Objective: Weed pollens are common sources of allergens worldwide. The prevalence of weed pollen sensitization is not yet fully known in China. The purpose of this study was to investigate the prevalence of sensitization to weed allergens from Artemisia, Ambrosia, and Humulus in northern China. Methods: A total of 1 144 subjects (aged from 5 to 68 years) visiting our clinic from June to October 2011 underwent intradermal testing using a panel of 25 allergen sources. Subjects with positive skin responses to any pollen were further tested for their serum concentrations of IgE antibodies against Artemisia vulgaris, Ambrosia artemisiifolia, and Humulus scandens, and against the purified allergens, Art v 1 and Amb a 1. Results: Of 1 144 subjects, 170 had positive intradermal reactions to pollen and 144 donated serum for IgE testing. The prevalence of positive intradermal responses to pollens of Artemisia sieversiana, Artemisia annua, A. artemisiifolia, and H. scandens was 11.0%, 10.2%, 3.7%, and 6.6%, respectively. Among the intradermal positive subjects, the prevalence of specific IgE antigens to A. vulgaris was 58.3%, to A. artemisiifolia 14.7%, and to H. scandens 41.0%. The prevalence of specific IgE antigens to the allergen Art v 1 was 46.9%, and to Amb a 1 was 11.2%. The correlation between the presence of IgE antibodies specific to A. vulgaris and to the Art v 1 antigen was very high. Subjects with A. artemisiifolia specific IgE also had A. vulgaris specific IgE, but with relatively high levels of A. vulgaris IgE antibodies. There were no correlations between the presence of IgE antibodies to H. scandens and A. vulgaris or to H. scandens and A. artemisiifolia. Conclusions: The intradermal prevalence of weed pollen sensitization among allergic subjects in northern China is about 13.5%. Correlations of specific IgE antibodies suggest that pollen allergens from Artemisia and Humulus are independent sources for primary sensitization.

Summary

The NADPH oxidase enzyme complex, NOX2, is responsible for reactive oxygen species (ROS) production in neutrophils and has been recognized as a key mediator of inflammation. Here, we have performed rational design and in silico screen to identify a small molecule inhibitor, Phox-I1, targeting the interactive site of p67phox with Rac GTPase that is a necessary step of the signaling leading to NOX2 activation. Phox-I1 binds to p67phox with a submicromolar affinity and abrogates Rac1 binding, and is effective in inhibiting NOX2-mediated superoxide production dose-dependently in human and murine neutrophils without detectable toxicity. Medicinal chemistry characterizations have yielded promising analogs and initial information of the structure-activity relationship of Phox-I1. Our studies suggest the potential utility of Phox-I class inhibitors in NOX2 oxidase inhibition and present the first application of rational targeting of a small GTPase - effector interface.

Repeated cocaine administration increases the dendritic arborization of nucleus accumbens neurons, but the underlying signaling events remain unknown. Here, we show that repeated cocaine negatively regulates the active form of Rac1, a small GTPase that controls actin remodeling in other systems. We show further, using viral-mediated gene transfer, that overexpression of a dominant negative mutant of Rac1, or local knockout of Rac1 from floxed Rac1 mice, is sufficient to increase the density of immature dendritic spines on nucleus accumbens neurons, whereas overexpression of a constitutively active Rac1 mutant, or light activation of a photoactivatible form of Rac1, blocks the ability of repeated cocaine to produce this effect. Downregulation of Rac1 activity in nucleus accumbens likewise promotes behavioral responses to cocaine, with Rac1 activation producing the opposite effect. These findings establish an important role for Rac1 signaling in mediating structural and behavioral plasticity to cocaine.

Objective and design

To determine whether Finegoldia magna protein L (PL) causes lung inflammation and, if so, whether the response is dependent on its Ig-binding B cell superantigenic property.

Material

Pulmonary inflammatory reactions were analyzed at varying time points after intratracheal administration of PL to various strains of mice.

Results

PL caused peribronchial and perivascular inflammation that peaked at 18–24 hours. Polymorphonuclear cells (PMNs) began to accumulate in bronchoalveolar lavage fluid (BALF) of PL-challenged mice by 4 hours and accounted for >90% of leukocytes by 18–24 hours. Inflammation was marked by the appearance of MIP-2, KC, TNF-α, and IL-6 in the BALF with peak levels attained 4 hours after PL administration. PL-induced pulmonary inflammation was associated with increased airway hyperreactivity following inhalation of methacholine. The inflammatory reaction was unabated in mice lacking B cells and Igs. By contrast, PL-induced inflammation was abrogated in MyD88- deficient mice. PL-induced responses required alveolar macrophages.

Conclusions

These results strongly suggest that PL-induced lung inflammation is dependent on an innate MyD88 dependent pathway rather than the Ig-binding properties of this microbial B cell superantigen. We propose that this pulmonary inflammatory reaction is caused by the interaction of PL with a Toll-like receptor expressed on alveolar macrophages.

Background

Serum preptin levels among subjects with different bone mineral densities (BMD) were measured and investigated to determine the correlation between BMD and bone-metabolic markers.

Methods

Approximately 52 elderly male patients with osteoporosis, 50 elderly men with osteopaenia, and 31 age-matched normal bone mass controls participated in the study. The serum preptin levels and bone metabolic markers were measured by enzyme-linked immunosorbent assay. The relationships between preptin levels, BMD, and metabolic parameters were also assessed.

Results

The serum preptin level was the lowest in the osteoporosis group and positively correlated with BMD. All the bone formation markers in the osteoporosis and osteopaenia groups were significantly reduced compared with those in the normal group. Serum preptin level was positively correlated with all the bone formation markers, whereas no correlation was observed with the bone resorption marker TRACP-5b.

Conclusions

Serum preptin levels are decreased in osteoporosis and osteopaenia patients and positively correlated with BMD. Therefore, preptin is involved in the pathogenesis of osteoporosis, probably through bone formation rather than bone resorption.

RhoA is a key regulator of cytoskeletal dynamics with a variety of effects on cellular processes. Loss of RhoA in neural progenitor cells disrupts adherens junctions and causes disorganization of the neuroepithelium in the developing nervous system. However, it remains largely unknown how the loss of RhoA physiologically affects neural circuit formation. Here we show that proper neuroepithelial organization maintained by RhoA GTPase in both the ventral and dorsal spinal cord is critical for left-right locomotor behavior. We examined the roles of RhoA in the ventral and dorsal spinal cord by deleting the gene in neural progenitors using Olig2-Cre and Wnt1-Cre mice, respectively. RhoA-deleted neural progenitors in both mutants exhibit defects in the formation of apical adherens junctions and disorganization of the neuroepithelium. Consequently, the ventricular zone and lumen of the dysplastic region are lost, causing the left and right sides of the gray matter to be directly connected. Furthermore, the dysplastic region lacks ephrinB3 expression at the midline that is required for preventing EphA4-expressing corticospinal neurons and spinal interneurons from crossing the midline. As a result, aberrant neuronal projections are observed in that region. Finally, both RhoA mutants develop a rabbit-like hopping gait. These results demonstrate that RhoA functions to maintain neuroepithelial structures in the developing spinal cord and that proper organization of the neuroepithelium is required for appropriate left-right motor behavior.

The interferon-inducible transmembrane (IFITM) protein family represents a new class of cellular restriction factors that block early stages of viral replication; the underlying mechanism is currently not known. Here we provide evidence that IFITM proteins restrict membrane fusion induced by representatives of all three classes of viral membrane fusion proteins. IFITM1 profoundly suppressed syncytia formation and cell-cell fusion induced by almost all viral fusion proteins examined; IFITM2 and IFITM3 also strongly inhibited their fusion, with efficiency somewhat dependent on cell types. Furthermore, treatment of cells with IFN also markedly inhibited viral membrane fusion and entry. By using the Jaagsiekte sheep retrovirus envelope and influenza A virus hemagglutinin as models for study, we showed that IFITM-mediated restriction on membrane fusion is not at the steps of receptor- and/or low pH-mediated triggering; instead, the creation of hemifusion was essentially blocked by IFITMs. Chlorpromazine (CPZ), a chemical known to promote the transition from hemifusion to full fusion, was unable to rescue the IFITM-mediated restriction on fusion. In contrast, oleic acid (OA), a lipid analog that generates negative spontaneous curvature and thereby promotes hemifusion, virtually overcame the restriction. To explore the possible effect of IFITM proteins on membrane molecular order and fluidity, we performed fluorescence labeling with Laurdan, in conjunction with two-photon laser scanning and fluorescence-lifetime imaging microscopy (FLIM). We observed that the generalized polarizations (GPs) and fluorescence lifetimes of cell membranes expressing IFITM proteins were greatly enhanced, indicating higher molecularly ordered and less fluidized membranes. Collectively, our data demonstrated that IFITM proteins suppress viral membrane fusion before the creation of hemifusion, and suggested that they may do so by reducing membrane fluidity and conferring a positive spontaneous curvature in the outer leaflets of cell membranes. Our study provides novel insight into the understanding of how IFITM protein family restricts viral membrane fusion and infection.

Author Summary

Many pathogenic viruses contain an envelope that must fuse with the cell membrane in order to gain entry and initiate infection. This process is mediated by one or more glycoproteins present on the surface of the virions, known as viral fusion proteins. Recently, a family of interferon-inducible transmembrane (IFITM) protein has been shown to block viral infection, including those of highly pathogenic viruses. Here we provide evidence that these IFITM proteins potently suppress membrane fusion induced by representatives of all three classes of viral fusion proteins. Interestingly, we found that the block is not at the steps of receptor binding or low pH that triggers conformational changes of viral fusion proteins required for membrane fusion. Rather, we discovered that the creation of hemifusion, an intermediate in which the outer membranes of the two lipid bilayers have merged but the inner membranes still remain intact is blocked by IFITM proteins. We further demonstrated that overexpression of IFITM proteins rigidify the cell membrane, thereby reducing membrane fluidity and fusion potential. Our study provides novel insight into the understanding of how IFITM proteins restrict viral entry and infection.

Background

Migraine is an independent risk factor for stroke. Mechanisms underlying this association are unclear. Familial hemiplegic migraine (FHM), a migraine subtype that also carries an increased stroke risk, is a useful model for common migraine phenotypes because of shared aura and headache features, trigger factors, and underlying glutamatergic mechanisms.

Methods and Results

Here, we show that FHM type 1 (FHM1) mutations in CaV2.1 voltage-gated Ca2+ channels render the brain more vulnerable to ischemic stroke. Compared to wild-type, two FHM1 mutant mouse strains developed earlier onset of anoxic depolarization and more frequent peri-infarct depolarizations, associated with rapid expansion of infarct core on diffusion-weighted MRI and larger perfusion deficits on laser speckle flowmetry. Cerebral blood flow required for tissue survival was higher in the mutants, leading to infarction with milder ischemia. As a result, mutants developed larger infarcts and worse neurological outcomes after stroke, which were selectively attenuated by a glutamate receptor antagonist.

Conclusions

We propose that enhanced susceptibility to ischemic depolarizations akin to spreading depression predisposes migraineurs to infarction during mild ischemic events, thereby increasing the stroke risk.

Background

Hepatocyte growth factor (HGF) is one of the major angiogenic factors being studied for the treatment of ischemic heart diseases. Our previous study demonstrated adenovirus-HGF was effective in myocardial ischemia models. The first clinical safety study showed a positive effect in patients with severe and diffused triple coronary disease.

Methods

12 Pigs were randomized (1∶1) to receive HGF, which was administered as five injections into the infarcted myocardium, or saline (control group). The injections were guided by EnSite NavX left ventricular electroanatomical mapping.

Results

The catheter-based injections caused no pericardial effusion, malignant arrhythmia or death. During mapping and injection, alanine aminotransferase, aspartate aminotransferase, blood urea nitrogen, serum creatinine and creatine kinase-MB levels have no significant increase as compared to those before and after the injection in HGF group(P>0.05). HGF group has high HGF expression with Western blot, less myocardial infarct sizes by electroanatomical mapping (HGF group versus after saline group, 5.28±0.55 cm2 versus 9.06±1.06 cm2, P<0.01), better cardiac function with Gated-Single Photon Emission Computed Tomography compared with those in saline group. Histological, strongly increased lectin–positive microvessels and microvessel density were found in the myocardial ischemic regions in HGF group.

Conclusion

Intramyocardial injection guided by NavX system provides a method of feasible and safe percutaneous gene transfer to myocardial infarct regions.

AIM: To quantitatively assess the ability of double contrast-enhanced ultrasound (DCUS) to detect tumor early response to pre-operative chemotherapy.

METHODS: Forty-three patients with gastric cancer treated with neoadjuvant chemotherapy followed by curative resection between September 2011 and February 2012 were analyzed. Pre-operative chemotherapy regimens of fluorouracil + oxaliplatin or S-1 + oxaliplatin were administered in 2-4 cycles over 6-12 wk periods. All patients underwent contrast-enhanced computed tomography (CT) scan and DCUS before and after two courses of pre-operative chemotherapy. The therapeutic response was assessed by CT using the response evaluation criteria in solid tumors (RECIST 1.1) criteria. Tumor area was assessed by DCUS as enhanced appearance of gastric carcinoma due to tumor vascularity during the contrast phase as compared to the normal gastric wall. Histopathologic analysis was carried out according to the Mandard tumor regression grade criteria and used as the reference standard. Receiver operating characteristic (ROC) analysis was used to evaluate the efficacy of DCUS parameters in differentiating histopathological responders from non-responders.

RESULTS: The study population consisted of 32 men and 11 women, with mean age of 59.7 ± 11.4 years. Neither age, sex, histologic type, tumor site, T stage, nor N stage was associated with pathological response. The responders had significantly smaller mean tumor size than the non-responders (15.7 ± 7.4 cm vs 33.3 ± 14.1 cm, P < 0.01). According to Mandard’s criteria, 27 patients were classified as responders, with 11 (40.7%) showing decreased tumor size by DCUS. In contrast, only three (18.8%) of the 16 non-responders showed decreased tumor size by DCUS (P < 0.01). The area under the ROC curve was 0.64, with a 95%CI of 0.46-0.81. The effects of several cut-off points on diagnostic parameters were calculated in the ROC curve analysis. By maximizing Youden’s index (sensitivity + specificity - 1), the best cut-off point for distinguishing responders from non-responders was determined, which had optimal sensitivity of 62.9% and specificity of 56.3%. Using this cut-off point, the positive and negative predictive values of DCUS for distinguishing responders from non-responders were 70.8% and 47.4%, respectively. The overall accuracy of DCUS for therapeutic response assessment was 60.5%, slightly higher than the 53.5% for CT response assessment with RECIST criteria (P = 0.663). Although the advantage was not statistically significant, likely due to the small number of cases assessed. DCUS was able to identify decreased perfusion in responders who showed no morphological change by CT imaging, which can be occluded by such treatment effects as fibrosis and edema.

CONCLUSION: DCUS may represent an innovative tool for more accurately predicting histopathological response to neoadjuvant chemotherapy before surgical resection in patients with locally-advanced gastric cancer.

To determine how tetraspanin KAI1/CD82, a tumor metastasis suppressor, inhibits cell migration, we assessed which cellular events critical for motility are altered by KAI1/CD82 and how KAI1/CD82 regulates these events. We found that KAI1/CD82-expressing cells typically exhibited elongated cellular tails and diminished lamellipodia. Live imaging demonstrated that the polarized protrusion and retraction of the plasma membrane became deficient upon KAI1/CD82 expression. The deficiency in developing these motility-related cellular events was caused by poor formations of actin cortical network and stress fiber and by aberrant dynamics in actin organization. Rac1 activity was reduced by KAI1/CD82, consistent with the diminution of lamellipodia and actin cortical network; while the growth factor-stimulated RhoA activity was blocked by KAI1/CD82, consistent with the loss of stress fiber and attenuation in cellular retraction. Upon KAI1/CD82 expression, Rac effector cofilin was not enriched at the cell periphery to facilitate lamellipodia formation while Rho kinase exhibited a significantly lower activity leading to less retraction. Phosphatidylinositol 4, 5-biphosphate, which initiates actin polymerization from the plasma membrane, became less detectable at the cell periphery in KAI1/CD82-expressing cells. Moreover, KAI1/CD82-induced phenotypes likely resulted from the suppression of multiple signaling pathways such as integrin and growth factor signaling. In summary, at the cellular level KAI1/CD82 inhibited polarized protrusion and retraction events by disrupting actin reorganization; at the molecular level, KAI1/CD82 deregulated Rac1, RhoA, and their effectors cofilin and Rho kinase by perturbing the plasma membrane lipids.

Cervical cancer remains a major problem in women's health worldwide. In this research, a novel biodegradable d-α-tocopheryl polyethylene glycol 1000 succinate-b-poly(ε-caprolactone-ran-glycolide) (TPGS-b-(PCL-ran-PGA)) nanoparticle (NP) was developed as a co-delivery system of docetaxel and endostatin for the synergistic treatment of cervical cancer. Docetaxel-loaded TPGS-b-(PCL-ran-PGA) NPs were prepared and further modified by polyethyleneimine for coating plasmid pShuttle2-endostatin. All NPs were characterized in size, surface charge, morphology, and in vitro release of docetaxel and pDNA. The uptake of coumarin 6-loaded TPGS-b-(PCL-ran-PGA)/PEI-pDsRED by HeLa cells was observed via fluorescent microscopy and confocal laser scanning microscopy. Endostatin expression in HeLa cells transfected by TPGS-b-(PCL-ran-PGA)/PEI-pShuttle2-endostatin NPs was detected using Western blot analysis, and the cell viability of different NP-treated HeLa cells was determined by MTT assay. The HeLa cells from the tumor model, nude mice, were treated with various NPs including docetaxel-loaded-TPGS-b-(PCL-ran-PGA)/PEI-endostatin NPs, and their survival time, tumor volume and body weight were monitored during regimen process. The tumor tissue histopathology was analyzed using hematoxylin and eosin staining, and microvessel density in tumor tissue was evaluated immunohistochemically. The results showed that the TPGS-b-(PCL-ran-PGA)/PEI NPs can efficiently and simultaneously deliver both coumarin-6 and plasmids into HeLa cells, and the expression of endostatin was verified via Western blot analysis. Compared with control groups, the TPGS-b-(PCL-ran-PGA)/PEI-pShuttle2-endostatin NPs significantly decreased the cell viability of HeLa cells (p < 0.01), inhibited the growth of tumors, and even eradicated the tumors. The underlying mechanism is attributed to synergistic anti-tumor effects by the combined use of docetaxel, endostatin, and TPGS released from NPs. The TPGS-b-(PCL-ran-PGA) NPs could function as multifunctional carrier for chemotherapeutic drugs and genetic material delivery, and offer considerable potential as an ideal candidate for in vivo cancer therapy.

Morphogenesis and shape of the ocular lens depend on epithelial cell elongation and differentiation into fiber cells, followed by the symmetric and compact organization of fiber cells within an enclosed extracellular matrix-enriched elastic capsule. The cellular mechanisms orchestrating these different events however, remain obscure. We investigated the role of the Rac1 GTPase in these processes by targeted deletion of expression using the conditional gene knockout (cKO) approach. Rac1 cKO mice were derived from two different Cre (Le-Cre and MLR-10) transgenic mice in which lens-specific Cre expression starts at embryonic day 8.75 and 10.5, respectively, in both the lens epithelium and fiber cells. The Le-Cre/Rac1 cKO mice exhibited an early-onset (E12.5) and severe lens phenotype compared to the MLR-10/Rac1 cKO (E15.5) mice. While the Le-Cre/Rac1 cKO lenses displayed delayed primary fiber cell elongation, lenses from both Rac1 cKO strains were characterized by abnormal shape, impaired secondary fiber cell migration, sutural defects and thinning of the posterior capsule which often led to rupture. Lens fiber cell N-cadherin/β-catenin/Rap1/Nectin-based cell-cell junction formation and WAVE-2/Abi-2/Nap1-regulated actin polymerization were impaired in the Rac1 deficient mice. Additionally, the Rac1 cKO lenses were characterized by a shortened epithelial sheet, reduced levels of extracellular matrix (ECM) proteins and increased apoptosis. Taken together, these data uncover the essential role of Rac1 GTPase activity in establishment and maintenance of lens shape, suture formation and capsule integrity, and in fiber cell migration, adhesion and survival, via regulation of actin cytoskeletal dynamics, cell adhesive interactions and ECM turnover.

Cold tolerance and the green period are key traits in the breeding of zoysiagrass (Zoysia Willd.). Identification of molecular markers associated with cold tolerance and the green period of zoysiagrass will contribute to efficient selection of elite cultivars. These two traits were measured in 96 zoysiagrass accessions in 2004 and 2005–2006, respectively. The mapping population was screened with 29 pairs of simple sequence repeat (SSR) primers and 54 pairs of sequence-related amplified polymorphism (SRAP) primers. A multi-loci in silico mapping approach implemented with an empirical Bayes method was applied for association mapping of cold tolerance and green period. We detected 254 SSR polymorphic loci and 338 SRAP polymorphic loci, among which three SSR loci (Xgwm131-3B-187, Xgwm469-6D-194 and Xgwm234-5B-244) and one SRAP locus (Me11Em7-406) were significantly associated with cold tolerance with effect values of 57.83%, 38.05%, 36.92% and 37%, respectively. Three SSR loci (Xgwm132-6B-225, Xgwm111-7D-34 and Xgwm102-2D-97) and two SRAP loci (Me19Em5-359 and Me16Em8-483) were significantly associated with the green period with effect values of 79.54%, 62.59%, 99.04%, 49.01% and 82.57%. These markers will be useful for genetic improvement of the cold tolerance and green period of zoysiagrass by marker-assisted breeding.

The prognosis for diabetic foot ulcers (DFUs) remains poor. Nutritional status has not been identified as one of the factors affecting the outcome of DFUs. Therefore, indicators correlated with nutritional status and outcome were analyzed to investigate their relationship. A total of 192 hospitalized patients with Wagner grade 1–5 ulcers and 60 patients with Wagner grade 0 ulcers (all had type 2 diabetes) were assessed by the following: subjective global assessment (SGA), anthropometric measurements, biochemical indicators and physical examinations to evaluate nutritional status, severity of infection and complications. Patient outcome was recorded as healing of the ulcer and the patients were followed up for 6 months or until the wound was healed. The percentage of malnutrition was 62.0% in the DFU patients. The SGA was closely correlated with infection (r=0.64), outcome (r=0.37) and BMI (r=−0.36), all P<0.001. The risk of poor outcome increased with malnutrition [odds ratio (OR), 10.6, P<0.001]. The nutritional status of the DFU patients was independently correlated with the severity of infection and outcome (both P<0.001) and Wagner grades and nutritional status (SGA) were independent risk factors for patient outcome (both P<0.001). Nutritional status deteriorated as the severity of the DFU increased, and malnutrition was a predictor of poor prognosis.

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

A previous study reported that combinatorial human endostatin and soluble tumor necrosis factor (TNF)-related apoptosis-inducing ligand (sTRAIL) gene transfer suppresses human hepatocellular carcinoma (HCC) growth and angiogenesis using the pVAX1 plasmid vector. The current study investigated the antitumor efficacy in HCC through adenovirus-mediated combination gene therapy. Human endostatin and sTRAIL (114 to 281 AA) genes were amplified and cloned into the Adeno-X expression vector. The recombinant adenoviruses (Ad-E and Ad-T) were packaged, amplified in the HEK 293 cells and used to infect human umbilical vein endothelial cells (HUVECs) and HepG2 cells, respectively. The results revealed that a significant cell growth inhibition was observed in the two types of cells using a cell viability assay. Intratumoral administration with Ad-E and Ad-T revealed a significant enhanced regression of the tumors compared with treatment with either recombinant adenovirus alone. Histology and immunohistochemistry examination further indicated that the inhibition of tumor growth appeared to result from increased apoptosis and reduced angiogenesis in tumor xenografts. In conclusion, these data further confirm the enhancement of antitumor efficacy through combined endostatin and TRAIL gene therapy and provide a promising application prospect by virtue of adenovirus-mediated anti-angiogenic and pro-apoptotic cancer gene therapy.

Objective

The G-403A polymorphism in RANTES gene may be involved in the development of coronary artery disease (CAD) through increasing RANTES-mediated leukocyte trafficking and activation. However, studies investigating the relationship between G-403A polymorphism and CAD yielded contradictory and inconclusive results. In order to shed some light on these inconsistent findings, a meta analysis was performed to clarify the role of G-403A polymorphism of RANTES gene in the susceptibility of CAD.

Methods

A systemic literature search of PubMed and EMBASE was conducted from their inception to March 23, 2012, to retrieve related studies. In addition, Conference Proceedings Citation Index-Science was searched, authors of relevant studies were contacted, and reference lists of the included studies and their related citations in PubMed were reviewed for additional pertinent studies.

Results

A total of 8 eligible studies were identified, with a total of 4252 CAD cases and 2150 controls. There was no evidence of significant association between G-403A polymorphism and CAD risk in any genetic model or pairwise comparisons (additive model: OR = 1.046, 95% CI = 0.883–1.239, I2 = 65.9%; recessive model: OR = 1.140, 95% CI = 0.774–1.678, I2 = 53.1%; dominant model: OR = 1.000, 95% CI = 0.820–1.21), I2 = 62.6%; AA vs GG: OR = 1.141, 95% CI = 0.734–1.773, I2 = 61.2%; GA vs GG: OR = 0.993, 95% CI = 0.800–1.232, I2 = 64.6%). Subgroup analysis and meta regression indicated that ethnicity and genotyping method accounted for the significant heterogeneity among studies. In the stratified analysis by ethnic group, G-403A polymorphism was found to be associated with increased CAD risk in Caucasian population whereas its protective role was observed in Asian population in some but not all comparisons.

Conclusion

Data from the current meta-analysis do not support the existence of a relationship between G-403A polymorphism and the development of CAD, and large sample size study employing unified genotyping method is needed to further evaluate the influence of G-403A polymorphism on susceptibility of CAD.

Background

Deep sequencing is a powerful tool for novel small RNA discovery. Illumina small RNA sequencing library preparation requires a pre-adenylated 3’ end adapter containing a 5’,5’-adenyl pyrophosphoryl moiety. In the absence of ATP, this adapter can be ligated to the 3’ hydroxyl group of small RNA, while RNA self-ligation and concatenation are repressed. Pre-adenylated adapters are one of the most essential and costly components required for library preparation, and few are commercially available.

Results

We demonstrate that DNA oligo with 5’ phosphate and 3’ amine groups can be enzymatically adenylated by T4 RNA ligase 1 to generate customized pre-adenylated adapters. We have constructed and sequenced a small RNA library for tomato (Solanum lycopersicum) using the T4 RNA ligase 1 adenylated adapter.

Conclusion

We provide an efficient and low-cost method for small RNA sequencing library preparation, which takes two days to complete and costs around $20 per library. This protocol has been tested in several plant species for small RNA sequencing including sweet potato, pepper, watermelon, and cowpea, and could be readily applied to any RNA samples.

A fully automated chiral capillary electrophoresis - tandem mass spectrometric method (CE-MS/MS) was developed for enantiomeric quantification of DOPA and its precursors, phenylalanine (Phe) and tyrosine (Tyr). To avoid MS source contamination, a negatively charged chiral selector, sulfated β-cyclodextrin (sulfated β-CD) that migrated away from the detector was used in combination with the partial filling technique. The six stereoisomers were simultaneously quantified in less than 12 min. Detection limits were 0.48 and 0.51 μM for L- and D-DOPA enantiomers, respectively. Assay reproducibility (RSD, n=6) were 4.43%, 3.15%, 4.91%, 5.16%, 3.96%, and 3.25% for L-/D-DOPA, L-/D-Tyr, and L-/D-Phe at 10.0 μM, respectively. Thanks to the high enantioseparation efficiency, detection of trace D-DOPA in L-/D-DOPA mixtures could be achieved. The assay was employed to study the metabolism of DOPA, a well known therapeutic drug for treating Parkinson’s disease. It was found that L-DOPA was metabolized effectively in PC-12 cells. About 88% of L-DOPA disappeared after incubation at a cell density of 2 × 106 cells/mL for 3 hrs. However, D-DOPA coexisting with L-DOPA in the incubation solution remained intact. The enantiospecific metabolism of DOPA in this neuronal model was demonstrated.

The Rho family of GTPases represents a class of Ras-related signaling molecules often deregulated in cancer. Rho GTPases switch from a GDP-bound, inactive state to a GTP-bound, active state in response to extracellular stimuli such as mitogens and extracellular matrix. In addition, Rho GTPase signaling can be altered in response to cell intrinsic factors such as changes in oncogenic or tumor suppressor signaling. In their active form, these proteins bind to a number of effector molecules, activating signaling cascades which regulate a variety of cellular processes including cytoskeletal reorganization, cell cycle progression, cell polarity and transcription. Here, we focus on one Rho family member, Cdc42, which is overexpressed in a number of human cancers. Consistent with a role in the promotion of tumorigenesis, activating mutations in Cdc42 and guanine nucleotide exchange factors are transforming, while inhibition of Cdc42 activity can impinge on cellular transformation following the activation of oncoproteins or loss of tumor suppressor function. Furthermore, Cdc42 activity has been implicated in the invasive phenotype which characterizes tumor metastasis, further suggesting that Cdc42 may be a useful target for therapeutic intervention. However, several recent studies in mice have unveiled a putative tumor suppressor function of Cdc42 in several tissue types which may involve cell polarity maintenance, suggesting that the role of Cdc42 in cancer development is complex and may be cell type specific.

A key issue regarding the use of stem cells in cardiovascular regenerative medicine is their retention in target tissues. Here, we have generated and assessed a bispecific antibody heterodimer designed to improve the retention of bone marrow–derived multipotent stromal cells (BMMSC) in cardiac tissue damaged by myocardial infarction. The heterodimer comprises an anti-human CD90 monoclonal antibody (mAb) (clone 5E10) and an anti-myosin light chain 1 (MLC1) mAb (clone MLM508) covalently cross-linked by a bis-aryl hydrazone. We modified the anti-CD90 antibody with a pegylated-4-formylbenzamide moiety to a molar substitution ratio (MSR) of 2.6 and the anti-MLC1 antibody with a 6-hydrazinonicotinamide moiety to a MSR of 0.9. The covalent modifications had no significant deleterious effect on mAb epitope binding. Furthermore, the binding of anti-CD90 antibody to BMMSCs did not prevent their differentiation into adipo-, chondro-, or osteogenic lineages. Modified antibodies were combined under mild conditions (RT, pH 6, 1 h) in the presence of a catalyst (aniline) to allow for rapid generation of the covalent bis-aryl hydrazone, which was monitored at A354. We evaluated epitope immunoreactivity for each mAb in the construct. Flow cytometry demonstrated binding of the bispecific construct to BMMSCs that was competed by free anti-CD90 mAb, verifying that modification and cross-linking were not detrimental to the anti-CD90 complementarity-determining region. Similarly, ELISA-based assays demonstrated bispecific antibody binding to plastic-immobilized recombinant MLC1. Excess anti-MLC1 mAb competed for bispecific antibody binding. Finally, the anti-CD90 × anti-MLC1 bispecific antibody construct induced BMMSC adhesion to plastic-immobilized MLC1 that was resistant to shear stress, as measured in parallel-plate flow chamber assays. We used mAbs that bind both human antigens and the respective pig homologues. Thus, the anti-CD90 × anti-MLC1 bispecific antibody may be used in large animal studies of acute myocardial infarction and may provide a starting point for clinical studies.

Background

To explore the association of ALOX5AP single nucleotide polymorphisms (SNPs) and haplotype with the occurrence of cerebral infarction in the Han population of northern China.

Methods

Blood samples were collected from 236 patients of Han ancestry with a history of cerebral infarction and 219 healthy subjects of Han ancestry with no history of cerebral infarction or cardiovascular disease. Applied Biosystems® TaqMan® SNP Genotyping Assays for SNP genotyping were used to determine the genotypes of 7 ALOX5AP SNP alleles (rs4073259, rs4769874, rs9315050, rs9551963, rs10507391, rs9579646, and rs4147064).

Results

One SNP allele (A) of rs4073259 was significantly associated with development of cerebral infarction (P = 0.049). In comparison to control groups, haplotype rs9315050&rs9551963 AAAC [OR (95% CI) =1.53 (1.02-2.29)], and genotypes rs4147064 CT [OR (95% CI) =1.872 (1.082-3.241)], and rs9551963 AC [OR (95% CI) = 2.015 (1.165-3.484)] increased the risk of cerebral infarction in patients with hypertension. Genotype rs9579646 GG [OR (95% CI) = 2.926 (1.18-7.251)] increased the risk of, while rs4073259 GG [OR (95% CI) = 0.381 (0.157-0.922)] decreased the risk of cerebral infarction in patients with diabetes.

Conclusion

These results suggest the ALOX5AP SNP A allele in rs4073259 and genotype rs9579646 GG, rs9551963 AC, and haplotype rs9315050 & rs9551963 AAAC were associated with an increased risk of ischemic stroke in the Han population, while rs4073259 GG was associated with a decreased risk.

AIM: To investigate the mechanism of interleukin (IL)-6 secretion through blocking the IL-17A/IL-17A receptor (IL-17RA) signaling pathway with a short hairpin RNA (shRNA) in hepatic stellate cells (HSCs) in vitro.

METHODS: HSCs were derived from the livers of adult male Sprague-Dawley rats. IL-6 expression was evaluated using real-time quantitative polymerase chain reaction and enzyme linked immunosorbent assay. The phosphorylation activity of p38 mitogen activated protein kinases (MAPK) and extracellular regulated protein kinases (ERK) 1/2 upon induction by IL-17A and suppression by IL-17RA shRNA were examined using Western blotting.

RESULTS: IL-6 expression induced by IL-17A was significantly increased compared to control in HSCs (P < 0.01 in a dose-dependent manner). Suppression of IL-17RA using lentiviral-mediated shRNA inhibited IL-6 expression induced by IL-17A compared to group with only IL-17A treatment (1.44 ± 0.17 vs 4.07 ± 0.43, P < 0.01). IL-17A induced rapid phosphorylation of p38 MAPK and ERK1/2 after 5 min exposure, and showed the strongest levels of phosphorylation of p38 MAPK and ERK1/2 at 15 min in IL-17A-treated HSCs. IL-6 mRNA expression induced by IL-17A (100 ng/mL) for 3 h exposure was inhibited by preincubation with specific inhibitors of p38 MAPK (SB-203580) and ERK1/2 (PD-98059) compared to groups without inhibitors preincubation (1.67 ± 0.24, 2.01 ± 0.10 vs 4.08 ± 0.59, P < 0.01). Moreover, Lentiviral-mediated IL-17RA shRNA 1 inhibited IL-17A-induced IL-6 mRNA expression compared to random shRNA in HSCs (1.44 ± 0.17 vs 3.98 ± 0.68, P < 0.01). Lentiviral-mediated IL-17RA shRNA 1 inhibited phosphorylation of p38 MAPK and ERK1/2 induced by 15 min IL-17A (100 ng/mL) exposure.

CONCLUSION: Down-regulation of the IL-17RA receptor by shRNA decreased IL-6 expression induced by IL-17A via p38 MAPK and ERK1/2 phosphorylation in HSCs. Suppression of IL-17RA expression may be a strategy to reduce the inflammatory response induced by IL-17A in the liver.

Objective

The AVOID-FFS (Avoidance of Far-Field R-wave Sensing) study aimed to investigate whether an atrial lead with a very short tip-to-ring spacing without optimization of pacemaker settings shows equally low incidence of far-field R-wave sensing (FFS) when compared to a conventional atrial lead in combination with optimization of the programming.

Methods

Patients receiving a dual chamber pacemaker were randomly assigned to receive an atrial lead with a tip-to-ring spacing of 1.1 mm or a lead with a conventional tip-to-ring spacing of 10 mm. Postventricular atrial blanking (PVAB) was programmed to the shortest possible value of 60 ms in the study group, and to an individually determined optimized value in the control group. Atrial sensing threshold was programmed to 0.3 mV in both groups. False positive mode switch caused by FFS was evaluated at one and three months post implantation.

Results

A total of 204 patients (121 male; age 73±10 years) were included in the study. False positive mode switch caused by FFS was detected in one (1%) patient of the study group and two (2%) patients of the control group (p = 0.62).

Conclusion

The use of an atrial electrode with a very short tip-to-ring spacing avoids inappropriate mode switch caused by FFS without the need for individual PVAB optimization.

Trial Registration

ClinicalTrials.gov NCT00512915