PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (28)
 

Clipboard (0)
None
Journals
Year of Publication
1.  Osteoconductivity and Hydrophilicity of TiO2 Coatings on Ti Substrates Prepared by Different Oxidizing Processes 
Various techniques for forming TiO2 coatings on Ti have been investigated for the improvement of the osteoconductivity of Ti implants. However, it is not clear how the oxidizing process affects this osteoconductivity. In this study, TiO2 coatings were prepared using the following three processes: anodizing in 0.1 M H3PO4 or 0.1 M NaOH aqueous solution; thermal oxidation at 673 K for 2 h in air; and a two-step process of anodizing followed by thermal oxidation. The oxide coatings were evaluated using SEM, XRD, and XPS. The water contact angle on the TiO2 coatings was measured as a surface property. The osteoconductivity of these samples was evaluated by measuring the contact ratio of formed hard tissue on the implanted samples (defined as the RB-I value) after 14 d implantation in rats' tibias. Anatase was formed by anodizing and rutile by thermal oxidation, but the difference in the TiO2 crystal structure did not influence the osteoconductivity. Anodized TiO2 coatings were hydrophilic, but thermally oxidized TiO2 coatings were less hydrophilic than anodized TiO2 coatings because they lacked in surface OH groups. The TiO2 coating process using anodizing without thermal oxidation gave effective improvement of the osteoconductivity of Ti samples.
doi:10.1155/2012/495218
PMCID: PMC3535825  PMID: 23316128
2.  Studies on Synthetic and Natural Melanin and Its Affinity for Fe(III) Ion 
In this work, we measured the metal-binding sites of natural and synthetic dihydroxyindole (DHI) melanins and their respective interactions with Fe(III) ions. Besides the two acid groups detected for the DHI system: catechol (Cat) and quinone-imine (QI), acetate groups were detected in the natural oligomer by potentiometric titrations. At acidic pH values, Fe(III) complexation with synthetic melanin was detected in an Fe(OH)(CatH2Cat) interaction. With an increase of pH, three new interactions occurred: dihydroxide diprotonated catechol, Fe(OH)2(CatH2Cat)−, dihydroxide monoprotonated catechol, [Fe(OH)2(CatHCat)]2−, and an interaction resulting from the association of one quinone-imine and a catechol group, [Fe(OH)2(Qi−)(CatHCat)]3−. In the natural melanin system, we detected the same interactions involving catechol and quinone-imine groups but also the metal interacts with acetate group at pH values lower than 4.0. Furthermore, interactions in the synthetic system were also characterized by infrared spectroscopy by using the characteristic vibrations of catechol and quinone-imine groups. Finally, scanning electronic microscopy (SEM) and energy-dispersive X-ray (EDS) analysis were used to examine the differences in morphology of these two systems in the absence and presence of Fe(III) ions. The mole ratio of metal and donor atoms was obtained by the EDS analysis.
doi:10.1155/2012/712840
PMCID: PMC3521465  PMID: 23251127
3.  Thermodynamic Investigation and Mixed Ligand Complex Formation of 1,4-Bis-(3-aminopropyl)-piperazine and Biorelevant Ligands 
Thermodynamic parameters for protonation of 1,4-bis(3-aminopropyl)-piperazine (BAPP) and its metal complexation with some divalent metal ions were determined in aqueous solution at constant ionic strength (0.1 M NaNO3) using a potentiometric technique. The order of –ΔG0 and –ΔH0 was found to obey Co2+ < Ni2+ < Cu2+ > Zn2+, in accordance with the Irving-Williams order. The formation equilibria of zinc (II) complexes and the ternary complexes Zn(BAPP)L, where L = amino acid, amides, or DNA constituents), have been investigated. Ternary complexes are formed by a simultaneous mechanism. The concentration distribution of the complexes in solution was evaluated as a function of pH. Stoichiometry and stability constants for the complexes formed are reported and discussed. The stability of ternary complexes was quantitatively compared with their corresponding binary complexes in terms of the parameter Δlog K.
doi:10.1155/2012/984291
PMCID: PMC3513716  PMID: 23226992
4.  Spectroscopic, Thermal, and Antimicrobial Studies of Co(II), Ni(II), Cu(II), and Zn(II) Complexes Derived from Bidentate Ligands Containing N and S Donor Atoms 
Two new heterocyclic Schiff bases of 4-amino-5-mercapto-3-H/propyl-1,2,4-triazole and 5-nitrofurfuraldehyde [HL1-2] and their cobalt, nickel, copper, and zinc complexes have been synthesized and characterized by elemental analyses, spectral (UV-Vis, IR, 1H NMR, Fluorescence, and ESR) studies, thermal techniques, and magnetic moment measurements. The heterocyclic Schiff bases act as bidentate ligands and coordinate with metal ions through nitrogen and sulphur of the thiol group. The low molar conductance values in DMF indicate that the metal complexes are nonelectrolytes. The magnetic moments and electronic spectral data suggest octahedral geometry for the Co(II), Ni(II), and Zn(II) complexes and square planar for Cu(II) complexes. Two Gram-positive bacteria (Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121), two Gram-negative bacteria (Escherichia coli MTCC 1652 and Pseudomonas aeruginosa MTCC 741), and one yeast, Candida albicans, were used for the evaluation of antimicrobial activity of the newly synthesized compounds.
doi:10.1155/2012/729708
PMCID: PMC3512225  PMID: 23226991
5.  Computational Study of the Structure of a Sepiolite/Thioindigo Mayan Pigment 
The interaction of thioindigo and the phyllosilicate clay sepiolite is investigated using density functional theory (DFT) and molecular orbital theory (MO). The best fit to experimental UV/Vis spectra occurs when a single thioindigo molecule attaches via Van der Waals forces to a tetrahedrally coordinated Al3+ cation with an additional nearby tetrahedrally coordinated Al3+ also present. The thioindigo molecule distorts from its planar structure, a behavior consistent with a color change. Due to the weak interaction between thioindigo and sepiolite we conclude that the thioindigo molecule must be trapped in a channel, an observation consistent with previous experimental studies. Future computational studies will look at the interaction of indigo with sepiolite.
doi:10.1155/2012/672562
PMCID: PMC3501801  PMID: 23193386
6.  Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL 
The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.
doi:10.1155/2012/649640
PMCID: PMC3485869  PMID: 23133406
7.  Synthesis, Spectroscopic Characterization, and In Vitro Antimicrobial Studies of Pyridine-2-Carboxylic Acid N′-(4-Chloro-Benzoyl)-Hydrazide and Its Co(II), Ni(II), and Cu(II) Complexes 
N-substituted pyridine hydrazide (pyridine-2-carbonyl chloride and 4-chloro-benzoic acid hydrazide) undergoes hydrazide formation of the iminic carbon nitrogen double bond through its reaction with cobalt(II), nickel(II), and copper(II) metal salts in ethanol which are reported and characterized based on elemental analyses, IR, solid reflectance, magnetic moment, molar conductance, and thermal analysis (TG). From the elemental analyses data, 1 : 2 metal complexes are formed having the general formulae [MCl2(HL)2] ·yH2O (where M = Co(II), Ni(II), and Cu(II), y = 1–3). The important infrared (IR) spectral bands corresponding to the active groups in the ligand and the solid complexes under investigation were studied. IR spectra show that ligand is coordinated to the metal ions in a neutral bidentate manner with ON donor sites. The solid complexes have been synthesized and studied by thermogravimetric analysis. All the metal chelates are found to be nonelectrolytes. From the magnetic and solid reflectance spectra, the complexes (cobalt(II), nickel(II), and copper(II)) have octahedral and square planner geometry, respectively. The antibacterial and antifungal activity's data show that the metal complexes have a promising biological activity comparable with the parent ligand against bacterial and fungal species.
doi:10.1155/2012/104549
PMCID: PMC3485482  PMID: 23125560
8.  Spectroscopic Characterization and Biological Activity of Mixed Ligand Complexes of Ni(II) with 1,10-Phenanthroline and Heterocyclic Schiff Bases 
Mixed ligand complexes of Ni(II) with 1,10-phenanthroline (1,10-Phen) and Schiff bases L1(MIIMP); L2(CMIIMP); L3(EMIIMP); L4(MIIMNP); L5(MEMIIMP); L6(BMIIMP); L7(MMIIMP); L8(MIIBD) have been synthesized. These metal chelates have been characterized by elemental analysis, IR, 1H-NMR, 13C-NMR, Mass, UV-Vis, magnetic moments, and thermogravimetric (TG&DTA) analysis. Spectral data showed that the 1,10-phenanthroline act as neutral bidentate ligand coordinating to the metal ion through two nitrogen donor atoms and Schiff bases acts as monobasic bidentate coordinating through NO donor atoms. All Ni(II) complexes appear to have an octahedral geometry. The antimicrobial activity of mixed ligand complexes has been studied by screening against various microorganisms, it is observed that the activity enhances upon coordination. The DNA binding studies have been investigated by UV-Vis spectroscopy, and the experimental results indicate that these complexes bind to CT DNA with the intrinsic binding constant Kb = 2.5 ± 0.2 × 105 M−1. MTT is used to test the anticancer effect of the complexes with HL60 tumor cell. The inhibition ratio was accelerated by increasing the dosage, and it had significant positive correlation with the medication dosage.
doi:10.1155/2012/948534
PMCID: PMC3467759  PMID: 23082074
9.  DNA-Binding and Topoisomerase-I-Suppressing Activities of Novel Vanadium Compound Van-7 
Vanadium compounds were studied during recent years to be considered as a representative of a new class of nonplatinum metal anticancer agents in combination to its low toxicity. Here, we found a vanadium compound Van-7 as an inhibitor of Topo I other than Topo II using topoisomerase-mediated supercoiled DNA relaxation assay. Agarose gel electrophoresis and comet assay showed that Van-7 treatment did not produce cleavable complexes like HCPT, thereby suggesting that Topo I inhibition occurred upstream of the relegation step. Further studies revealed that Van-7 inhibited Topo I DNA binding involved in its intercalating DNA. Van-7 did not affect the catalytic activity of DNase I even up to100 μM. Van-7 significantly suppressed the growth of cancer cell lines with IC50 at nanomolar concentrations and arrested cell cycle of A549 cells at G2/M phase. All these results indicate that Van-7 is a potential selective Topo I inhibitor with anticancer activities as a kind of Topo I suppressor, not Topo I poison.
doi:10.1155/2012/756374
PMCID: PMC3465879  PMID: 23055949
10.  Biosorption of Mercury (II) from Aqueous Solutions onto Fungal Biomass 
The biosorption of mercury (II) on 14 fungal biomasses, Aspergillus flavus I–V, Aspergillus fumigatus I-II, Helminthosporium sp., Cladosporium sp., Mucor rouxii mutant, M. rouxii IM-80, Mucor sp 1 and 2, and Candida albicans, was studied in this work. It was found that the biomasses of the fungus M. rouxii IM-80, M. rouxii mutant, Mucor sp1, and Mucor sp 2 were very efficient removing the metal in solution, using dithizone, reaching the next percentage of removals: 95.3%, 88.7%, 80.4%, and 78.3%, respectively. The highest adsorption was obtained at pH 5.5, at 30°C after 24 hours of incubation, with 1 g/100 mL of fungal biomass.
doi:10.1155/2012/156190
PMCID: PMC3458410  PMID: 23028382
11.  SOD-Mimic Cu(II) Dimeric Complexes Involving Kinetin and Its Derivative: Preparation and Characterization 
Two SOD-mimic active dimeric Cu(II) chlorido complexes of the compositions [Cu2(μ-HL1)4Cl2]Cl2 (1) and [Cu2(μ-HL2)2(μ-Cl)2(HL2)2Cl2] · 4H2O (2) involving the cosmetologically relevant cytokinin kinetin (N6-furfuryladenine, HL1) and its derivative N6-(5-methylfurfuryl)adenine (HL2) have been synthesized and characterized by elemental analysis, infrared, and electronic spectroscopy, ESI+ mass spectrometry, conductivity and temperature dependence of magnetic susceptibility measurements, and thermogravimetric (TG) and differential thermal (DTA) analyses. The results of these methods, particularly the temperature dependence of magnetic susceptibility, showed the complexes to be dimeric with a strong antiferromagnetic exchange (J = −290 cm−1 for complex 1 and J = −160 cm−1 for 2). The complexes have been identified as auspicious SOD-mimics, as their antiradical activity evaluated by the in vitro SOD-mimic assay resulted in the IC50 values equal to 8.13 μM (1) and 0.71 μM (2).
doi:10.1155/2012/704329
PMCID: PMC3433123  PMID: 22966218
12.  Synthesis Characterization and DNA Interaction Studies of a New Zn(II) Complex Containing Different Dinitrogen Aromatic Ligands 
A mononuclear complex of Zn(II), [Zn(DIP)2 (DMP)] (NO3)2·2H2O in which DIP is 4,7-diphenyl-1,10-phenanthroline and DMP is 4,4′-dimethyl-2,2′-bipyridine has been prepared and characterized by 1HNMR spectroscopy, FT-IR, UV-Vis and elemental analysis techniques. DNA-binding properties of the complex were studied using UV-vis spectra, circular dichroism (CD) spectra, fluorescence, cyclic voltammetry (CV), and viscosity measurements. The results indicate that this zinc(II) complex can intercalate into the stacked base pairs of DNA and compete with the strong intercalator ethidium bromide for the intercalative binding sites.
doi:10.1155/2012/571913
PMCID: PMC3432521  PMID: 22956919
14.  Binding Studies of a New Water-Soluble Iron(III) Schiff Base Complex to DNA Using Multispectroscopic Methods 
A novel iron(III) complex [Fe(SF)](ClO4)3.2H2O; in which SF = N,N0-bis{5-[(triphenylphosphonium chloride)-methyl] salicylidene}-o-phenylenediamine) has been synthesized and characterized using different physicochemical methods. The binding of this complex with calf thymus (CT) DNA was investigated by circular dichroism, absorption studies, emission spectroscopy, voltammetric studies, and viscosity measurements. The results showed that this complex can bind to DNA via external and groove binding modes.
doi:10.1155/2012/126451
PMCID: PMC3415175  PMID: 22899896
15.  Immobilization of Laccase in Alginate-Gelatin Mixed Gel and Decolorization of Synthetic Dyes 
Alginate-gelatin mixed gel was applied to immobilized laccase for decolorization of some synthetic dyes including crystal violet. The immobilization procedure was accomplished by adding alginate to a gelatin solution containing the enzyme and the subsequent dropwise addition of the mixture into a stirred CaCl2 solution. The obtained data showed that both immobilized and free enzymes acted optimally at 50°C for removal of crystal violet, but the entrapped enzyme showed higher thermal stability compared to the free enzyme. The immobilized enzyme represented optimum decolorization at pH 8. Reusability of the entrapped laccase was also studied and the results showed that ca. 85% activity was retained after five successive cycles. The best removal condition was applied for decolorization of seven other synthetic dyes. Results showed that the maximum and minimum dye removal was related to amido black 10B and eosin, respectively.
doi:10.1155/2012/823830
PMCID: PMC3415199  PMID: 22899898
16.  Fine Tuning of Redox Networks on Multiheme Cytochromes from Geobacter sulfurreducens Drives Physiological Electron/Proton Energy Transduction 
The bacterium Geobacter sulfurreducens (Gs) can grow in the presence of extracellular terminal acceptors, a property that is currently explored to harvest electricity from aquatic sediments and waste organic matter into microbial fuel cells. A family composed of five triheme cytochromes (PpcA-E) was identified in Gs. These cytochromes play a crucial role by bridging the electron transfer from oxidation of cytoplasmic donors to the cell exterior and assisting the reduction of extracellular terminal acceptors. The detailed thermodynamic characterization of such proteins showed that PpcA and PpcD have an important redox-Bohr effect that might implicate these proteins in the e−/H+ coupling mechanisms to sustain cellular growth. The physiological relevance of the redox-Bohr effect in these proteins was studied by determining the fractional contribution of each individual redox-microstate at different pH values. For both proteins, oxidation progresses from a particular protonated microstate to a particular deprotonated one, over specific pH ranges. The preferred e−/H+ transfer pathway established by the selected microstates indicates that both proteins are functionally designed to couple e−/H+ transfer at the physiological pH range for cellular growth.
doi:10.1155/2012/298739
PMCID: PMC3415244  PMID: 22899897
17.  Alkene Cleavage Catalysed by Heme and Nonheme Enzymes: Reaction Mechanisms and Biocatalytic Applications 
The oxidative cleavage of alkenes is classically performed by chemical methods, although they display several drawbacks. Ozonolysis requires harsh conditions (−78°C, for a safe process) and reducing reagents in a molar amount, whereas the use of poisonous heavy metals such as Cr, Os, or Ru as catalysts is additionally plagued by low yield and selectivity. Conversely, heme and nonheme enzymes can catalyse the oxidative alkene cleavage at ambient temperature and atmospheric pressure in an aqueous buffer, showing excellent chemo- and regioselectivities in certain cases. This paper focuses on the alkene cleavage catalysed by iron cofactor-dependent enzymes encompassing the reaction mechanisms (in case where it is known) and the application of these enzymes in biocatalysis.
doi:10.1155/2012/626909
PMCID: PMC3395118  PMID: 22811656
18.  Physicochemical Properties and Cellular Responses of Strontium-Doped Gypsum Biomaterials 
This paper describes some physical, structural, and biological properties of gypsum bioceramics doped with various amounts of strontium ions (0.19–2.23 wt%) and compares these properties with those of a pure gypsum as control. Strontium-doped gypsum (gypsum:Sr) was obtained by mixing calcium sulfate hemihydrate powder and solutions of strontium nitrate followed by washing the specimens with distilled water to remove residual salts. Gypsum was the only phase found in the composition of both pure and gypsum:Sr, meanwhile a shift into lower diffraction angles was observed in the X-ray diffraction patterns of doped specimens. Microstructure of all gypsum specimens consisted of many rod-like small crystals entangled to each other with more elongation and higher thickness in the case of gypsum:Sr. The Sr-doped sample exhibited higher compressive strength and lower solubility than pure gypsum. A continuous release of strontium ions was observed from the gypsum:Sr during soaking it in simulated body fluid for 14 days. Compared to pure gypsum, the osteoblasts cultured on strontium-doped samples showed better proliferation rate and higher alkaline phosphatase activity, depending on Sr concentration. These observations can predict better in vivo behavior of strontium-doped gypsum compared to pure one.
doi:10.1155/2012/976495
PMCID: PMC3375162  PMID: 22719270
19.  Behavior and Distribution of Heavy Metals Including Rare Earth Elements, Thorium, and Uranium in Sludge from Industry Water Treatment Plant and Recovery Method of Metals by Biosurfactants Application 
In order to investigate the behavior, distribution, and characteristics of heavy metals including rare earth elements (REEs), thorium (Th), and uranium (U) in sludge, the total and fractional concentrations of these elements in sludge collected from an industry water treatment plant were determined and compared with those in natural soil. In addition, the removal/recovery process of heavy metals (Pb, Cr, and Ni) from the polluted sludge was studied with biosurfactant (saponin and sophorolipid) elution by batch and column experiments to evaluate the efficiency of biosurfactant for the removal of heavy metals. Consequently, the following matters have been largely clarified. (1) Heavy metallic elements in sludge have generally larger concentrations and exist as more unstable fraction than those in natural soil. (2) Nonionic saponin including carboxyl group is more efficient than sophorolipid for the removal of heavy metals in polluted sludge. Saponin has selectivity for the mobilization of heavy metals and mainly reacts with heavy metals in F3 (the fraction bound to carbonates) and F5 (the fraction bound to Fe-Mn oxides). (3) The recovery efficiency of heavy metals (Pb, Ni, and Cr) reached about 90–100% using a precipitation method with alkaline solution.
doi:10.1155/2012/173819
PMCID: PMC3368164  PMID: 22693485
20.  Binuclear Cu(II) and Co(II) Complexes of Tridentate Heterocyclic Shiff Base Derived from Salicylaldehyde with 4-Aminoantipyrine 
New binuclear Co(II) and Co(II) complexes of ONO tridentate heterocyclic Schiff base derived from 4-aminoantipyrine with salicylaldehyde have been synthesized and characterized on the bases of elemental analysis, UV-Vis., FT-IR, and also by aid of molar conductivity measurements, magnetic measurements, and melting points. It has been found that the Schiff bases with Cu(II) or Co(II) ion forming binuclear complexes on (1 : 1) “metal : ligand” stoichiometry. The molar conductance measurements of the complexes in DMSO correspond to be nonelectrolytic nature for all prepared complexes. Distorted octahedral environment is suggested for metal complexes. A theoretical treatment of the formation of complexes in the gas phase was studied, and this was done by using the HyperChem-6 program for the molecular mechanics and semi-empirical calculations. The free ligand and its complexes have been tested for their antibacterial activities against two types of human pathogenic bacteria: the first type (Staphylococcus aureus) is Gram positive and the second type (Escherichia coli) is Gram negative (by using agar well diffusion method). Finally, it was found that compounds show different activity of inhibition on growth of the bacteria.
doi:10.1155/2012/601879
PMCID: PMC3352244  PMID: 22611346
21.  Melanin-Based Coatings as Lead-Binding Agents 
Interactions between metal ions and different forms of melanin play significant roles in melanin biochemistry. The binding properties of natural melanin and related synthetic materials can be exploited for nonbiological applications, potentially including water purification. A method for investigating metal ion-melanin interactions on solid support is described, with lead as the initial target. 2.5 cm discs of the hydrophobic polymer PVDF were coated with synthetic eumelanin from the tyrosinase-catalyzed polymerization of L-dopa, and with melanin extracted from human hair. Lead (Pb2+) binding was quantified by atomic absorption spectroscopy (flame mode), and the data was well fit by the Langmuir model. Langmuir affinities ranged from 3.4 · 103 to 2.2 · 104 M−1. At the maximum capacity observed, the synthetic eumelanin coating bound ~9% of its mass in lead. Binding of copper (Cu2+), zinc (Zn2+), and cadmium (Cd2+) to the synthetic-eumelanin-coated discs was also investigated. Under the conditions tested, the Langmuir affinities for Zn2+, Cd2+, and Cu2+ were 35%, 53%, and 77%, respectively, of the Langmuir affinity for Pb2+. The synthetic-eumelanin-coated discs have a slightly higher capacity for Cu2+ on a per mole basis than for Pb2+, and lower capacities for Cd2+ and Zn2+. The system described can be used to address biological questions and potentially be applied toward melanin-based water purification.
doi:10.1155/2012/361803
PMCID: PMC3350951  PMID: 22611345
22.  Synthesis, Characterization and In Vitro Antibacterial Studies of Organotin(IV) Complexes with 2-Hydroxyacetophenone-2-methylphenylthiosemicarbazone (H2dampt) 
Five new organotin(IV) complexes of 2-hydroxyacetophenone-2-methylphenylthiosemicarbazone [H2dampt, (1)] with formula [RSnCln-1(dampt)] (where R = Me, n = 2 (2); R = Bu, n = 2 (3); R = Ph, n = 2 (4); R = Me2, n = 1 (5); R = Ph2, n = 1 (6)) have been synthesized by direct reaction of H2dampt (1) with organotin(IV) chloride(s) in absolute methanol. The ligand (1) and its organotin(IV) complexes (2–6) were characterized by CHN analyses, molar conductivity, UV-Vis, FT-IR, 1H, 13C, and 119Sn NMR spectral studies. H2dampt (1) is newly synthesized and has been structurally characterized by X-ray crystallography. Spectroscopic data suggested that H2dampt (1) is coordinated to the tin(IV) atom through the thiolate-S, azomethine-N, and phenoxide-O atoms; the coordination number of tin is five. The in vitro antibacterial activity has been evaluated against Staphylococcus aureus, Enterobacter aerogenes, Escherichia coli, and Salmonella typhi. The screening results have shown that the organotin(IV) complexes (2–6) have better antibacterial activities and have potential as drugs. Furthermore, it has been shown that diphenyltin(IV) derivative (6) exhibits significantly better activity than the other organotin(IV) derivatives (2–5).
doi:10.1155/2012/698491
PMCID: PMC3352140  PMID: 22611347
23.  Electrospun Nanostructured Fibers of Collagen-Biomimetic Apatite on Titanium Alloy 
Titanium and its alloys are currently the mainly used materials to manufacture orthopaedic implants due to their excellent mechanical properties and corrosion resistance. Although these materials are bioinert, the improvement of biological properties (e.g., bone implant contact) can be obtained by the application of a material that mimics the bone extracellular matrix. To this aim, this work describes a new method to produce nanostructured collagen-apatite composites on titanium alloy substrate, by combining electrospinning and biomimetic mineralization. The characterization results showed that the obtained mineralized scaffolds have morphological, structural, and chemical compositional features similar to natural bone extracellular matrix. Finally, the topographic distribution of the chemical composition in the mineralized matrix evaluated by Fourier Transform Infrared microspectroscopy demonstrated that the apatite nanocrystals cover the collagen fibers assembled by the electrospinning.
doi:10.1155/2012/123953
PMCID: PMC3287036  PMID: 22400013
24.  Pharmacokinetic Study of Di-Phenyl-Di-(2,4-Difluobenzohydroxamato)Tin(IV): Novel Metal-Based Complex with Promising Antitumor Potential 
Di-phenyl-di-(2,4-difluobenzohydroxamato)tin(IV)(DPDFT), a new metal-based arylhydroxamate antitumor complex, showed high in vivo and in vitro antitumor activity with relative low toxicity, but no data was reported regarding its pharmacokinetics and dependent toxicity. In this paper, a rapid, sensitive, and reproducible HPLC method in vivo using Diamonsil ODS column with a mixture of methanol and phosphoric acid in water (30 : 70, V/V, pH 3.0) as mobile phase was developed and validated for the determination of DPDFT. The plasma was deproteinized with methanol that contained acetanilide as the internal standard (I.S.). The photodiode array detector was set at a wavelength of 228 nm at room temperature and a linear curve over the concentration range 0.1~25 μg·mL−1 (r = 0.9993) was obtained. The method was used to determine the concentration-time profiles for DPDFT in the plasma after single intravenous administration with doses of 5, 10, 15 mg·kg−1 to rats. The pharmacokinetics parameter calculations and modeling were carried out using the 3p97 software. The results showed that the concentration-time curves of DPDFT in rat plasma could be fitted to two-compartment model.
doi:10.1155/2012/210682
PMCID: PMC3287010  PMID: 22400014
25.  Hydroxyapatite Coating of Titanium Implants Using Hydroprocessing and Evaluation of Their Osteoconductivity 
Many techniques for the surface modification of titanium and its alloys have been proposed from the viewpoint of improving bioactivity. This paper contains an overview of surface treatment methods, including coating with hydroxyapatite (HAp), an osteoconductive compound. There are two types of coating methods: pyroprocessing and hydroprocessing. In this paper, hydroprocessing for coating on the titanium substrate with HAp, carbonate apatite (CO3–Ap), a CO3–Ap/CaCO3 composite, HAp/collagen, and a HAp/gelatin composite is outlined. Moreover, evaluation by implantation of surface-modified samples in rat tibiae is described.
doi:10.1155/2012/730693
PMCID: PMC3287042  PMID: 22400015

Results 1-25 (28)