PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (165)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Authors
more »
Year of Publication
more »
1.  Evaluation of the Tyrer-Cuzick (International Breast Cancer Intervention Study) Model for Breast Cancer Risk Prediction in Women With Atypical Hyperplasia 
Journal of Clinical Oncology  2010;28(22):3591-3596.
Purpose
Accurate breast cancer risk assessment is vital to personalize screening and risk reduction strategies. Women with atypical hyperplasia have a four-fold higher risk of breast cancer. We evaluated the performance of the Tyrer-Cuzick model, which was designed to predict 10-year risk of breast cancer development, in a well-defined cohort of women with atypia.
Patients and Methods
The Mayo Benign Breast Disease cohort includes 9,376 women who had a benign breast biopsy between 1967 and 1991. Among those, 331 women with atypia were identified by our study pathologists. Risk factor data for the Tyrer-Cuzick model were collated for each woman and used to predict individual risk of developing invasive breast cancer within 10 years.
Results
Over a median follow-up of 14.6 years, 64 (19%) of the 331 women developed invasive breast cancer. In the first 10 years after biopsy, 31 women developed invasive breast cancer whereas the Tyrer-Cuzick model predicted 58.9. The observed-to-predicted ratio was 0.53 (95% CI, 0.37 to 0.75). The concordance statistic was 0.540, revealing that the Tyrer-Cuzick model did not accurately distinguish, on an individual level, between women who developed invasive breast cancer and those who did not.
Conclusion
The Tyrer-Cuzick model significantly overestimated risk of breast cancer for women with atypia, and individual risk estimates showed poor concordance between predicted risk and invasive breast cancer development. Thus, we cannot recommend the use of the Tyrer-Cuzick model to predict 10-year breast cancer risk in women with atypical hyperplasia.
doi:10.1200/JCO.2010.28.0784
PMCID: PMC2917314  PMID: 20606088
2.  Assessment of the Accuracy of the Gail Model in Women With Atypical Hyperplasia 
Journal of Clinical Oncology  2008;26(33):5374-5379.
Purpose
An accurate estimate of a woman's breast cancer risk is essential for optimal patient counseling and management. Women with biopsy-confirmed atypical hyperplasia of the breast (atypia) are at high risk for breast cancer. The Gail model is widely used in these women, but has not been validated in them.
Patients and Methods
Women with atypia were identified from the Mayo Benign Breast Disease (BBD) cohort (1967 to 1991). Their risk factors for breast cancer were obtained, and the Gail model was used to predict 5-year–and follow-up–specific risks for each woman. The predicted and observed numbers of breast cancers were compared, and the concordance between individual risk levels and outcomes was computed.
Results
Of the 9,376 women in the BBD cohort, 331 women had atypia (3.5%). At a mean follow-up of 13.7 years, 58 of 331 (17.5%) patients had developed invasive breast cancer, 1.66 times more than the 34.9 predicted by the Gail model (95% CI, 1.29 to 2.15; P < .001). For individual women, the concordance between predicted and observed outcomes was low, with a concordance statistic of 0.50 (95% CI, 0.44 to 0.55).
Conclusion
The Gail model significantly underestimates the risk of breast cancer in women with atypia. Its ability to discriminate women with atypia into those who did and did not develop breast cancer is limited. Health care professionals should be cautious when using the Gail model to counsel individual patients with atypia.
doi:10.1200/JCO.2007.14.8833
PMCID: PMC2651072  PMID: 18854574
4.  Frailty and Mortality Outcomes in Cognitively Normal Older People: Sex Differences in a Population-Based Study 
OBJECTIVES
To characterize frailty in cognitively normal older adults at baseline and to investigate the relationship of frailty with mortality.
DESIGN
A population-based, prospective, cohort study; the Mayo Clinic Study of Aging.
SETTING
Olmsted County, Minnesota.
PARTICIPANTS
Cognitively normal older persons aged 70 years and older (n = 2,356).
MEASUREMENTS
Frailty was assessed at baseline using a 36-item Frailty Index. Four frailty subgroups were identified: Frailty Index ≤0.10 (fit); 0.100.30 (frailest). All participants underwent comprehensive clinical and cognitive assessments. The association of frailty with mortality was assessed using Cox proportional hazards models.
RESULTS
The mean age (standard deviation) was 78.8 (±5.2) years, 50.2% were male, and the median (interquartile range) Frailty Index was 0.17 (0.11–0.22). Frailty increased with age and was more common in older men. Over a median follow-up of 6.5 years (range 7 days to 8.9 years), 500 of the 2,356 participants died, including 292 men. Compared to fit participants, the frailest participants had the greatest risk of death across the whole cohort (hazard ratio, HR= 3.91; 95% confidence interval, CI = 2.69–5.68). The association was stronger in women (HR= 5.26, 95% CI = 2.88–9.61) than men (HR= 3.15, 95% CI = 1.98–5.02).
CONCLUSION
Baseline frailty was common, especially in older men, and increased with age across our cohort. Frailty was associated with a significantly increased risk of death, particularly in women. These gender differences should be considered when designing a geriatric care plan.
doi:10.1111/jgs.13821
PMCID: PMC4721254  PMID: 26782862
frailty; Frailty Index; mortality; aging; sex-differences
5.  Dense and Non-dense Mammographic Area and Risk of Breast Cancer by Age and Tumor Characteristics 
Background
Mammographic density (MD) is a strong breast cancer risk factor. We previously reported associations of percent MD with larger and node-positive tumors across all ages, and estrogen receptor (ER)-negative status among women ages <55 years. To provide insight into these associations, we examined the components of percent MD (dense area (DA) and non-dense area (NDA) with breast cancer subtypes.
Methods
Data were pooled from six studies including 4095 breast cancers and 8558 controls. DA and NDA were assessed from digitized film-screen mammograms and standardized across studies. Breast cancer odds by density phenotypes and age according to histopathological characteristics and receptor status were calculated using polytomous logistic regression.
Results
DA was associated with increased breast cancer risk [odds ratios (OR) for quartiles: 0.65, 1.00(Ref), 1.22, 1.55; p-trend <0.001] and NDA was associated with decreased risk [ORs for quartiles: 1.39, 1.00(Ref), 0.88, 0.72; p-trend <0.001] across all ages and invasive tumor characteristics. There were significant trends in the magnitude of associations of both DA and NDA with breast cancer by increasing tumor size (p-trend<0.001) but no differences by nodal status. Among women <55 years, DA was more strongly associated with increased risk of ER+ vs. ER− tumors [p-heterogeneity (het) = 0.02] while NDA was more strongly associated with decreased risk of ER− vs. ER+ tumors [p-het = 0.03].
Conclusions
DA and NDA have differential associations with ER+ vs. ER− tumors that vary by age.
Impact
DA and NDA are important to consider when developing age- and subtype-specific risk models.
doi:10.1158/1055-9965.EPI-14-1136
PMCID: PMC4417380  PMID: 25716949
Mammographic density; Breast density; Breast cancer; Tumor subtypes; Mammography; Epidemiology
6.  Mammographic texture and risk of breast cancer by tumor type and estrogen receptor status 
Background
Several studies have shown that mammographic texture features are associated with breast cancer risk independent of the contribution of breast density. Thus, texture features may provide novel information for risk stratification. We examined the association of a set of established texture features with breast cancer risk by tumor type and estrogen receptor (ER) status, accounting for breast density.
Methods
This study combines five case–control studies including 1171 breast cancer cases and 1659 controls matched for age, date of mammogram, and study. Mammographic breast density and 46 breast texture features, including first- and second-order features, Fourier transform, and fractal dimension analysis, were evaluated from digitized film-screen mammograms. Logistic regression models evaluated each normalized feature with breast cancer after adjustment for age, body mass index, first-degree family history, percent density, and study.
Results
Of the mammographic features analyzed, fractal dimension and second-order statistics features were significantly associated (p < 0.05) with breast cancer. Fractal dimensions for the thresholds equal to 10% and 15% (FD_TH10 and FD_TH15) were associated with an increased risk of breast cancer while thresholds from 60% to 85% (FD_TH60 to FD_TH85) were associated with a decreased risk. Increasing the FD_TH75 and Energy feature values were associated with a decreased risk of breast cancer while increasing Entropy was associated with a decreased risk of breast cancer. For example, 1 standard deviation increase of FD_TH75 was associated with a 13% reduced risk of breast cancer (odds ratio = 0.87, 95% confidence interval 0.79–0.95). Overall, the direction of associations between features and ductal carcinoma in situ (DCIS) and invasive cancer, and estrogen receptor positive and negative cancer were similar.
Conclusion
Mammographic features derived from film-screen mammograms are associated with breast cancer risk independent of percent mammographic density. Some texture features also demonstrated associations for specific tumor types. For future work, we plan to assess risk prediction combining mammographic density and features assessed on digital images.
Electronic supplementary material
The online version of this article (doi:10.1186/s13058-016-0778-1) contains supplementary material, which is available to authorized users.
doi:10.1186/s13058-016-0778-1
PMCID: PMC5139106  PMID: 27923387
7.  Model for Individualized Prediction of Breast Cancer Risk After a Benign Breast Biopsy 
Journal of Clinical Oncology  2015;33(8):923-929.
Purpose
Optimal early detection and prevention for breast cancer depend on accurate identification of women at increased risk. We present a risk prediction model that incorporates histologic features of biopsy tissues from women with benign breast disease (BBD) and compare its performance to the Breast Cancer Risk Assessment Tool (BCRAT).
Methods
We estimated the age-specific incidence of breast cancer and death from the Mayo BBD cohort and then combined these estimates with a relative risk model derived from 377 patient cases with breast cancer and 734 matched controls sampled from the Mayo BBD cohort to develop the BBD–to–breast cancer (BBD-BC) risk assessment tool. We validated the model using an independent set of 378 patient cases with breast cancer and 728 matched controls from the Mayo BBD cohort and compared the risk predictions from our model with those from the BCRAT.
Results
The BBD-BC model predicts the probability of breast cancer in women with BBD using tissue-based and other risk factors. The concordance statistic from the BBD-BC model was 0.665 in the model development series and 0.629 in the validation series; these values were higher than those from the BCRAT (0.567 and 0.472, respectively). The BCRAT significantly underpredicted breast cancer risk after benign biopsy (P = .004), whereas the BBD-BC predictions were appropriately calibrated to observed cancers (P = .247).
Conclusion
We developed a model using both demographic and histologic features to predict breast cancer risk in women with BBD. Our model more accurately classifies a woman's breast cancer risk after a benign biopsy than the BCRAT.
doi:10.1200/JCO.2014.55.4865
PMCID: PMC4348637  PMID: 25624442
8.  Spectrum of cognition short of dementia 
Neurology  2015;85(19):1712-1721.
Objective:
To understand the neuropsychological basis of dementia risk among persons in the spectrum including cognitive normality and mild cognitive impairment.
Methods:
We quantitated risk of progression to dementia in elderly persons without dementia from 2 population-based studies, the Framingham Heart Study (FHS) and Mayo Clinic Study of Aging (MCSA), aged 70 to 89 years at enrollment. Baseline cognitive status was defined by performance in 4 domains derived from batteries of neuropsychological tests (that were similar but not identical for FHS and MCSA) at cut scores corresponding to SDs of ≤−0.5, −1, −1.5, and −2 from normative means. Participants were characterized as having no cognitive impairment (reference group), or single or multiple amnestic or nonamnestic profiles at each cut score. Incident dementia over the following 6 years was determined by consensus committee at each study separately.
Results:
The pattern of hazard ratios for incident dementia, rates of incident dementia and positive predictive values across cognitive test cut scores, and number of affected domains was similar although not identical across the FHS and MCSA. Dementia risks were higher for amnestic profiles than for nonamnestic profiles, and for multidomain compared with single-domain profiles.
Conclusions:
Cognitive domain subtypes, defined by neuropsychologically derived cut scores and number of low-performing domains, differ substantially in prognosis in a conceptually logical manner that was consistent between FHS and MCSA. Neuropsychological characterization of elderly persons without dementia provides valuable information about prognosis. The heterogeneity of risk of dementia cannot be captured concisely with one test or a single definition or cutpoint.
doi:10.1212/WNL.0000000000002100
PMCID: PMC4653114  PMID: 26453643
9.  Performance of the CogState computerized battery in the Mayo Clinic Study on Aging 
Background
The feasibility and validity of brief computerized cognitive batteries at the population-level are unknown.
Methods
Non-demented participants (n = 1660, age 50–97) in the Mayo Clinic Study on Aging completed the computerized CogState battery and standard neuropsychological battery. The correlation between tests was examined and comparisons between CogState performance on the personal computer (PC) and iPad (n = 331), and in the Clinic vs. at home (n = 194), were assessed.
Results
We obtained valid data on >97% of participants on each test. Correlations between the CogState and neuropsychological tests ranged from −0.462 to 0.531. While absolute differences between the PC and iPad were small and participants preferred the iPad, performance on the PC was faster. Participants performed faster on Detection, One Card Learning, and One Back at home compared to the Clinic.
Conclusions
The computerized CogState battery, especially the iPad, was feasible, acceptable, and valid in the population.
doi:10.1016/j.jalz.2015.01.008
PMCID: PMC4595161  PMID: 25858683
Computerized cognitive battery; Epidemiology; Neuropsychology; Cognitively normal; Mild cognitive impairment; Population-based cohort study
10.  Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children 
Immunogenetics  2015;67(10):547-561.
Background
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation.
Methods
In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers.
Results
Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic: 4.43, p<0.0001) and higher neutralizing antibody titers (t-statistic: 3.14, p=0.002).
Conclusions
Our results suggest that there is evidence of multigenic associations among identified gene SNPs, and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
doi:10.1007/s00251-015-0864-z
PMCID: PMC4587390  PMID: 26329766
Rubella vaccine; single nucleotide polymorphisms (SNPs); genetic association; neutralizing antibodies; cytokines; Rubella; Rubella Vaccine; Rubella virus; Measles-Mumps-Rubella Vaccine; Polymorphism; Single Nucleotide; Genetic Association Studies; Antibodies; Neutralizing; Cytokines
11.  Lessons learned in the analysis of high-dimensional data in vaccinomics 
Vaccine  2015;33(40):5262-5270.
The field of vaccinology is increasingly moving toward the generation, analysis, and modeling of extremely large and complex high-dimensional datasets. We have used data such as these in the development and advancement of the field of vaccinomics to enable prediction of vaccine responses and to develop new vaccine candidates. However, the application of systems biology to what has been termed “big data,” or “high-dimensional data,” is not without significant challenges—chief among them a paucity of gold standard analysis and modeling paradigms with which to interpret the data. In this article, we relate some of the lessons we have learned over the last decade of working with high-dimensional, high-throughput data as applied to the field of vaccinomics. The value of such efforts, however, is ultimately to better understand the immune mechanisms by which protective and non-protective responses to vaccines are generated, and to use this information to support a personalized vaccinology approach in creating better, and safer, vaccines for the public health.
doi:10.1016/j.vaccine.2015.04.088
PMCID: PMC4581898  PMID: 25957070
12.  Direct medical costs and source of cost differences across the spectrum of cognitive decline: A population-based study 
BACKGROUND
Objective cost estimates and source of cost differences are needed across the spectrum of cognition, including cognitively normal (CN), mild-cognitive-impairment (MCI), newly-discovered dementia, and prevalent dementia.
METHODS
Subjects were a subset of the Mayo Clinic Study of Aging stratified-random sampling of Olmsted County, MN, residents aged 70-89 years. A neurologist reviewed provider-linked medical records to identify prevalent-dementia (review date=index). Remaining subjects were invited to participate in prospective clinical/neuropsychological assessments; participants were categorized as CN, MCI, or newly-discovered-dementia (assessment date=index). Costs for medical services/procedures 1-year pre-index (excluding indirect and long-term care costs) were estimated using line-item provider-linked administrative data. We estimated contributions of care-delivery site and comorbid conditions (including and excluding neuropsychiatric diagnoses) to between-category cost differences.
RESULTS
Annual mean medical costs for CN, MCI, newly-discovered-dementia, and prevalent-dementia were $6,042, $6,784, $9,431, $11,678 respectively. Hospital inpatient costs contributed 70% of total costs for prevalent dementia and accounted for differences between CN and both prevalent and newly-discovered dementia. Ambulatory costs accounted for differences between CN and MCI. Age-, sex-, education-adjusted differences reached significance for CN versus newly-discovered and prevalent-dementia and for MCI versus prevalent-dementia. After considering all comorbid diagnoses, between-category differences were reduced (e.g., prevalent-dementia minus MCI (from $4,842 to $3,575); newly-discovered-dementia minus CN (from $3,578 to$711). Following exclusion of neuropsychiatric diagnoses from comorbidity adjustment, between-category differences tended to revert to greater differences.
CONCLUSIONS
Cost estimates did not differ significantly between CN and MCI. Substantial differences between MCI and prevalent dementia reflected high inpatient costs for dementia and appear partly related to co-occurring Mental Disorders. Such comparisons can help inform models aimed at identifying where, when, and for which individuals proposed interventions might be cost-effective.
doi:10.1016/j.jalz.2015.01.007
PMCID: PMC4543557  PMID: 25858682
Dementia; Cognitive status; Mild cognitive impairment; Economics; Utilization; Cost
13.  Subtle gait changes in patients with REM Behavior Disorder 
Background
Many people with REM sleep behavior disorder have an underlying synucleinopathy, the most common of which is Lewy body disease. Identifying additional abnormal clinical features may help in identifying those at greater risk of evolving to a more severe syndrome. As gait disorders are common in the synucleinopathies, early abnormalities in gait in those with REM sleep behavior disorder could help in identifying those at increased risk of developing overt parkinsonism and/or cognitive impairment.
Methods
We identified 42 probable REM sleep behavior disorder subjects and 492 controls using the Mayo Sleep Questionnaire and assessed gait velocity, cadence and stride dynamics with an automated gait analysis system.
Results
Cases and controls were similar in age (79.9 ± 4.7 & 80.1 ± 4.7, p= 0.74), UPDRS score (3.3 ± 5.5 & 1.9 ± 4.1, p=0.21) and Mini-Mental State Examination scores (27.2 ± 1.9 & 27.7 ± 1.6, p=0.10). A diagnosis of probable REM sleep behavior disorder was associated with decreased velocity (−7.9 cm/sec, 95%CI −13.8 to −2.0, p<0.01), cadence (−4.4 steps/min, 95%CI −7.6 to −1.3, p<0.01), and significantly increased double limb support variability (30%, 95%CI 6 – 60, p=0.01), greater stride time variability (29%, 95%CI 2 – 63, p=0.03) and swing time variability (46%, 95%CI 15 – 84, p<0.01).
Conclusions
Probable REM sleep behavior disorder is associated with subtle gait changes prior to overt clinical parkinsonism. Diagnosis of probable REM sleep behavior disorder supplemented by gait analysis may help as a screening tool for disorders of α-synuclein.
doi:10.1002/mds.25653
PMCID: PMC3952497  PMID: 24130124
REM Sleep Behavior Disorder; gait; gait variability
14.  A Prospective Study of Chronic Obstructive Pulmonary Disease and Risk of Mild Cognitive Impairment 
JAMA neurology  2014;71(5):581-588.
BACKGROUND
Previous studies suggest cross-sectional associations between a diagnosis of chronic obstructive pulmonary disease (COPD) and mild cognitive impairment (MCI). However, few studies have assessed whether COPD, a potentially modifiable factor, is associated with an increased risk of MCI and if the relation is specific to type of MCI.
OBJECTIVE
To investigate whether a diagnosis of COPD, and COPD duration, is associated with an increased risk of incident MCI, and MCI subtypes (amnestic MCI (a-MCI) and non-amnestic MCI (na-MCI)).
DESIGN
Mayo Clinic Study on Aging, a prospective population-based cohort study.
SETTING
Olmsted County, Minnesota.
PARTICIPANTS
The study included 1425 cognitively normal individuals aged 70–89 years, who were randomly selected from Olmsted County, MN, on October 1, 2004, using the medical records linkage system.
METHODS
At baseline and every 15 months thereafter, participants were assessed with a nurse interview, neurological examination, and neuropsychological testing. A diagnosis of COPD was confirmed via medical record chart review. A baseline diagnosis of COPD and disease duration were examined as risk factors for MCI and MCI-subtypes using Cox proportional hazards models and adjusting for demographic variables and medical comorbidities, using age as the time scale.
MAIN OUTCOME MEASURES
Incident MCI, amnestic MCI, non-amnestic MCI
RESULTS
Of 1425 cognitively normal subjects at baseline, 370 developed incident MCI. The median duration of follow-up was 5.1 years (Interquartile Range [IQR], 3.8–5.4 years). COPD significantly increased the risk of na-MCI by 83% (HR 1.83; 95% CI, 1.04–3.23), but not any MCI or a-MCI in multivariate analyses. There was a dose-response relationship such that individuals with COPD duration of 5 years or longer at baseline had the greatest risk of both MCI (HR 1.58, 95% CI:1.04, 2.40) and na-MCI (HR 2.58, 95% CI:1.32–5.06).
CONCLUSIONS AND RELEVANCE
COPD was associated with an increased risk of MCI, particularly na-MCI. There was a dose-response relationship between COPD duration and risk of MCI. These findings highlight the importance of COPD as a risk factor for MCI and may provide a substrate for early intervention to prevent or delay the onset and progression of MCI, particularly na-MCI.
doi:10.1001/jamaneurol.2014.94
PMCID: PMC4020948  PMID: 24637951
15.  What is the quality of life in the oldest old? 
International psychogeriatrics / IPA  2011;23(6):1003-1010.
Background
Maintaining and improving quality of life has become a major focus in geriatric medicine, but the oldest old have received limited attention in clinical investigations. We aimed to investigate the relationship between self-perceived and caregiver-perceived quality of life (QOL), cognitive functioning, and depressive symptoms in the oldest old.
Methods
This IRB-approved prospective study recruited community dwellers aged 90–99 years old. Collected data included neurological evaluation, DSM III-R criteria for dementia, Mini-Mental State Examination (MMSE), Dementia Rating Scale (DRS), Geriatric Depression Scale (GDS), Record of Independent Living (ROIL), and QOL assessment using the Linear Analogue Self Assessment (LASA).
Results
Data on 144 subjects (56 cognitively normal (normal), 13 mild cognitive impairment (MCI), 41 dementia (DEM), 34 dementia with stroke and parkinsonism (DEMSP)) over a three-year period were analyzed. Mean ages ranged from 93 to 94 years, and the majority were female with at least high school education. Overall functional ability was higher in groups without dementia (p < 0.0001). All subjects reported high overall QOL (range 6.76–8.3 out of 10), regardless of cognitive functioning. However, caregivers perceived the subjects’ overall QOL to be lower with increasing severity of cognitive impairment (p < 0.0001). Lower GDS scores correlate with higher self-perceived overall QOL (ρ = −0.38, p < 0.0001).
Conclusions
In our community sample of the oldest old, there was a fairly high level of overall QOL, whether or not cognitive impairment exists. Individuals perceive their QOL better than caregivers do, and the difference in subjects’ and caregivers’ perception is more pronounced for the groups with dementia. QOL is more strongly correlated with depressive symptoms than with dementia severity.
doi:10.1017/S1041610210002462
PMCID: PMC3924179  PMID: 21281556
geriatric; well being; cognition; depression; dementia; stroke; parkinsonism; MCI
16.  The Contributions of Breast Density and Common Genetic Variation to Breast Cancer Risk 
We evaluated whether a 76-locus polygenic risk score (PRS) and Breast Imaging Reporting and Data System (BI-RADS) breast density were independent risk factors within three studies (1643 case patients, 2397 control patients) using logistic regression models. We incorporated the PRS odds ratio (OR) into the Breast Cancer Surveillance Consortium (BCSC) risk-prediction model while accounting for its attributable risk and compared five-year absolute risk predictions between models using area under the curve (AUC) statistics. All statistical tests were two-sided. BI-RADS density and PRS were independent risk factors across all three studies (P interaction = .23). Relative to those with scattered fibroglandular densities and average PRS (2nd quartile), women with extreme density and highest quartile PRS had 2.7-fold (95% confidence interval [CI] = 1.74 to 4.12) increased risk, while those with low density and PRS had reduced risk (OR = 0.30, 95% CI = 0.18 to 0.51). PRS added independent information (P < .001) to the BCSC model and improved discriminatory accuracy from AUC = 0.66 to AUC = 0.69. Although the BCSC-PRS model was well calibrated in case-control data, independent cohort data are needed to test calibration in the general population.
doi:10.1093/jnci/dju397
PMCID: PMC4598340  PMID: 25745020
17.  Predicting the risk of mild cognitive impairment in the Mayo Clinic Study of Aging 
Neurology  2015;84(14):1433-1442.
Objective:
We sought to develop risk scores for the progression from cognitively normal (CN) to mild cognitive impairment (MCI).
Methods:
We recruited into a longitudinal cohort study a randomly selected, population-based sample of Olmsted County, MN, residents, aged 70 to 89 years on October 1, 2004. At baseline and subsequent visits, participants were evaluated for demographic, clinical, and neuropsychological measures, and were classified as CN, MCI, or dementia. Using baseline demographic and clinical variables in proportional hazards models, we derived scores that predicted the risk of progressing from CN to MCI. We evaluated the ability of these risk scores to classify participants for MCI risk.
Results:
Of 1,449 CN participants, 401 (27.7%) developed MCI. A basic model had a C statistic of 0.60 (0.58 for women, 0.62 for men); an augmented model resulted in a C statistic of 0.70 (0.69 for women, 0.71 for men). Both men and women in the highest vs lowest sex-specific quartiles of the augmented model's risk scores had an approximately 7-fold higher risk of developing MCI. Adding APOE ε4 carrier status improved the model (p = 0.002).
Conclusions:
We have developed MCI risk scores using variables easily assessable in the clinical setting and that may be useful in routine patient care. Because of variability among populations, validation in independent samples is required. These models may be useful in identifying patients who might benefit from more expensive or invasive diagnostic testing, and can inform clinical trial design. Inclusion of biomarkers or other risk factors may further enhance the models.
doi:10.1212/WNL.0000000000001437
PMCID: PMC4395890  PMID: 25788555
18.  Common Breast Cancer Susceptibility Variants in LSP1 and RAD51L1 Are Associated with Mammographic Density Measures that Predict Breast Cancer Risk 
Vachon, Celine M. | Scott, Christopher G. | Fasching, Peter A. | Hall, Per | Tamimi, Rulla M. | Li, Jingmei | Stone, Jennifer | Apicella, Carmel | Odefrey, Fabrice | Gierach, Gretchen L. | Jud, Sebastian M. | Heusinger, Katharina | Beckmann, Matthias W. | Pollan, Marina | Fernández-Navarro, Pablo | González-Neira, Anna | Benítez, Javier | van Gils, Carla H. | Lokate, Mariëtte | Onland-Moret, N. Charlotte | Peeters, Petra H.M. | Brown, Judith | Leyland, Jean | Varghese, Jajini S. | Easton, Douglas F. | Thompson, Deborah J. | Luben, Robert N. | Warren, Ruth ML | Wareham, Nicholas J. | Loos, Ruth JF | Khaw, Kay-Tee | Ursin, Giske | Lee, Eunjung | Gayther, Simon A. | Ramus, Susan J. | Eeles, Rosalind A. | Leach, Martin O. | Kwan-Lim, Gek | Couch, Fergus J. | Giles, Graham G. | Baglietto, Laura | Krishnan, Kavitha | Southey, Melissa C. | Le Marchand, Loic | Kolonel, Laurence N. | Woolcott, Christy | Maskarinec, Gertraud | Haiman, Christopher A | Walker, Kate | Johnson, Nichola | McCormack, Valerie A. | Biong, Margarethe | Alnæs, Grethe I.G. | Gram, Inger Torhild | Kristensen, Vessela N. | Børresen-Dale, Anne-Lise | Lindström, Sara | Hankinson, Susan E. | Hunter, David J. | Andrulis, Irene L. | Knight, Julia A. | Boyd, Norman F. | Figueroa, Jonine D. | Lissowska, Jolanta | Wesolowska, Ewa | Peplonska, Beata | Bukowska, Agnieszka | Reszka, Edyta | Liu, JianJun | Eriksson, Louise | Czene, Kamila | Audley, Tina | Wu, Anna H. | Pankratz, V. Shane | Hopper, John L. | dos-Santos-Silva, Isabel
Background
Mammographic density adjusted for age and body mass index (BMI) is a heritable marker of breast cancer susceptibility. Little is known about the biological mechanisms underlying the association between mammographic density and breast cancer risk. We examined whether common low-penetrance breast cancer susceptibility variants contribute to inter-individual differences in mammographic density measures.
Methods
We established an international consortium (DENSNP) of 19 studies from 10 countries, comprising 16,895 Caucasian women, to conduct a pooled cross-sectional analysis of common breast cancer susceptibility variants in 14 independent loci and mammographic density measures. Dense and non-dense areas, and percent density, were measured using interactive-thresholding techniques. Mixed linear models were used to assess the association between genetic variants and the square roots of mammographic density measures adjusted for study, age, case status, body mass index (BMI) and menopausal status.
Results
Consistent with their breast cancer associations, the C-allele of rs3817198 in LSP1 was positively associated with both adjusted dense area (p=0.00005) and adjusted percent density (p=0.001) whereas the A-allele of rs10483813 in RAD51L1 was inversely associated with adjusted percent density (p=0.003), but not with adjusted dense area (p=0.07).
Conclusion
We identified two common breast cancer susceptibility variants associated with mammographic measures of radio-dense tissue in the breast gland.
Impact
We examined the association of 14 established breast cancer susceptibility loci with mammographic density phenotypes within a large genetic consortium and identified two breast cancer susceptibility variants, LSP1-rs3817198 and RAD51L1-rs10483813, associated with mammographic measures and in the same direction as the breast cancer association.
doi:10.1158/1055-9965.EPI-12-0066
PMCID: PMC3569092  PMID: 22454379
breast density; breast cancer; genetics; biomarkers; mammography
19.  Neuropsychiatric symptoms, APOE ε4, and the risk of incident dementia 
Neurology  2015;84(9):935-943.
Objective:
To investigate the population-based interaction between a biological variable (APOE ε4), neuropsychiatric symptoms, and the risk of incident dementia among subjects with prevalent mild cognitive impairment (MCI).
Methods:
We prospectively followed 332 participants with prevalent MCI (aged 70 years and older) enrolled in the Mayo Clinic Study of Aging for a median of 3 years. The diagnoses of MCI and dementia were made by an expert consensus panel based on published criteria, after reviewing neurologic, cognitive, and other pertinent data. Neuropsychiatric symptoms were determined at baseline using the Neuropsychiatric Inventory Questionnaire. We used Cox proportional hazards models, with age as a time scale, to calculate hazard ratios (HRs) and 95% confidence intervals (CIs). Models were adjusted for sex, education, and medical comorbidity.
Results:
Baseline agitation, nighttime behaviors, depression, and apathy significantly increased the risk of incident dementia. We observed additive interactions between APOE ε4 and depression (joint effect HR = 2.21; 95% CI = 1.24–3.91; test for additive interaction, p < 0.001); and between APOE ε4 and apathy (joint effect HR = 1.93; 95% CI = 0.93–3.98; test for additive interaction, p = 0.031). Anxiety, irritability, and appetite/eating were not associated with increased risk of incident dementia.
Conclusions:
Among prevalent MCI cases, baseline agitation, nighttime behaviors, depression, and apathy elevated the risk of incident dementia. There was a synergistic interaction between depression or apathy and APOE ε4 in further elevating the risk of incident dementia.
doi:10.1212/WNL.0000000000001307
PMCID: PMC4351664  PMID: 25653291
20.  Histologic Findings in Normal Breast Tissues: Comparison to Reduction Mammaplasty and Benign Breast Disease Tissues 
Background
Investigations of breast carcinogenesis often rely upon comparisons between cancer tissue and nonmalignant breast tissue. It is unclear how well common reference sources of nonmalignant breast tissues reflect normal breast tissue.
Methods
Breast tissue samples were evaluated from three sources: 1) normal donor tissues in the Susan G. Komen for the Cure® Tissue Bank at Indiana University Simon Cancer Center (KTB), 2) women who underwent reduction mammaplasty (RM) at Mayo Clinic Rochester, and 3) the Mayo Clinic Benign Breast Disease Cohort Study (BBD). Samples were examined histologically and assessed for proliferative disease and degree of lobular involution. Univariate comparisons were performed among the study groups, and multivariate analyses were performed with logistic regression to assess the association between study group and the presence of epithelial proliferative disease and complete lobular involution.
Results
Histologic data were collected for 455 KTB samples, 259 RM samples, and 319 BBD samples. Histologic findings and the frequency of epithelial proliferation were significantly different among the groups. Histologic abnormalities were seen in a minority of the KTB samples (35%), whereas an abnormality was present in 88% of RM tissues and 97.5% of BBD samples. The presence of proliferative disease (with or without atypical hyperplasia) was present in 3.3% of normal donors (3.3%), 17% of RM samples, and 34.9% of BBD samples, (p<0.0001 for each comparison). Multivariate analyses confirmed that these differences remained significant and also showed higher likelihood of complete lobular involution in the normal donor samples compared to RM and BBD tissues.
Conclusion
Compared to benign breast disease tissues and reduction mammaplasty tissues, breast tissue samples from normal donors have significantly fewer histologic abnormalities and a higher frequency of more complete lobular involution. Breast tissue samples from normal donors represent a unique tissue resource with histologic features consistent with lower breast cancer risk.
doi:10.1007/s10549-011-1746-1
PMCID: PMC3242875  PMID: 21881938
21.  Genetic Variations in Multiple Drug Action Pathways and Survival in Advanced-Stage Non-small Cell Lung Cancer Treated with Chemotherapy 
Purpose
Variations in genes related to anticancer drugs' biologic activity could influence treatment responses and lung cancer prognosis. Genetic variants in four biological pathways, i.e., glutathione metabolism, DNA repair, cell cycle, and EGFR, were systematically investigated to examine their association with survival in advanced-stage NSCLC treated with chemotherapy.
Experimental Design
A total of 894 tagging single-nucleotide polymorphisms (tagSNPs) in 70 genes from the four pathways were genotyped and analyzed in a 1076-patient cohort. Association with overall survival was analyzed at single-SNP and whole-gene levels within all patients and major chemotherapy agent combination groups.
Results
A poorer overall survival was observed in patients with genetic variations in GSS (glutathione pathway) and MAP3K1 (EGFR pathway) (HR=1.45, 95% CI=1.20–1.70 and HR=1.25, 95% CI=1.05–1.50, respectively). In stratified analysis on patients receiving platinum plus taxane treatment, we observed a hazardous effect on overall survival by MAP3K1 variant (HR=1.38, 95% CI =1.11–1.72) and a protective effect by RAF1 (HR=0.64, 95% CI=0.5–0.82) in the EGFR pathway. In patients receiving platinum plus gemcitabine treatment, RAF and GPX5 (glutathione pathway) genetic variations showed protective effects on survival (HR=0.54, 95% CI=0.38–0.77; HR=0.67, 95% CI=0.52–0.85, respectively); in contrast, NRAS (EGFR pathway) and GPX7 (glutathione pathway) variations showed hazardous effects on overall survival (HR=1.91, 95% CI=1.30–2.80; HR=1.83, 95% CI=1.27–2.63, respectively). All genes that harbored these significant SNPs remained significant by whole-gene analysis.
Conclusion
Common genetic variations in genes of EGFR and glutathione pathways may be associated with overall survival among patients with advanced-stage NSCLC treated with platinum, taxane, and/or gemicitabine combinations.
doi:10.1158/1078-0432.CCR-10-2877
PMCID: PMC3124814  PMID: 21636554
non-small cell lung cancer; survival; single-nucleotide polymorphisms; pathway; chemotherapy
22.  Inherited Mutations in 17 Breast Cancer Susceptibility Genes Among a Large Triple-Negative Breast Cancer Cohort Unselected for Family History of Breast Cancer 
Journal of Clinical Oncology  2014;33(4):304-311.
Purpose
Recent advances in DNA sequencing have led to the development of breast cancer susceptibility gene panels for germline genetic testing of patients. We assessed the frequency of mutations in 17 predisposition genes, including BRCA1 and BRCA2, in a large cohort of patients with triple-negative breast cancer (TNBC) unselected for family history of breast or ovarian cancer to determine the utility of germline genetic testing for those with TNBC.
Patients and Methods
Patients with TNBC (N = 1,824) unselected for family history of breast or ovarian cancer were recruited through 12 studies, and germline DNA was sequenced to identify mutations.
Results
Deleterious mutations were identified in 14.6% of all patients. Of these, 11.2% had mutations in the BRCA1 (8.5%) and BRCA2 (2.7%) genes. Deleterious mutations in 15 other predisposition genes were detected in 3.7% of patients, with the majority observed in genes involved in homologous recombination, including PALB2 (1.2%) and BARD1, RAD51D, RAD51C, and BRIP1 (0.3% to 0.5%). Patients with TNBC with mutations were diagnosed at an earlier age (P < .001) and had higher-grade tumors (P = .01) than those without mutations.
Conclusion
Deleterious mutations in predisposition genes are present at high frequency in patients with TNBC unselected for family history of cancer. Mutation prevalence estimates suggest that patients with TNBC, regardless of age at diagnosis or family history of cancer, should be considered for germline genetic testing of BRCA1 and BRCA2. Although mutations in other predisposition genes are observed among patients with TNBC, better cancer risk estimates are needed before these mutations are used for clinical risk assessment in relatives.
doi:10.1200/JCO.2014.57.1414
PMCID: PMC4302212  PMID: 25452441
23.  Pseudoangiomatous Stromal Hyperplasia and Breast Cancer Risk 
Annals of surgical oncology  2010;17(12):3269-3277.
Introduction
Pseudoangiomatous stromal hyperplasia (PASH) is a benign localized fibrotic lesion in which clusters of spindle cells form cleft-like spaces, resembling ectatic vessels. Its relationship to breast cancer risk has not been characterized.
Methods
Histological presence of PASH was evaluated by review of archival slides in a single institution cohort of women who underwent benign excisional breast biopsy from 1967-1991. Relative risks for subsequent breast cancer were estimated using standardized incidence ratios (SIR), comparing the observed number of cancers with those expected based on Iowa SEER data (mean follow-up 18.5 years).
Results
PASH was identified in 579/9065 biopsies (6.4%). Women with PASH were younger, more likely to have a palpable mass as indication for biopsy, and had less lobular involution compared to those without PASH (all p<0.001), while they did not differ by family history of breast cancer or degree of epithelial proliferation. Breast cancers occurred in 34 women with PASH (5.9%) and 789 without (8.8%). Women with PASH had lower risk of breast cancer (SIR 1.03, 95% CI 0.71 to 1.44) than those without PASH (SIR 1.54, 95% CI 1.43 to 1.65), p=0.01. Lower levels of breast cancer risk for the PASH group persisted in analyses stratified by age, family history, epithelial proliferation, and involution. The cancers in the PASH group occurred predominantly in the ipsilateral breast greater than five years after biopsy.
Conclusions
Despite clinical concern generated by palpable density often associated with PASH, this relatively uncommon histological finding does not connote increased risk of subsequent breast cancer.
doi:10.1245/s10434-010-1170-5
PMCID: PMC2953577  PMID: 20567920
24.  Late-Onset Alzheimer Risk Variants in Memory Decline, Incident Mild Cognitive Impairment and Alzheimer Disease 
Neurobiology of aging  2014;36(1):60-67.
Background
Genome-wide association studies (GWAS) of late-onset Alzheimer's disease (LOAD) identified risk variants. We assessed the association of nine variants with memory and progression to mild cognitive impairment (MCI) or LOAD (MCI/LOAD).
Methods
Older Caucasians, cognitively normal at baseline and longitudinally evaluated at Mayo Clinic Rochester and Jacksonville, were assessed for associations of genetic variants with memory decline (n=2,262) using linear mixed models and for incident MCI/LOAD (n=2,674) with Cox proportional hazards models. Each variant was tested both individually and collectively using a single weighted risk score.
Results
APOE-ε4 was significantly associated with worse memory at baseline (β=-0.88, p=2.78E-03) and increased rate of 5-year decline (β=-1.43, p=3.71E-06) with highly significant overall effect on memory (p=3.88E-09). CLU-locus risk allele rs11136000-G was associated with worse memory at baseline (β=-0.51, p=0.012), but not with increased rate of decline. CLU allele was also associated with incident MCI/LOAD (hazard ratio=HR=1.14, p=0.049) in sensitivity analysis. MS4A6A-locus risk allele rs610932-C was associated with increased incident MCI/LOAD in primary analysis (HR=1.17, p=0.016) and had suggestive association with lower baseline memory (β=-0.35, p=0.08). PICALM-locus risk allele rs3851179-G had nominally significant HR in both primary and sensitivity analysis, but with a protective estimate. LOAD risk alleles ABCA7-rs3764650-C and EPHA1-rs11767557-A associated with increased rates of memory decline in the subset of subjects with a final diagnosis of MCI/LOAD. Risk scores excluding APOE were not significant, whereas APOE-inclusive risk scores associated with worse memory and incident MCI/LOAD.
Conclusions
The collective influence of the nine top LOAD GWAS variants on memory decline and progression to MCI/LOAD appears limited. Given the significant associations observed with APOE-ε4, discovery of the biologically functional variants at these loci may uncover stronger effects on memory and incident disease.
doi:10.1016/j.neurobiolaging.2014.07.042
PMCID: PMC4268433  PMID: 25189118
Alzheimer's disease; memory; mild cognitive impairment; genetic risk; association; cognitive decline
25.  Correction: Genetic Evidence Implicates the Immune System and Cholesterol Metabolism in the Aetiology of Alzheimer's Disease 
Jones, Lesley | Holmans, Peter A. | Hamshere, Marian L. | Harold, Denise | Moskvina, Valentina | Ivanov, Dobril | Pocklington, Andrew | Abraham, Richard | Hollingworth, Paul | Sims, Rebecca | Gerrish, Amy | Pahwa, Jaspreet Singh | Jones, Nicola | Stretton, Alexandra | Morgan, Angharad R. | Lovestone, Simon | Powell, John | Proitsi, Petroula | Lupton, Michelle K. | Brayne, Carol | Rubinsztein, David C. | Gill, Michael | Lawlor, Brian | Lynch, Aoibhinn | Morgan, Kevin | Brown, Kristelle S. | Passmore, Peter A. | Craig, David | McGuinness, Bernadette | Todd, Stephen | Holmes, Clive | Mann, David | Smith, A. David | Love, Seth | Kehoe, Patrick G. | Mead, Simon | Fox, Nick | Rossor, Martin | Collinge, John | Maier, Wolfgang | Jessen, Frank | Schürmann, Britta | van den Bussche, Hendrik | Heuser, Isabella | Peters, Oliver | Kornhuber, Johannes | Wiltfang, Jens | Dichgans, Martin | Frölich, Lutz | Hampel, Harald | Hüll, Michael | Rujescu, Dan | Goate, Alison M. | Kauwe, John S. K. | Cruchaga, Carlos | Nowotny, Petra | Morris, John C. | Mayo, Kevin | Livingston, Gill | Bass, Nicholas J. | Gurling, Hugh | McQuillin, Andrew | Gwilliam, Rhian | Deloukas, Panos | Al-Chalabi, Ammar | Shaw, Christopher E. | Singleton, Andrew B. | Guerreiro, Rita | Mühleisen, Thomas W. | Nöthen, Markus M. | Moebus, Susanne | Jöckel, Karl-Heinz | Klopp, Norman | Wichmann, H.-Erich | Rüther, Eckhard | Carrasquillo, Minerva M. | Pankratz, V. Shane | Younkin, Steven G. | Hardy, John | O'Donovan, Michael C. | Owen, Michael J. | Williams, Julie
PLoS ONE  2011;6(2):10.1371/annotation/a0bb886d-d345-4a20-a82e-adce9b047798.
doi:10.1371/annotation/a0bb886d-d345-4a20-a82e-adce9b047798
PMCID: PMC3039022

Results 1-25 (165)