PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-24 (24)
 

Clipboard (0)
None
Journals
Year of Publication
Document Types
1.  Metal-Based Antibacterial and Antifungal Agents: Synthesis, Characterization, and In Vitro Biological Evaluation of Co(II), Cu(II), Ni(II), and Zn(II) Complexes With Amino Acid-Derived Compounds 
A series of antibacterial and antifungal amino acid-derived compounds and their cobalt(II), copper(II), nickel(II), and zinc(II) metal complexes have been synthesized and characterized by their elemental analyses, molar conductances, magnetic moments, and IR, and electronic spectral measurements. Ligands (L1)−(L5) were derived by condensation of β-diketones with glycine, phenylalanine, valine, and histidine and act as bidentate towards metal ions (cobalt, copper, nickel, and zinc) via the azomethine-N and deprotonated-O of the respective amino acid. The stoichiometric reaction between the metal(II) ion and synthesized ligands in molar ratio of M : L (1 : 1) resulted in the formation of the metal complexes of type [M(L)(H2O)4]Cl (where M = Co(II), Cu(II), and Zn(II)) and of M : L (1 : 2) of type [M(L)2(H2O)2] (where M = Co(II), Cu(II), Ni(II), and Zn(II)). The magnetic moment data suggested for the complexes to have an octahedral geometry around the central metal atom. The electronic spectral data also supported the same octahedral geometry of the complexes. Elemental analyses and NMR spectral data of the ligands and their metal(II) complexes agree with their proposed structures. The synthesized ligands, along with their metal(II) complexes, were screened for their in vitro antibacterial activity against four Gram-negative (Escherichia coli, Shigella flexeneri, Pseudomonas aeruginosa, and Salmonella typhi) and two Gram-positive (Bacillus subtilis and Staphylococcus aureus) bacterial strains and for in vitro antifungal activity against Trichophyton longifusus, Candida albicans, Aspergillus flavus, Microsporum canis, Fusarium solani, and Candida glaberata. The results of these studies show the metal(II) complexes to be more antibacterial/antifungal against one or more species as compared to the uncomplexed ligands. The brine shrimp bioassay was also carried out to study their in vitro cytotoxic properties. Five compounds, (3), (7), (10), (11), and (22), displayed potent cytotoxic activity as LD50 = 8.974 × 10−4, 7.022 × 10−4, 8.839 × 10−4, 7.133 × 10−4, and 9.725 × 10−4 M/mL, respectively, against Artemia salina.
doi:10.1155/BCA/2006/83131
PMCID: PMC1800917  PMID: 17497020
2.  Proposal for Sets of 77Se NMR Chemical Shifts in Planar and Perpendicular Orientations of Aryl Group and the Applications 
The orientational effect of p-YC6H4 (Ar) on δ(Se) is elucidated for ArSeR, based on experimental and theoretical investigations. Sets of δ(Se) are proposed for pl and pd employing 9-(arylselanyl)anthracenes (1) and 1-(arylselanyl)anthraquinones (2), respectively, where Se–CR in ArSeR is on the Ar plane in pl and perpendicular to the plane in pd. Absolute magnetic shielding tensors of Se (σ(Se)) are calculated for ArSeR (R = H, Me, and Ph), assuming pl and pd, with the DFT-GIAO method. Observed characters are well reproduced by the total shielding tensors (σt(Se)). The paramagnetic terms (σP(Se)) are governed by σP(Se)xx + σP(Se)yy, where the direction of nP(Se) is set to the z-axis. The mechanisms of the orientational effect are established both for pl and pd. Sets of δ(Se: 1) and δ(Se: 2) act as the standards for pl and pd, respectively, when δ(Se) of ArSeR are analyzed based on the orientational effect.
doi:10.1155/BCA/2006/79327
PMCID: PMC1800916  PMID: 17497018
3.  Reactions Between Chalcogen Donors and Dihalogens/Interalogens: Typology of Products and Their Characterization by FT-Raman Spectroscopy 
The chemical bond and structural features for the most important classes of solid products obtained by reacting chalcogen donors with dihalogens and interhalogens are reviewed. Particular attention is paid to the information the FT-Raman spectroscopy can confidently give about each structural motif considered in the absence of X-ray structural analyses.
doi:10.1155/BCA/2006/58937
PMCID: PMC1800915  PMID: 17497008
4.  Kinetic Study of DNA Modification by Phthalocyanine Derivative of the Oligonucleotide 
Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the last decades. One actively pursued approach involves antisense or antigene constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. In this study, we have investigated the kinetics and thermodynamics of sequence-specific modification of DNA with deoxyribooligonucleotide linked to Co(II)-tetracarboxyphthalocyanine (PtcCo(II)) in the presence of H2O2.
doi:10.1155/BCA/2006/23560
PMCID: PMC1800914  PMID: 17497004
5.  Pressure-Tuning Raman Spectra of Diiodine Thioamide Compounds: Models for Antithyroid Drug Activity 
The pressure-tuning Raman spectra of five solid, diiodine heterocyclic thioamide compounds (mbztS)I2 (mbztS = N-methyl-2-mercaptobenzothiazole) (1); [(mbztS)2I]+[I7]− (2); (pySH)I2 (pySH = 2-mercaptopyridine) (3); [(pySH)(pyS]+[I3]− (4); (thpm)(I2)2 or possibly [(thpm)I2]+[I3]− (thpm = 2-mercapto-3,4,5,6-tertahydropyrimidine (5) have been measured for pressures up to ∼ 50 kbar using a diamond-anvil cell. Compounds 1, 4, and 5 undergo pressure-induced phase transitions at ∼ 35, ∼ 25, and ∼ 32 kbar, respectively. Following the phase transition in 1, the pressure dependences of the vibrational modes, which were originally located at 84, 111, and 161 cm−1 and are associated with the S⋯I–I linkage, are 2.08, 1.78, and 0.57 cm−1/kbar, respectively. These pressure dependences are typical of low-energy vibrations. The pressure-tuning FT-Raman results for the pairs of compounds 1 , 2, 3, and 4 are remarkably similar to each other suggesting that the compounds are most probably perturbed diiodide compounds rather than ionic ones. The Raman data for 5 show that it is best formulated as (thpm)(I2)2 rather than [(thpm)2I]+[I3]−.
doi:10.1155/BCA/2006/68542
PMCID: PMC1794079  PMID: 17497015
6.  Protective Effect of Meso-Tetrakis-(3,5-di-tert-butyl-4-hydroxyphenyl)porphyrin on the In Vivo Impact of Trimethyltin Chloride on the Antioxidative Defense System 
The in vivo effect of trimethyltin chloride (Me3SnCl), free base meso-tetrakis(3,5-di-tert-butyl-4-hydroxyphenyl)porphyrin (R′4PH2) and their equimolar mixture, on the enzymatic activity of catalase (CAT), superoxide dismutase (SOD), and on the total content of free sulfhydryl groups has been studied in rat liver and kidney. It was demonstrated that the simultaneous treatment of tested animals with the combination of Me3SnCl and R′4PH2 reduced the toxic impact of Me3SnCl.
doi:10.1155/BCA/2006/64927
PMCID: PMC1794078  PMID: 17497013
7.  Interaction of Thioamides, Selenoamides, and Amides With Diiodine 
We review the results of our work on the iodine interaction with thioamides, selenoamides, and amides. Complexes with (i) “spoke” or “extended spoke” structures, D · I2 and D · I2 · I2, respectively, (D is the ligand donor) (ii) iodonium salts of {[D2 − I]+[In]−} (n = 3, 7) and {[D2 − I]+[FeCl4]−} formulae and (iii) disulfides of the categories (a) [D − D], (b) {[D − DH]+[I3]−} have been isolated and characterized. A compound of formula {[D2 − I]+[I3]−[D · I2]} containing both types of complexes (i) and (ii) was also isolated. The interaction of diiodine with selenium analogs of the antithyroid drug 6-n-propyl-2-thiouracil (PTU), of formulae RSeU (6-alkyl-2-Selenouracil) results in the formation of complexes with formulae [(RSeU)I2]. All these results are correlated with the mechanism of action of antithyroid drugs. Finally, we review here our work on the diiodine interaction with the amides (LO).
doi:10.1155/BCA/2006/60291
PMCID: PMC1794077  PMID: 17497011
8.  Bioinorganic Chemistry in Thyroid Gland: Effect of Antithyroid Drugs on Peroxidase-Catalyzed Oxidation and Iodination Reactions 
Propylthiouracil (PTU) and methimazole (MMI) are the most commonly used antithyroid drugs. The available data suggest that these drugs may block the thyroid hormone synthesis by inhibiting the thyroid peroxidase (TPO) or diverting oxidized iodides away from thyroglobulin. It is also known that PTU inhibits the selenocysteine-containing enzyme ID-1 by reacting with the selenenyl iodide intermediate (E-SeI). In view of the current interest in antithyroid drugs, we have recently carried out biomimetic studies to understand the mechanism by which the antithyroid drugs inhibit the thyroid hormone synthesis and found that the replacement of sulfur with selenium in MMI leads to an interesting compound that may reversibly block the thyroid hormone synthesis. Our recent results on the inhibition of lactoperoxidase (LPO)-catalyzed oxidation and iodination reactions by antithyroid drugs are described.
doi:10.1155/BCA/2006/23214
PMCID: PMC1794076  PMID: 17497002
9.  Design and Synthesis of Redox-Switched Lariat Ethers and Their Application for Transport of Alkali and Alkaline-Earth Metal Cations Across Supported Liquid Membrane 
A new class of redox-switched anthraquinone derived lariat ethers 1-(1-anthraquinonyloxy) 3, 6, 9 trioxaundecane 11-ol (M1), 1-(1-anthraquinonyloxy) 3, 6 dioxaoctane 9-ol (M2), 1-(1-anthraquinonyloxy) 3 oxapentane 5-ol (M3), 1-(1-anthraquinonyloxy) 3 oxapentane 5-butane (M4), 1-(1-anthraquinonyloxy) 3, 6 dioxaoctane 9-methane (M5) and 1-(1-anthraquinonyloxy) 3 oxapentane 5-methane (M6) have been synthesized and characterized by spectral analysis. These ionophores were used in liquid membrane carrier facilitated transport of main group metal cations across supported liquid membrane (SLM). Cellulose nitrate membrane was used as membrane support. Effect of various parameters such as variation in concentration of metal as well as ionophore, effect of chain length and end group of ionophore have been studied. The sequence of metal ions transported by ionophore M1 is Na+ > Li+ > K+ > Ca2+ > Mg2+ and the order of metal ions transported by ionophores (M2–M6) is Li+ > Na+ > K+ > Ca2+ > Mg2+. Ionophore M1 is selective for Na+, Li+, and K+ and ionophores (M2–M6) are selective for Li+ and Na+.
doi:10.1155/BCA/2006/97141
PMCID: PMC1779550  PMID: 17497021
10.  Synthesis, Superoxide Dismutase Mimetic and Anticancer Activities of Metal Complexes of 2,2-Dimethylpentanedioic Acid(2dmepdaH2) and 3,3-Dimethylpentanedioic acid(3dmepdaH2): X-Ray Crystal Structures of [Cu(3dmepda)(bipy)]2· 6H2O and [Cu(2dmepda)(bipy)(EtOH)]2· 4EtOH (bipy = 2,2′Bipyridine) 
2,2-dimethylpentanedioic acid (2dmepdaH2) and 3,3-dimethylpentanedioic acid (3dmepdaH2) reacted with copper(II) acetate to give [Cu(2dmepda)(H2O)3]2 (1) and [Cu(3dmepda)(H2O)3]2 (2). Reaction of (1) and (2) with 1,10-phenanthroline and 2,2′-bipyridine yielded [Cu(2dmepda)(phen)(H2O)]20.5phen (3), [Cu(2dmepda)(bipy)(H2O)]2 (4), [Cu(2dmepda)(bipy)(EtOH)]2· 2EtOH (4A), [Cu(3dmepda)(phen)(H2O)]2 (5), and [Cu(3dmepda)(bipy)(H2O)]2· (6). The structures of (4A) and (6) each consists of a [Cu(bipy)(dicarboxylate)(solvent)]2 dimer. The superoxide dismutase (SOD) mimetic activity of the novel copper complexes and their manganese analogues was investigated. The dimethyl sulphoxide(DMSO) soluble complexes (1)–(4) and (6) were assessed for their cancer chemotherapeutic potential towards hepatocellular carcinoma and kidney adenocarcinoma cell lines. The 1,10-phenanthroline containing complex [Cu(2dmepda)(phen)(H2O)]20.5phen (3) was the most potent with activity that compares well to that of cisplatin.
doi:10.1155/BCA/2006/80283
PMCID: PMC1779549  PMID: 17497019
11.  Antihuman Immunodeficiency Virus Type 1 (HIV-1) Activity of Rare Earth Metal Complexes of 4-Hydroxycoumarins in Cell Culture 
The cerium Ce(III), lanthanum La(III), and neodymium Nd(III) complexes with 4-hydroxy-3-(3-oxo-1-phenylbutyl)-2H-1-benzopyran-2-one (warfarin) (W) and 3,3′-benzylidenebis[4-hydroxycoumarin] (1) were synthesized and studied for the first time for cytotoxicity (on MT-2 cells) and as anti-HIV agents under acute and chronic infection. The complexes were characterized by different physicochemical methods: mass spectrometry, 1H NMR, 13C NMR, and IR spectroscopy. The spectra of the complexes were interpreted on the basis of comparison with the spectrum of the free ligands. Anti-HIV effect of the complexes/ligands was measured in MT-2 cells by microtiter infection assay. Detection of endogenous reverse transcriptase (RT) activity and RT processivity by PCR indicative for proviral DNA synthesis demonstrated that anti-HIV activity has not been linked to early stages of viral replication. No effect on late steps of viral replication has been found using cells chronically producing HIV-1LAI virus. La(W) demonstrated anti-HIV activity (IC50=21.4 μM) close to maximal nontoxic concentration. Nd(W), Ce(1), and Nd(1) demonstrated limited anti-HIV potency, so none of the complexes seems appropriate to be used in clinic. Further targeting of HIV-1 inhibition by La(W) is under progress.
doi:10.1155/BCA/2006/71938
PMCID: PMC1779548  PMID: 17497016
12.  Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification 
Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.
doi:10.1155/BCA/2006/63703
PMCID: PMC1779547  PMID: 17497012
13.  Synthesis, Characterization, and Cytotoxic Activity of New Lanthanum(III) Complexes of Bis-Coumarins 
Complexes of lanthanum(III) with bis-coumarins: 3,3′-benzylidene-bis(4-hydroxy-2H-1-benzopyran-2-one) (H2L1) and bis(4-hydroxy-2-oxo-2H-chromen-3-yl)-(1H-pyrazol-3-yl)-methane (H2L2) were synthesized by reaction of lanthanum(III) salt and the ligands, in amounts equal to metal : ligand molar ratio of 1 : 2. The complexes were prepared by adding an aqueous solution of lanthanum(III) salt to an aqueous solution of the ligand subsequently raising the pH of the mixture gradually to circa 5.0 by adding dilute solution of sodium hydroxide. The lanthanum(III) complexes with bis-coumarins were characterized by different physicochemical methods—elemental analysis, IR-, 1H-, and 13C-NMR-spectroscopies, and mass spectral data. The spectral data of lanthanum(III) complexes were interpreted on the basis of comparison with the spectra of the free ligands. This analysis showed that in the La(III) complexes, the ligands coordinated to the metal ion through both deprotonated hydroxyl groups. On the basis of the ν(C=O) red shift observed, participation of the carbonyl groups in the coordination with the metal ion was also suggested. In the present study, we performed a cytotoxic-effects screening of the lanthanum complexes with H2L1 and H2L2 in a panel of human tumor cell lines, using the standard MTT-dye reduction assay for cell viability. The panel consisted of the acute myeloid leukemia-derived HL-60 and the chronic myeloid leukemia-derived BV-173. Following a 24- hour treatment of BV-173 cells with lanthanum complex of H2L1 at 100 or 200 μM led to a DNA-laddering. The findings suggest that the observed cytotoxicity of the lanthanum complex of H2L1 on BV-173 is at least partly mediated through induction of programmed cell death.
doi:10.1155/BCA/2006/25651
PMCID: PMC1686302  PMID: 17497005
14.  Synthesis, Spectral, and Biological Properties of Copper(II) Complexes of Thiosemicarbazones of Schiff Bases Derived from 4-Aminoantipyrine and Aromatic Aldehydes 
We have synthesized a novel series of Schiff bases by condensation of 4-aminoantipyrine and various aromatic aldehydes followed by reaction with thiosemicarbazide. These thiosemicarbazones are potential ligands toward transition metal ions. The reaction of copper(II) salts with 4[N-(benzalidene)amino]antipyrinethiosemicarbazone (BAAPTS), 4[N-(4′-methoxybenzalidene) amino] antipyrinethiosemicarbozone (MBAAPTS), 4[N-(4′-dimethylamino benzalidene) amino] antipyrinethiosemicarbazone (DABAAPTS), and 4[N-(cinnamalidene) amino] antipyrinethiosemicarbazone (CAAPTS) resulted in the formation of solid complexes with the general composition CuX2 · (H2O)(L)(X = Cl, Br,NO3,NCS, or CH3COO; L = BAAPTS, MBAAPTS, DABAAPTS, or CAAPTS). These complexes were characterized through elemental analysis, molecular weight, electrical conductance, infrared, electronic spectra, and magnetic susceptibilities at room temperature. Copper(II) complexes with BAAPTS and MBAAPTS were screened for antibacterial and antifungal properties and have exhibited potential activity. Thermal stabilities of two representative complexes were also investigated.
doi:10.1155/BCA/2006/59509
PMCID: PMC1686301  PMID: 17497009
15.  Assessment of Toxicity of Some Penta- and Hexacoordinated Organotin(IV) and Tetracoordinated Tin(II) Complexes of Heterocyclic β-Diketones 
A number of penta- and hexacoordinated organotin(IV) complexes and tetracoordinated tin(II) complexes of compositions Me2SnCl[RCOC:CON(C6H5)N:C⎴CH3] (where R = − CH3, −p−ClC6H4, and −C6H5), Me2Sn[RCOC:CON(C6H5)N:C⎴CH3]2 (where R = −CH3, and −C6H5), and Sn(II) [RCOC:CON(C6H5)N:C⎴CH3]2 (where R = −p−ClC6H4 and −C6H5) were screened for their toxicity against Musca domestica (house fly). In general, organotin(IV) complexes contribute more to the activity than tin(II) complexes.
doi:10.1155/BCA/2006/60140
PMCID: PMC1686300  PMID: 17497010
16.  Antispermatogenic Activity of the Benzothiazoline Ligand and Corresponding Organoantimony(V) Derivative in Male Albino Rats 
Triphenylantimony(V) derivative, Ph3Sb(OPri) [SC6H4N : C(CH3)CH2C(O)CH3], 1b, and the corresponding benzothiazoline ligand [1, 2], HNC6H4SC⎴(CH3)CH2C(O)CH3, 1a, have been tested for their effects on the reproductive system of male albino rats. The oral administration of both 1a and 1b at the dose level of 10 mg/rat/day produced significant reduction in the weights of testes, epididymides, seminal vesicles, and ventral prostate. Significant decrease in sperm motility as well as in sperm density resulted in 100% sterility. Significant (P < .01) alterations were also found in biochemical parameters of reproductive organs in treated male rats as compared to the control group. Production of preleptotene, pachytene, and secondary spermatocytes was decreased by 42%, 43%, 39%, and by 44%, 49%, 55% in the ligand, 1a, and organoantimony(V) derivative, 1b, treated rats, respectively. These results indicate that both compounds 1a and 1b are antispermatogenic in nature and on oral administration in male rats, and finally caused sterility. A comparison indicates that the organoantimony(V) derivative 1b is more effective pertaining to its antispermatogenic activity than the corresponding ligand 1a.
doi:10.1155/BCA/2006/16895
PMCID: PMC1686299  PMID: 17496999
17.  Synthesis, Biological, Spectral, and Thermal Investigations of Cobalt(II) and Nickel(II) Complexes of N-Isonicotinamido -2′,4′-Dichlorobenzalaldimine 
A new series of 12 complexes of cobalt(II) and nickel(II) with N-isonicotinamido-2′,4′-dichlorobenzalaldimine (INH-DCB) with the general composition MX2 · n(INH-DCB) [M = Co(II) or Ni(II), X = Cl− ,Br−, NO3−, NCS−, or CH3COO−, n = 2; X = ClO4−, n = 3] have been synthesized. The nature of bonding and the stereochemistry of the complexes have been deduced from elemental analyses, infrared, electronic spectra, magnetic susceptibility, and conductivity measurements. An octahedral geometry has been suggested for all the complexes. The metal complexes were screened for their antifungal and antibacterial activities on different species of pathogenic fungi and bacteria and their biopotency has been discussed.
doi:10.1155/BCA/2006/29234
PMCID: PMC1686298  PMID: 17497006
18.  Fertility Regulation in Male Rats by Implemented Tetraazamacrocyclic Compounds of Iron(II): Synthetic, Spectroscopic, and Applied Aspects With Toxicological Screening 
Antifertility and histopathological investigations were carried out on reproductive organs of male albino rats induced by tetraazamacrocyclic complexes of iron(II). The complexes were synthesized by the template condensation of 1,2-diaminoethane, 1,3-diaminopropane with succinic acid and phthalic acid in 2 : 2 molar ratios which are abbreviated as [Fe(TAMLn)OAc] (n = 1 or 2 and TAMLn represents tetraazamacrocyclic ligand). The complexes have been characterized by elemental analysis, conductivity measurements, IR, and electronic spectra.
doi:10.1155/BCA/2006/17316
PMCID: PMC1686297  PMID: 17497000
19.  Effect of Benzothiazoline Ligand and Corresponding Organoantimony(V) Derivative on the Reproductive System of Male Rats 
Benzothiazoline HNC6H4SC⎴(C6H5)CH:C(OH)COOCH3 1 prepared by the condensation reaction of aroyl pyruvate and 2-aminothiophenol has been treated with Ph3Sb(OPri)2 to yield Ph3Sb[SC6H4NC(C6H5)CH:CO⎴COOCH3] 2. These compounds have been characterized by elemental analyses and molecular weight determinations. The probable structures of the ligand as well as antimony complex have been tentatively proposed on the basis of IR and NMR (1H and 13C) spectral evidences. Both compounds have been tested for their antifertility activity in male albino rats. The oral administration of compounds 1 and 2 at the dose level of 10 mg/rat/day significantly reduced the weights of testes, epididymides, ventral prostate, and seminal vesicles. The production of preleptotene spermatocytes was decreased by 36.57%; 57.23%, pachytene spermatocytes by 40.06%; 62.01%, and secondary spermatocytes by 52.45%; 63.22%, following the treatment of compounds 1 and 2, respectively. The marked reduction in sperm motility and density resulted in infertility by 100%. Significant (P < .01) alterations were found in biochemical parameters of reproductive organs in treated animals as compared to control group. It is concluded that all these effects may finally impair the fertility of male rats.
doi:10.1155/BCA/2006/20979
PMCID: PMC1686296  PMID: 17497001
20.  Synthetic, Structural, and Biochemical Studies of Organotin(IV) With Schiff Bases Having Nitrogen and Sulphur Donor Ligands 
Three bidentate Schiff bases having nitrogen and sulphur donor sequences were prepared by condensing S-benzyldithiocarbazate (NH2NHCS2CH2C6H5) with heterocyclic aldehydes. The reaction of diphenyltin dichloride with Schiff bases leads to the formation of a new series of organotin(IV) complexes. An attempt has been made to prove their structures on the basis of elemental analyses, conductance measurements, molecular weights determinations, UV, infrared, and multinuclear magnetic resonance (1H, 13C, and 119Sn) spectral studies. Organotin(IV) complexes were five- and six-coordinate. Schiff bases and their corresponding organotin complexes have also been screened for their antibacterial and antifungal activities and found to be quite active in this respect.
doi:10.1155/BCA/2006/23245
PMCID: PMC1686295  PMID: 17497003
21.  New Dihydro OO′Bis(Salicylidene) 2,2′ Aminobenzothiazolyl Borate Complexes: Kinetic and Voltammetric Studies of Dimethyltin Copper Complex with Guanine, Adenine, and Calf Thymus DNA 
The newly synthesized ligand, dihydro OO′bis(salicylidene) 2,2′ aminobenzothiazolyl borate (2), was derived from the reaction of Schiff base of 2-aminobenzothiazole and salicylaldehyde with KBH4. CuII (3) and ZnII (4) complexes of (2) were synthesized and further metallated with dimethyltindichloride to yield heterobimetallic complexes (5) and (6). All complexes have been thoroughly characterized by elemental analysis, and IR, NMR, EPR, and UV-Vis spectroscopy and conductance measurements. The spectroscopic data support square planar environment around the CuII atom, while the SnIV atom acquires pentacoordinate geometry. The interaction of complex (5) with guanine, adenine, and calf thymus DNA was studied by spectrophotometric, electrochemical, and kinetic methods. The absorption spectra of complex (5) exhibit a remarkable “hyperchromic effect” in the presence of guanine and calf thymus DNA. Indicative of strong binding of the complex to calf thymus DNA preferentially binds through N7 position of guanine base, while the adenine shows binding to a lesser extent. The kinetic data were obtained from the rate constants, kobs, values under pseudo-first-order conditions. Cyclic voltammetry was employed to study the interaction of complex (5) with guanine, adenine, and calf thymus DNA. The CV of complex (5) in the absence and in the presence of guanine and calf thymus DNA altered drastically, with a positive shift in formal peak potential Epa and Epc values and a significant increase in peak current. The positive shift in formal potentials with increase in peak current favours strong interaction of complex (5) with calf thymus DNA. The net shift in E1/2 has been used to estimate the ratio of equilibrium constants for the binding of Cu(II) and Cu(I) complexes to calf thymus DNA.
doi:10.1155/BCA/2006/32896
PMCID: PMC1686294  PMID: 17497007
22.  Structure-Activity Relationships of Synthetic Coumarins as HIV-1 Inhibitors 
HIV/AIDS pandemics is a serious threat to health and development of mankind, and searching for effective anti-HIV agents remains actual. Considerable progress has been made in recent years in the field of drug development against HIV. A lot of structurally different coumarins were found to display potent anti-HIV activity. The current review demonstrates the variety of synthetic coumarins having unique mechanism of action referring to the different stages of HIV replication. Recent studies based on the account of various synthetic coumarins seem to indicate that some of them serve as potent non-nucleoside RT-inhibitors, another as inhibitors of HIV-integrase or HIV-protease. The merits of selecting potential anti-HIV agents to be used in rational combination drugs design and structure-activity relationships are discussed.The scientific community is looking actively for new drugs and combinations for treatment of HIV infection effective for first-line treatment, as well as against resistant mutants. The investigation on chemical anti-HIV agents gives hope and optimism about it. This review article describes recent progress in the discovery, structure modification, and structure-activity relationship studies of potent anti-HIV coumarin derivatives.
doi:10.1155/BCA/2006/68274
PMCID: PMC1686293  PMID: 17497014
23.  Synthesis, Characterization, and Biotoxicity of N N⌢ Donor Sulphonamide Imine Silicon(IV) Complexes 
The organosilicon derivatives of 2-[1-(2-furayl)ethyledene]sulphathiazole with organosilicon chlorides have been synthesised and characterized on the basis of analytical, conductance, and spectroscopic techniques. Probable trigonal bipyramidal and octahedral structures for the resulting derivatives have been proposed on the basis of electronic, IR, 1H, 13C NMR, and 29Si NMR spectral studies. In the search for better fungicides, bactericides, nematicides, and insecticides studies were conducted to assess the growth-inhibiting potential of the synthesized complexes against various pathogenic fungal, bacterial strains, root-knot nematode Meloidogyne incognita, and insect Trogoderma granarium. These studies demonstrate that the concentrations reached levels which are sufficient to inhibit and kill the pathogens, nematode, and insect.
doi:10.1155/BCA/2006/13743
PMCID: PMC1686292  PMID: 17496998
24.  Lanthanide(III) and Yttrium(III) Complexes of Benzimidazole-2-Acetic Acid: Synthesis, Characterisation and Effect of La(III) Complex on Germination of Wheat 
The synthesis and characterisation of lanthanide(III) and yttrium(III) nitrate complexes of benzimidazole-2-acetic acid (HBIA) are reported. The complexes have been characterised by elemental analysis, molar conductance, magnetic studies, IR, 1H NMR, UV-visible, EPR, and TG/DTA studies. They have the stoichiometry [Ln3(BIA)2(NO3)7(H2O)4] · 3H2O where Ln=La(III), Pr(III), Nd(II), Sm(III), Eu(III), Gd(III), Tb(III), Dy(III), and Y(III). The effect of La(III) complex on germination, coleoptile, and root length of two local varieties of wheat DWR-195 and GW-349 for different treatment periods has been investigated. The complex was found to exhibit enhanced activity, compared to HBIA or metal salt alone at lower treatment periods.
doi:10.1155/BCA/2006/75612
PMCID: PMC1686291  PMID: 17497017

Results 1-24 (24)