PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-2 (2)
 

Clipboard (0)
None

Select a Filter Below

Journals
Authors
Year of Publication
Document Types
author:("Xiao, fanging")
1.  On the Role of low-energy electrons in the radiosensitization of DNA by gold nanoparticles 
Nanotechnology  2011;22(46):10.1088/0957-4484/22/46/465101.
Four different gold nanoparticle (GNP) preparations, including nude GNP and GNP coated either with thiolated undecane (S-C11H23), or with dithiolated diethylenetriaminepentaacetic (DTDTPA) or gadolinium (Gd) DTDTPA chelating agents were synthesized. The average diameters, for each type of nanoparticle are 5 nm, 10 and 13 nm, respectively. Dry films of plasmid DNA pGEM-3Zf(-), DNA with bound GNP and DNA with coated GNP were bombarded with 60 keV electrons. The yields of single and double strand breaks were measured as a function of exposure by electrophoresis. The binding of only one GNP without coating to DNA containing 3197 base pairs increases single and double strand breaks by a factor of 2.3 while for GNP coated with S-C11H23 this factor is reduced to 1.6. GNP coated with the DTDTPA and DTDTPA:Gd in same ratio with DNA, produce essentially no increment in damage. These results could be explained by the attenuation by the coatings of the intensity of low energy photoelectrons emitted from GNP. Thus, coatings of GNP may considerably attenuate short-range low energy electrons emitted from gold, leading to a considerable decrease of radiosensitization. According to our results, the highest radiosensitization should be obtained with GNP having the shortest possible ligand, directed to the DNA of cancer cells.
doi:10.1088/0957-4484/22/46/465101
PMCID: PMC3829822  PMID: 22024607 CAMSID: cams1998
2.  Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL 
The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.
doi:10.1155/2012/649640
PMCID: PMC3485869  PMID: 23133406

Results 1-2 (2)