PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-13 (13)
 

Clipboard (0)
None

Select a Filter Below

Journals
Year of Publication
Document Types
1.  Genomic and proteomic characterization of the large Myoviridae bacteriophage ϕTMA of the extreme thermophile Thermus thermophilus 
Bacteriophage  2011;1(3):152-164.
A lytic phage, designated as ϕTMA, was isolated from a Japanese hot spring using Thermus thermophilus HB27 as an indicator strain. Electron microscopic examination showed that ϕTMA had an icosahedral head and a contractile tail. The circular double-stranded DNA sequence of ϕTMA was 151,483 bp in length, and its organization was essentially same as that of ϕYS40 except that the ϕTMA genome contained genes for a pair of transposase and resolvase, and a gene for a serine to asparagine substituted ortholog of the protein involved in the initiation of the ϕYS40 genomic DNA synthesis. The different host specificities of ϕTMA and ϕYS40 could be explained by the sequence differences in the C-terminal regions of their distal tail fiber proteins. The ΔpilA knockout strains of T. thermophilus showed simultaneous loss of sensitivity to their cognate phages, pilus structure, twitching motility and competence for natural transformation, thus suggesting that the phage infection required the intact host pili. Pulsed-field gel electrophoresis analysis of the ϕTMA and ϕYS40 genomes revealed that the length of their DNA exceeded 200 kb, indicating that the terminal redundancy is more than 30% of the closed circular form. Proteomic analysis of the ϕTMA virion using a combination of N-terminal sequencing and mass spectrometric analysis of peptide fragments suggested that the maturation of several proteins involved in the phage assembly process was mediated by a trypsin-like protease. The gene order of the phage structural proteins was also discussed.
doi:10.4161/bact.1.3.16712
PMCID: PMC3225780  PMID: 22164349
Thermus thermophilus; myovirus; genomics; antagonistic coevolution; proteomics
2.  Dual Biosynthesis Pathway for Longer-Chain Polyamines in the Hyperthermophilic Archaeon Thermococcus kodakarensis▿ †  
Journal of Bacteriology  2010;192(19):4991-5001.
Long-chain and/or branched-chain polyamines are unique polycations found in thermophiles. Cytoplasmic polyamines were analyzed for cells cultivated at various growth temperatures in the hyperthermophilic archaeon Thermococcus kodakarensis. Spermidine [34] and N4-aminopropylspermine [3(3)43] were identified as major polyamines at 60°C, and the amounts of N4-aminopropylspermine [3(3)43] increased as the growth temperature rose. To identify genes involved in polyamine biosynthesis, a gene disruption study was performed. The open reading frames (ORFs) TK0240, TK0474, and TK0882, annotated as agmatine ureohydrolase genes, were disrupted. Only the TK0882 gene disruptant showed a growth defect at 85°C and 93°C, and the growth was partially retrieved by the addition of spermidine. In the TK0882 gene disruptant, agmatine and N1-aminopropylagmatine accumulated in the cytoplasm. Recombinant TK0882 was purified to homogeneity, and its ureohydrolase characteristics were examined. It possessed a 43-fold-higher kcat/Km value for N1-aminopropylagmatine than for agmatine, suggesting that TK0882 functions mainly as N1-aminopropylagmatine ureohydrolase to produce spermidine. TK0147, annotated as spermidine/spermine synthase, was also studied. The TK0147 gene disruptant showed a remarkable growth defect at 85°C and 93°C. Moreover, large amounts of agmatine but smaller amounts of putrescine accumulated in the disruptant. Purified recombinant TK0147 possessed a 78-fold-higher kcat/Km value for agmatine than for putrescine, suggesting that TK0147 functions primarily as an aminopropyl transferase to produce N1-aminopropylagmatine. In T. kodakarensis, spermidine is produced mainly from agmatine via N1-aminopropylagmatine. Furthermore, spermine and N4-aminopropylspermine were detected in the TK0147 disruptant, indicating that TK0147 does not function to produce spermine and long-chain polyamines.
doi:10.1128/JB.00279-10
PMCID: PMC2944531  PMID: 20675472
3.  Crystallization and preliminary X-ray diffraction studies of the prototypal homologue of mitoNEET (Tth-NEET0026) from the extreme thermophile Thermus thermophilus HB8 
A thermophilic bacterial homologue of mitoNEET (a mammalian mitochondrial outer membrane protein) from T. thermophilus HB8 (open reading frame TTHA0026; Tth-NEET0026) has been identified as a water-soluble prototypal [2Fe–2S] protein and crystallized. The bipyramidal crystals of the recombinant Tth-NEET0026 diffracted to 1.80 Å resolution using synchrotron radiation.
MitoNEET (a mammalian mitochondrial outer membrane protein) is a potential pharmacological and clinical target of the insulin-sensitizer pioglitazone. The thermophilic homologue of mitoNEET (TTHA0026) from Thermus thermophilus HB8 has been heterologously overproduced in Escherichia coli and purified as a water-soluble prototypal protein containing the mitoNEET-like [2Fe–2S] cluster. The resultant recombinant protein, named Tth-NEET0026, has been crystallized in its oxidized form by the hanging-drop vapour-diffusion method using 17%(w/v) polyethylene glycol 4000, 8.5%(v/v) 2-­propanol, 15%(v/v) glycerol and 0.085 M HEPES–NaOH pH 7.2. The dark reddish crystals diffracted to 1.80 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 45.51, c = 84.26 Å. The asymmetric unit contains one protein molecule.
doi:10.1107/S1744309108035975
PMCID: PMC2593688  PMID: 19052371
mitoNEET; [2Fe–2S] clusters; type II diabetes; Thermus thermophilus
4.  Gain and loss of an intron in a protein-coding gene in Archaea: the case of an archaeal RNA pseudouridine synthase gene 
Background
We previously found the first examples of splicing of archaeal pre-mRNAs for homologs of the eukaryotic CBF5 protein (also known as dyskerin in humans) in Aeropyrum pernix, Sulfolobus solfataricus, S. tokodaii, and S. acidocaldarirus, and also showed that crenarchaeal species in orders Desulfurococcales and Sulfolobales, except for Hyperthermus butylicus, Pyrodictium occultum, Pyrolobus fumarii, and Ignicoccus islandicus, contain the (putative) cbf5 intron. However, the exact timing of the intron insertion was not determined and verification of the putative secondary loss of the intron in some lineages was not performed.
Results
In the present study, we determined approximately two-thirds of the entire coding region of crenarchaeal Cbf5 sequences from 43 species. A phylogenetic analysis of our data and information from the available genome sequences suggested that the (putative) cbf5 intron existed in the common ancestor of the orders Desulfurococcales and Sulfolobales and that probably at least two independent lineages in the order Desulfurococcales lost the (putative) intron.
Conclusion
This finding is the first observation of a lineage-specific loss of a pre-mRNA intron in Archaea. As the insertion or deletion of introns in protein-coding genes in Archaea has not yet been seriously considered, our finding suggests the possible difficulty of accurately and completely predicting protein-coding genes in Archaea.
doi:10.1186/1471-2148-9-198
PMCID: PMC2738675  PMID: 19671140
5.  Effects of pH and Temperature on the Composition of Polar Lipids in Thermoplasma acidophilum HO-62 ▿ †  
Journal of Bacteriology  2008;190(15):5404-5411.
Thermoplasma acidophilum HO-62 was grown at different pHs and temperatures, and its polar lipid compositions were determined. Although the number of cyclopentane rings in the caldarchaeol moiety increased when T. acidophilum was cultured at high temperature, the number decreased at low pHs. Glycolipids, phosphoglycolipids, and phospholipids were analyzed by high-performance liquid chromatography with an evaporative light-scattering detector. The amount of caldarchaeol with more than two sugar units on one side increased under low-pH and high-temperature conditions. The amounts of glycolipids increased and those of phosphoglycolipids decreased under these conditions. The proton permeability of the liposomes obtained from the phosphoglycolipids that contained two or more sugar units was lower than that of the liposomes obtained from the phosphoglycolipids that contained one sugar unit. From these results, we propose the hypothesis that T. acidophilum adapts to low pHs and high temperatures by extending sugar chains on their cell surfaces, as well as by varying the number of cyclopentane rings.
doi:10.1128/JB.00415-08
PMCID: PMC2493274  PMID: 18539746
6.  Effects of a Squalene Epoxidase Inhibitor, Terbinafine, on Ether Lipid Biosyntheses in a Thermoacidophilic Archaeon, Thermoplasma acidophilum 
Journal of Bacteriology  2002;184(5):1395-1401.
The archaeal plasma membrane consists mainly of diether lipids and tetraether lipids instead of the usual ester lipids found in other organisms. Although a molecule of tetraether lipid is thought to be synthesized from two molecules of diether lipids, there is no direct information about the biosynthetic pathway(s) or intermediates of tetraether lipid biosynthesis. In this study, we examined the effects of the fungal squalene epoxidase inhibitor terbinafine on the growth and ether lipid biosyntheses in the thermoacidophilic archaeon Thermoplasma acidophilum. Terbinafine was found to inhibit the growth of T. acidophilum in a concentration-dependent manner. When growing T. acidophilum cells were pulse-labeled with [2-14C]mevalonic acid in the presence of terbinafine, incorporation of radioactivity into the tetraether lipid fraction was strongly suppressed, while accumulation of radioactivity was noted at the position corresponding to diether lipids, depending on the concentration of terbinafine. After the cells were washed with fresh medium and incubated further without the radiolabeled substrate and the inhibitor, the accumulated radioactivity in the diether lipid fraction decreased quickly while that in the tetraether lipids increased simultaneously, without significant changes in the total radioactivity of ether lipids. These results strongly suggest that terbinafine inhibits the biosynthesis of tetraether lipids from a diether-type precursor lipid(s). The terbinafine treatment will be a tool for dissecting tetraether lipid biosynthesis in T. acidophilum.
doi:10.1128/JB.184.5.1395-1401.2002
PMCID: PMC134840  PMID: 11844769
7.  Complete Polar Lipid Composition of Thermoplasma acidophilum HO-62 Determined by High-Performance Liquid Chromatography with Evaporative Light-Scattering Detection 
Journal of Bacteriology  2002;184(2):556-563.
Polar ether lipids of Thermoplasma acidophilum HO-62 were purified by high-performance liquid chromatography with an evaporative light-scattering detector. Structures of purified lipids were investigated by capillary gas chromatography, mass spectrometry, and nuclear magnetic resonance. Three types of ether lipids were found: phospholipids, glycolipids, and phosphoglycolipids. The two phospholipids had glycerophosphate as the phosphoester moiety. The seven glycolipids had different combinations of gulose, mannose, and glucose, which formed mono- or oligosaccharides. The eight phosphoglycolipids with two polar head groups contained glycerophosphate as the phosphoester moiety and gulose alone or gulose and mannose, which formed mono- or oligosaccharides, as the sugar moiety. Although gulose is an unusual sugar in nature, several glyco- and phosphoglycolipids contained gulose as one of the sugar moieties in Thermoplasma acidophilum. All the ether lipids had isopranoid chains of C40 or C20 with zero to three cyclopentane rings. The structures of these lipids including four new glycolipids and three new phosphoglycolipids were determined, and a glycosylation process for biosynthesis of these glycolipids was suggested.
doi:10.1128/JB.184.2.556-563.2002
PMCID: PMC139571  PMID: 11751835
8.  Quinone Profiles of Thermoplasma acidophilum HO-62 
Journal of Bacteriology  2001;183(4):1462-1465.
Quinones of Thermoplasma acidophilum HO-62 were analyzed by high-performance liquid chromatography, mass spectrometry, and nuclear magnetic resonance. Menaquinone, methionaquinone, and 2-trans and 2-cis forms of thermoplasmaquinone were identified. The relative amount of thermoplasmaquinone increased under anaerobic conditions, and those of menaquinone and methionaquinone increased under aerobic conditions.
doi:10.1128/JB.183.4.1462-1465.2001
PMCID: PMC95023  PMID: 11157962
9.  Phylogenetic Diversity of Symbiotic Methanogens Living in the Hindgut of the Lower Termite Reticulitermes speratus Analyzed by PCR and In Situ Hybridization 
A phylogenetic analysis of the sequences of 60 clones of archaeal small-subunit rRNA genes amplified from the termite Reticulitermes speratus revealed that most of them (56 clones) clustered in the genus Methanobrevibacter. Three clones were classified in the order Thermoplasmales. The Methanobrevibacter-related symbionts were detected by in situ hybridization analysis.
PMCID: PMC91104  PMID: 9925625
10.  sn-Glycerol-1-Phosphate-Forming Activities in Archaea: Separation of Archaeal Phospholipid Biosynthesis and Glycerol Catabolism by Glycerophosphate Enantiomers 
Journal of Bacteriology  1999;181(4):1330-1333.
In Methanobacterium thermoautotrophicum, sn-glycerol-1-phosphate (G-1-P) dehydrogenase is responsible for the formation of the Archaea-specific backbone of phospholipids, G-1-P, from dihydroxyacetonephosphate (DHAP). The possible G-1-P-forming activities were surveyed in cell-free extracts of six species of Archaea. All the archaeal cell-free homogenates tested revealed the ability to form G-1-P from DHAP. In addition, activities of G-3-P-forming glycerol kinase and G-3-P dehydrogenase were also detected in four heterotrophic archaea, while glycerol kinase activity was not detected in two autotrophic methanogens. These results show that G-1-P is produced from DHAP by G-1-P dehydrogenase in a wide variety of archaea while exogenous glycerol is catabolized via G-3-P.
PMCID: PMC93513  PMID: 9973362
11.  Recombination-Deficient Mutants of an Extreme Thermophile, Thermus thermophilus 
Recombination-deficient strains of the extreme thermophile Thermus thermophilus have been prepared from a leucine-isoleucine mutant strain (NM6). The availability of such recombination-deficient thermophilic bacterial strains may provide especially good hosts for work with plasmid vectors.
Images
PMCID: PMC182350  PMID: 16349029
12.  An Alkalophilic Bacillus sp. Produces 2-Phenylethylamine 
A large amount of 2-phenylethylamine was produced in cells of alkalophilic Bacillus sp. strain YN-2000. This amine is secreted in the medium during the cell growth. The amounts of 2-phenylethylamine in both cells and medium change upon changing the pH of the medium.
PMCID: PMC182345  PMID: 16349025
13.  The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8 
Nucleic Acids Research  1981;9(19):5159-5162.
Using 3′- and 5′-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA OH. This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.
PMCID: PMC327506  PMID: 6171775

Results 1-13 (13)