PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (39)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
more »
1.  Colistin Resistance in Acinetobacter baumannii Is Mediated by Complete Loss of Lipopolysaccharide Production ▿  
Antimicrobial Agents and Chemotherapy  2010;54(12):4971-4977.
Infections caused by multidrug-resistant (MDR) Gram-negative bacteria represent a major global health problem. Polymyxin antibiotics such as colistin have resurfaced as effective last-resort antimicrobials for use against MDR Gram-negative pathogens, including Acinetobacter baumannii. Here we show that A. baumannii can rapidly develop resistance to polymyxin antibiotics by complete loss of the initial binding target, the lipid A component of lipopolysaccharide (LPS), which has long been considered to be essential for the viability of Gram-negative bacteria. We characterized 13 independent colistin-resistant derivatives of A. baumannii type strain ATCC 19606 and showed that all contained mutations within one of the first three genes of the lipid A biosynthesis pathway: lpxA, lpxC, and lpxD. All of these mutations resulted in the complete loss of LPS production. Furthermore, we showed that loss of LPS occurs in a colistin-resistant clinical isolate of A. baumannii. This is the first report of a spontaneously occurring, lipopolysaccharide-deficient, Gram-negative bacterium.
doi:10.1128/AAC.00834-10
PMCID: PMC2981238  PMID: 20855724
2.  Biological Cost of Different Mechanisms of Colistin Resistance and Their Impact on Virulence in Acinetobacter baumannii 
Two mechanisms of resistance to colistin have been described in Acinetobacter baumannii. One involves complete loss of lipopolysaccharide (LPS), resulting from mutations in lpxA, lpxC, or lpxD, and the second is associated with phosphoethanolamine addition to LPS, mediated through mutations in pmrAB. In order to assess the clinical impacts of both resistance mechanisms, A. baumannii ATCC 19606 and its isogenic derivatives, AL1851 ΔlpxA, AL1852 ΔlpxD, AL1842 ΔlpxC, and ATCC 19606 pmrB, were analyzed for in vitro growth rate, in vitro and in vivo competitive growth, infection of A549 respiratory alveolar epithelial cells, virulence in the Caenorhabditis elegans model, and virulence in a systemic mouse infection model. The in vitro growth rate of the lpx mutants was clearly diminished; furthermore, in vitro and in vivo competitive-growth experiments revealed a reduction in fitness for both mutant types. Infection of A549 cells with ATCC 19606 or the pmrB mutant resulted in greater loss of viability than with lpx mutants. Finally, the lpx mutants were highly attenuated in both the C. elegans and mouse infection models, while the pmrB mutant was attenuated only in the C. elegans model. In summary, while colistin resistance in A. baumannii confers a clear selective advantage in the presence of colistin treatment, it causes a noticeable cost in terms of overall fitness and virulence, with a more striking reduction associated with LPS loss than with phosphoethanolamine addition. Therefore, we hypothesize that colistin resistance mediated by changes in pmrAB will be more likely to arise in clinical settings in patients treated with colistin.
doi:10.1128/AAC.01597-13
PMCID: PMC3910726  PMID: 24189257
3.  Pasteurella multocida Heddleston Serovar 3 and 4 Strains Share a Common Lipopolysaccharide Biosynthesis Locus but Display both Inter- and Intrastrain Lipopolysaccharide Heterogeneity 
Journal of Bacteriology  2013;195(21):4854-4864.
Pasteurella multocida is a Gram-negative multispecies pathogen and the causative agent of fowl cholera, a serious disease of poultry which can present in both acute and chronic forms. The major outer membrane component lipopolysaccharide (LPS) is both an important virulence factor and a major immunogen. Our previous studies determined the LPS structures expressed by different P. multocida strains and revealed that a number of strains belonging to different serovars contain the same LPS biosynthesis locus but express different LPS structures due to mutations within glycosyltransferase genes. In this study, we report the full LPS structure of the serovar 4 type strain, P1662, and reveal that it shares the same LPS outer core biosynthesis locus, L3, with the serovar 3 strains P1059 and Pm70. Using directed mutagenesis, the role of each glycosyltransferase gene in LPS outer core assembly was determined. LPS structural analysis of 23 Australian field isolates that contain the L3 locus revealed that at least six different LPS outer core structures can be produced as a result of mutations within the LPS glycosyltransferase genes. Moreover, some field isolates produce multiple but related LPS glycoforms simultaneously, and three LPS outer core structures are remarkably similar to the globo series of vertebrate glycosphingolipids. Our in-depth analysis showing the genetics and full range of P. multocida lipopolysaccharide structures will facilitate the improvement of typing systems and the prediction of the protective efficacy of vaccines.
doi:10.1128/JB.00779-13
PMCID: PMC3807493  PMID: 23974032
4.  Evolutionary Analysis of Burkholderia pseudomallei Identifies Putative Novel Virulence Genes, Including a Microbial Regulator of Host Cell Autophagy 
Journal of Bacteriology  2013;195(24):5487-5498.
Burkholderia pseudomallei, the causative agent of melioidosis, contains a large pathogen genome (7.2 Mb) with ∼2,000 genes of putative or unknown function. Interactions with potential hosts and environmental factors may induce rapid adaptations in these B. pseudomallei genes, which can be discerned through evolutionary analysis of multiple B. pseudomallei genomes. Here we show that several previously uncharacterized B. pseudomallei genes bearing genetic signatures of rapid adaptation (positive selection) can induce diverse cellular phenotypes when expressed in mammalian cells. Notably, several of these phenotypes are plausibly related to virulence, including multinuclear giant cell formation, apoptosis, and autophagy induction. Specifically, we show that BPSS0180, a type VI cluster-associated gene, is capable of inducing autophagy in both phagocytic and nonphagocytic mammalian cells. Following infection of macrophages, a B. pseudomallei mutant disrupted in BPSS0180 exhibited significantly decreased colocalization with LC3 and impaired intracellular survival; these phenotypes were rescued by introduction of an intact BPSS0180 gene. The results suggest that BPSS0180 may be a novel inducer of host cell autophagy that contributes to B. pseudomallei intracellular growth. More generally, our study highlights the utility of applying evolutionary principles to microbial genomes to identify novel virulence genes.
doi:10.1128/JB.00718-13
PMCID: PMC3889600  PMID: 24097950
5.  Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii 
Journal of Bacteriology  2013;195(24):5577-5582.
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
doi:10.1128/JB.00853-13
PMCID: PMC3889614  PMID: 24123815
6.  Lipopolysaccharide-Deficient Acinetobacter baumannii Shows Altered Signaling through Host Toll-Like Receptors and Increased Susceptibility to the Host Antimicrobial Peptide LL-37 
Infection and Immunity  2013;81(3):684-689.
Infections caused by multidrug-resistant Acinetobacter baumannii have emerged as a serious global health problem. We have shown previously that A. baumannii can become resistant to the last-line antibiotic colistin via the loss of lipopolysaccharide (LPS), including the lipid A anchor, from the outer membrane (J. H. Moffatt, M. Harper, P. Harrison, J. D. Hale, E. Vinogradov, T. Seemann, R. Henry, B. Crane, F. St. Michael, A. D. Cox, B. Adler, R. L. Nation, J. Li, and J. D. Boyce, Antimicrob. Agents Chemother. 54:4971–4977, 2010). Here, we show how these LPS-deficient bacteria interact with components of the host innate immune system. LPS-deficient A. baumannii stimulated 2- to 4-fold lower levels of NF-κB activation and tumor necrosis factor alpha (TNF-α) secretion from immortalized murine macrophages, but it still elicited low levels of TNF-α secretion via a Toll-like receptor 2-dependent mechanism. Furthermore, we show that while LPS-deficient A. baumannii was not altered in its resistance to human serum, it showed increased susceptibility to the human antimicrobial peptide LL-37. Thus, LPS-deficient, colistin-resistant A. baumannii shows significantly altered activation of the host innate immune inflammatory response.
doi:10.1128/IAI.01362-12
PMCID: PMC3584870  PMID: 23250952
7.  The Fimbrial Protein FlfA from Gallibacterium anatis Is a Virulence Factor and Vaccine Candidate 
Infection and Immunity  2013;81(6):1964-1973.
The Gram-negative bacterium Gallibacterium anatis is a major cause of salpingitis and peritonitis in egg-laying chickens, leading to decreased egg production worldwide. Widespread multidrug resistance largely prevents treatment of this organism using traditional antimicrobial agents, while antigenic diversity hampers disease prevention by classical vaccines. Thus, insight into its pathogenesis and knowledge about important virulence factors is urgently required. A key event during the colonization and invasion of mucosal surfaces is adherence, and recently, at least three F17-like fimbrial gene clusters were identified in the genomes of several G. anatis strains. The objective of this study was to characterize the putative F17-like fimbrial subunit protein FlfA from G. anatis 12656-12 and determine its importance for virulence. In vitro expression and surface exposure of FlfA was demonstrated by flow cytometry and immunofluorescence microscopy. The predicted function of FlfA as a fimbrial subunit protein was confirmed by immunogold electron microscopy. An flfA deletion mutant (ΔflfA) was generated in G. anatis 12656-12, and importantly, this mutant was significantly attenuated in the natural chicken host. Furthermore, protection against G. anatis 12656-12 could be induced by immunizing chickens with recombinant FlfA. Finally, in vitro expression of FlfA homologs was observed in a genetically diverse set of G. anatis strains, suggesting the potential of FlfA as a serotype-independent vaccine candidate This is the first study describing a fimbrial subunit protein of G. anatis with a clear potential as a vaccine antigen.
doi:10.1128/IAI.00059-13
PMCID: PMC3676021  PMID: 23509151
8.  Beclin 1 Is Required for Starvation-Enhanced, but Not Rapamycin-Enhanced, LC3-Associated Phagocytosis of Burkholderia pseudomallei in RAW 264.7 Cells 
Infection and Immunity  2013;81(1):271-277.
LC3-associated phagocytosis (LAP) of Burkholderia pseudomallei by murine macrophage (RAW 264.7) cells is an intracellular innate defense mechanism. Beclin 1, a protein with several roles in autophagic processes, is known to be recruited to phagosomal membranes as a very early event in LAP. We sought to determine whether knockdown of Beclin 1 by small interfering RNA (siRNA) would affect recruitment of LC3 and subsequent LAP of infecting B. pseudomallei. Both starvation and rapamycin treatment can induce Beclin 1-dependent autophagy. Therefore, we analyzed the consequences of Beclin 1 knockdown for LAP in infected cells that had been either starved or treated with rapamycin by determining the levels of bacterial colocalization with LC3 and intracellular survival. Concurrently, we confirmed the location of bacteria as either contained in phagosomes or free in the cytoplasm. We found that both rapamycin and starvation treatment enhanced LAP of B. pseudomallei but that the rapamycin response is Beclin 1 independent whereas the starvation response is Beclin 1 dependent.
doi:10.1128/IAI.00834-12
PMCID: PMC3536138  PMID: 23115045
9.  Cell surface hydrophobicity of colistin-susceptible versus -resistant Acinetobacter baumannii determined by contact angles: methodological considerations and implications 
Journal of applied microbiology  2012;113(4):940-951.
AIMS
Contact angle analysis of cell surface hydrophobicity (CSH) describes the tendency of a water droplet to spread across a lawn of filtered bacterial cells. Colistin-induced disruption of the Gram-negative outer membrane necessitates hydrophobic contacts with lipopolysaccharide (LPS). We aimed to characterize the CSH of Acinetobacter baumannii using contact angles, to provide insight into the mechanism of colistin resistance.
METHODS AND RESULTS
Contact angles were analysed for five paired colistin-susceptible and -resistant A. baumannii strains. Drainage of the water droplet through bacterial layers was demonstrated to influence results. Consequently, measurements were performed 0.66-sec after droplet deposition. Colistin-resistant cells exhibited lower contact angles (38.8±2.8° to 46.8±1.3°) compared to their paired-susceptible strains (40.7±3.0° to 48.0±1.4°; ANOVA; p<0.05). Contact angles increased at stationary phase (50.3±2.9° to 61.5±2.5° and 47.4±2.0° to 50.8±3.2°, susceptible and resistant, respectively, ANOVA; p<0.05), and in response to colistin 32-mgL−1 exposure (44.5±1.5° to 50.6±2.8° and 43.5±2.2° to 48.0±2.2°, susceptible and resistant, respectively; ANOVA; p<0.05). Analysis of complemented strains constructed with an intact lpxA gene, or empty vector, highlighted the contribution of LPS to CSH.
CONCLUSIONS
Compositional outer-membrane variations likely account for CSH differences between A. baumannii phenotypes, which influence the hydrophobic colistin-bacterium interaction.
SIGNIFICANCE AND IMPACT OF STUDY
Important insight into the mechanism of colistin resistance has been provided. Greater consideration of contact angle mehodology is nescessary to ensure accurate analyses are performed.
doi:10.1111/j.1365-2672.2012.05337.x
PMCID: PMC3434258  PMID: 22574702
Antimicrobials; Lipopolysaccharide; Mechanism of Action
10.  Colistin-Resistant, Lipopolysaccharide-Deficient Acinetobacter baumannii Responds to Lipopolysaccharide Loss through Increased Expression of Genes Involved in the Synthesis and Transport of Lipoproteins, Phospholipids, and Poly-β-1,6-N-Acetylglucosamine 
We recently demonstrated that colistin resistance in Acinetobacter baumannii can result from mutational inactivation of genes essential for lipid A biosynthesis (Moffatt JH, et al., Antimicrob. Agents Chemother. 54:4971–4977). Consequently, strains harboring these mutations are unable to produce the major Gram-negative bacterial surface component, lipopolysaccharide (LPS). To understand how A. baumannii compensates for the lack of LPS, we compared the transcriptional profile of the A. baumannii type strain ATCC 19606 to that of an isogenic, LPS-deficient, lpxA mutant strain. The analysis of the expression profiles indicated that the LPS-deficient strain showed increased expression of many genes involved in cell envelope and membrane biogenesis. In particular, upregulated genes included those involved in the Lol lipoprotein transport system and the Mla-retrograde phospholipid transport system. In addition, genes involved in the synthesis and transport of poly-β-1,6-N-acetylglucosamine (PNAG) also were upregulated, and a corresponding increase in PNAG production was observed. The LPS-deficient strain also exhibited the reduced expression of genes predicted to encode the fimbrial subunit FimA and a type VI secretion system (T6SS). The reduced expression of genes involved in T6SS correlated with the detection of the T6SS-effector protein AssC in culture supernatants of the A. baumannii wild-type strain but not in the LPS-deficient strain. Taken together, these data show that, in response to total LPS loss, A. baumannii alters the expression of critical transport and biosynthesis systems associated with modulating the composition and structure of the bacterial surface.
doi:10.1128/AAC.05191-11
PMCID: PMC3256090  PMID: 22024825
11.  Natural Transformation of Gallibacterium anatis 
Applied and Environmental Microbiology  2012;78(14):4914-4922.
Gallibacterium anatis is a pathogen of poultry. Very little is known about its genetics and pathogenesis. To enable the study of gene function in G. anatis, we have established methods for transformation and targeted mutagenesis. The genus Gallibacterium belongs to the Pasteurellaceae, a group with several naturally transformable members, including Haemophilus influenzae. Bioinformatics analysis identified G. anatis homologs of the H. influenzae competence genes, and natural competence was induced in G. anatis by the procedure established for H. influenzae: transfer from rich medium to the starvation medium M-IV. This procedure gave reproducibly high transformation frequencies with G. anatis chromosomal DNA and with linearized plasmid DNA carrying G. anatis sequences. Both DNA types integrated into the G. anatis chromosome by homologous recombination. Targeted mutagenesis gave transformation frequencies of >2 × 10−4 transformants CFU−1. Transformation was also efficient with circular plasmid containing no G. anatis DNA; this resulted in the establishment of a self-replicating plasmid. Nine diverse G. anatis strains were found to be naturally transformable by this procedure, suggesting that natural competence is common and the M-IV transformation procedure widely applicable for this species. The G. anatis genome is only slightly enriched for the uptake signal sequences identified in other pasteurellaceaen genomes, but G. anatis did preferentially take up its own DNA over that of Escherichia coli. Transformation by electroporation was not effective for chromosomal integration but could be used to introduce self-replicating plasmids. The findings described here provide important tools for the genetic manipulation of G. anatis.
doi:10.1128/AEM.00412-12
PMCID: PMC3416388  PMID: 22582057
12.  Effect of colistin exposure and growth phase on the surface properties of live Acinetobacter baumannii cells examined by atomic force microscopy 
The diminishing antimicrobial development pipeline has forced the revival of colistin as a last line of defence against infections caused by multidrug-resistant Gram-negative ‘superbugs’ such as Acinetobacter baumannii. The complete loss of lipopolysaccharide (LPS) mediates colistin resistance in some A. baumannii strains. Atomic force microscopy was used to examine the surface properties of colistin-susceptible and -resistant A. baumannii strains at mid-logarithmic and stationary growth phases in liquid and in response to colistin treatment. The contribution of LPS to surface properties was investigated using A. baumannii strains constructed with and without the lpxA gene. Bacterial spring constant measurements revealed that colistin-susceptible cells were significantly stiffer than colistin-resistant cells at both growth phases (P < 0.01), whilst colistin treatment at high concentrations (32 mg/L) resulted in more rigid surfaces for both phenotypes. Multiple, large adhesive peaks frequently noted in force curves captured on colistin-susceptible cells were not evident for colistin-resistant cells. Adhesion events were markedly reduced following colistin exposure. The cell membranes of strains of both phenotypes remained intact following colistin treatment, although fine topographical details were illustrated. These studies, conducted for the first time on live A. baumannii cells in liquid, have contributed to our understanding of the action of colistin in this problematic pathogen.
doi:10.1016/j.ijantimicag.2011.07.014
PMCID: PMC3433558  PMID: 21925844
Atomic force microscopy; Colistin; Acinetobacter baumannii; Morphology; Surface properties
13.  Screening of 71 P. multocida Proteins for Protective Efficacy in a Fowl Cholera Infection Model and Characterization of the Protective Antigen PlpE 
PLoS ONE  2012;7(7):e39973.
Background
There is a strong need for a recombinant subunit vaccine against fowl cholera. We used a reverse vaccinology approach to identify putative secreted or cell surface associated P. multocida proteins that may represent potential vaccine candidate antigens.
Principal Findings
A high-throughput cloning and expression protocol was used to express and purify 71 recombinant proteins for vaccine trials. Of the 71 proteins tested, only one, PlpE in denatured insoluble form, protected chickens against fowl cholera challenge. PlpE also elicited comparable levels of protection in mice. PlpE was localized by immunofluorescence to the bacterial cell surface, consistent with its ability to elicit a protective immune response. To explore the role of PlpE during infection and immunity, a plpE mutant was generated. The plpE mutant strain retained full virulence for mice.
Conclusion
These studies show that PlpE is a surface exposed protein and was the only protein of 71 tested that was able to elicit a protective immune response. However, PlpE is not an essential virulence factor. This is the first report of a denatured recombinant protein stimulating protection against fowl cholera.
doi:10.1371/journal.pone.0039973
PMCID: PMC3390355  PMID: 22792202
14.  Role for the Burkholderia pseudomallei Type Three Secretion System Cluster 1 bpscN Gene in Virulence ▿  
Infection and Immunity  2011;79(9):3659-3664.
Burkholderia pseudomallei, the causal agent of melioidosis, employs a number of virulence factors during its infection of mammalian cells. One such factor is the type three secretion system (TTSS), which is proposed to mediate the transport and secretion of bacterial effector molecules directly into host cells. The B. pseudomallei genome contains three TTSS gene clusters (designated TTSS1, TTSS2, and TTSS3). Previous research has indicated that neither TTSS1 nor TTSS2 is involved in B. pseudomallei virulence in a hamster infection model. We have characterized a B. pseudomallei mutant lacking expression of the predicted TTSS1 ATPase encoded by bpscN. This mutant was significantly attenuated for virulence in a respiratory melioidosis mouse model of infection. In addition, analyses in vitro showed diminished survival and replication in RAW264.7 cells and an increased level of colocalization with the autophagy marker protein LC3 but an unhindered ability to escape from phagosomes. Taken together, these data provide evidence that the TTSS1 bpscN gene product plays an important role in the intracellular survival of B. pseudomallei and the pathogenesis of murine infection.
doi:10.1128/IAI.01351-10
PMCID: PMC3165474  PMID: 21768285
15.  Different surface charge of colistin-susceptible and -resistant Acinetobacter baumannii cells measured with zeta potential as a function of growth phase and colistin treatment 
Objectives
Electrostatic forces mediate the initial interaction between cationic colistin and Gram-negative bacterial cells. Lipopolysaccharide (LPS) loss mediates colistin resistance in some A. baumannii strains. Our aim was to determine the surface charge of colistin-susceptible and –resistant A. baumannii as a function of growth phase and in response to polymyxin treatment.
Methods
The zeta potential of A. baumannii ATCC 19606 and 10 clinical multidrug-resistant strains (MICs 0.5–2 mg/L) was assessed. Colistin-resistant derivatives (MIC >128 mg/L) of wild-type strains were selected in the presence of 10 mg/L colistin, including the LPS-deficient lpxA mutant, ATCC 19606R. To determine the contribution of LPS to surface charge, two complemented ATCC 19606R derivatives were examined, namely ATCC 19606R + lpxA (containing an intact lpxA gene) and ATCC 19606R + V (containing empty vector). Investigations were conducted as a function of growth phase and polymyxin treatment (1, 4 and 8 mg/L).
Results
Wild-type cells exhibited a greater negative charge (−60.5 ± 2.36 to −26.2 ± 2.56 mV) thancolistin-resistant cells (−49.2 ± 3.09 to −19.1 ± 2.80 mV) at mid-log phase (ANOVA, P < 0.05). Opposing growth-phase trends were observed for both phenotypes: wild-type cells displayed reduced negative charge and colistin-resistant cells displayed increased negative charge at stationary compared with mid-logarithmic phase. Polymyxin exposure resulted in a concentration-dependent increase in zeta potential. Examination of ATCC 19606R and complemented strains supported the importance of LPS in determining surface charge, suggesting a potential mechanism of colistin resistance.
Conclusions
Zeta potential differences between A. baumannii phenotypes probably reflect compositional outer-membrane variations that impact the electrostatic component of colistin activity.
doi:10.1093/jac/dkq422
PMCID: PMC3001852  PMID: 21081544
physicochemical properties; Gram-negative; polymyxin
16.  Insertion Sequence ISAba11 Is Involved in Colistin Resistance and Loss of Lipopolysaccharide in Acinetobacter baumannii▿ 
Infections caused by Acinetobacter baumannii are of increasing concern, largely due to the multidrug resistance of many strains. Here we show that insertion sequence ISAba11 movement can result in inactivation of the A. baumannii lipid A biosynthesis genes lpxA and lpxC, resulting in the complete loss of lipopolysaccharide production and high-level colistin resistance.
doi:10.1128/AAC.01732-10
PMCID: PMC3101452  PMID: 21402838
17.  Necrotic Enteritis-Derived Clostridium perfringens Strain with Three Closely Related Independently Conjugative Toxin and Antibiotic Resistance Plasmids 
mBio  2011;2(5):e00190-11.
ABSTRACT
The pathogenesis of avian necrotic enteritis involves NetB, a pore-forming toxin produced by virulent avian isolates of Clostridium perfringens type A. To determine the location and mobility of the netB structural gene, we examined a derivative of the tetracycline-resistant necrotic enteritis strain EHE-NE18, in which netB was insertionally inactivated by the chloramphenicol and thiamphenicol resistance gene catP. Both tetracycline and thiamphenicol resistance could be transferred either together or separately to a recipient strain in plate matings. The separate transconjugants could act as donors in subsequent matings, which demonstrated that the tetracycline resistance determinant and the netB gene were present on different conjugative elements. Large plasmids were isolated from the transconjugants and analyzed by high-throughput sequencing. Analysis of the resultant data indicated that there were actually three large conjugative plasmids present in the original strain, each with its own toxin or antibiotic resistance locus. Each plasmid contained a highly conserved 40-kb region that included plasmid replication and transfer regions that were closely related to the 47-kb conjugative tetracycline resistance plasmid pCW3 from C. perfringens. The plasmids were as follows: (i) a conjugative 49-kb tetracycline resistance plasmid that was very similar to pCW3, (ii) a conjugative 82-kb plasmid that contained the netB gene and other potential virulence genes, and (iii) a 70-kb plasmid that carried the cpb2 gene, which encodes a different pore-forming toxin, beta2 toxin.
IMPORTANCE
The anaerobic bacterium Clostridium perfringens can cause an avian gastrointestinal disease known as necrotic enteritis. Disease pathogenesis is not well understood, although the plasmid-encoded pore-forming toxin NetB, is an important virulence factor. In this work, we have shown that the plasmid that carries the netB gene is conjugative and has a 40-kb region that is very similar to replication and transfer regions found within each of the sequenced conjugative plasmids from C. perfringens. We also showed that this strain contained two additional large plasmids that were also conjugative and carried a similar 40-kb region. One of these plasmids encoded beta2 toxin, and the other encoded tetracycline resistance. To our knowledge, this is the first report of a bacterial strain that carries three closely related but different independently conjugative plasmids. These results have significant implications for our understanding of the transmission of virulence and antibiotic resistance genes in pathogenic bacteria.
doi:10.1128/mBio.00190-11
PMCID: PMC3181468  PMID: 21954306
18.  Strategies for Intracellular Survival of Burkholderia pseudomallei 
Burkholderia pseudomallei is the causative agent of melioidosis, a disease with high mortality that is prevalent in tropical regions of the world. A key component of the pathogenesis of melioidosis is the ability of B. pseudomallei to enter, survive, and replicate within mammalian host cells. For non-phagocytic cells, bacterial adhesins have been identified both on the bacterial surface and associated with Type 4 pili. Cell invasion involves components of one or more of the three Type 3 Secretion System clusters, which also mediate, at least in part, the escape of bacteria from the endosome into the cytoplasm, where bacteria move by actin-based motility. The mechanism of actin-based motility is not clearly understood, but appears to differ from characterized mechanisms in other bacterial species. A small proportion of intracellular bacteria is targeted by host cell autophagy, involving direct recruitment of LC3 to endosomes rather than through uptake by canonical autophagosomes. However, the majority of bacterial cells are able to circumvent autophagy and other intracellular defense mechanisms such as the induction of inducible nitric oxide synthase, and then replicate in the cytoplasm and spread to adjacent cells via membrane fusion, resulting in the formation of multi-nucleated giant cells. A potential role for host cell ubiquitin in the autophagic response to bacterial infection has recently been proposed.
doi:10.3389/fmicb.2011.00170
PMCID: PMC3159172  PMID: 22007185
melioidosis; Burkholderia; pathogenesis; adhesion; intracellular survival; autophagy; ubiquitination
19.  The Burkholderia pseudomallei Type III Secretion System and BopA Are Required for Evasion of LC3-Associated Phagocytosis 
PLoS ONE  2011;6(3):e17852.
Burkholderia pseudomallei is the causative agent of melioidosis, a fatal infectious disease endemic in tropical regions worldwide, and especially prevalent in southeast Asia and northern Australia. This intracellular pathogen can escape from phagosomes into the host cytoplasm, where it replicates and infects adjacent cells. We previously demonstrated that, in response to B. pseudomallei infection of macrophage cell line RAW 264.7, a subset of bacteria co-localized with the autophagy marker protein, microtubule-associated protein light chain 3 (LC3), implicating autophagy in host cell defence against infection. Recent reports have suggested that LC3 can be recruited to both phagosomes and autophagosomes, thereby raising questions regarding the identity of the LC3-positive compartments in which invading bacteria reside and the mechanism of the autophagic response to B. pseudomallei infection. Electron microscopy analysis of infected cells demonstrated that the invading bacteria were either free in the cytosol, or sequestered in single-membrane phagosomes rather than double-membrane autophagosomes, suggesting that LC3 is recruited to B. pseudomallei-containing phagosomes. Partial or complete loss of function of type III secretion system cluster 3 (TTSS3) in mutants lacking the BopA (effector) or BipD (translocator) proteins respectively, resulted in delayed or no escape from phagosomes. Consistent with these observations, bopA and bipD mutants both showed a higher level of co-localization with LC3 and the lysosomal marker LAMP1, and impaired survival in RAW264.7 cells, suggesting enhanced killing in phagolysosomes. We conclude that LC3 recruitment to phagosomes stimulates killing of B. pseudomallei trapped in phagosomes. Furthermore, BopA plays an important role in efficient escape of B. pseudomallei from phagosomes.
doi:10.1371/journal.pone.0017852
PMCID: PMC3055895  PMID: 21412437
20.  Natural Selection in the Chicken Host Identifies 3-Deoxy-d-manno- Octulosonic Acid Kinase Residues Essential for Phosphorylation of Pasteurella multocida Lipopolysaccharide▿  
Infection and Immunity  2010;78(9):3669-3677.
Pasteurella multocida is the causative agent of a number of diseases in animals, including fowl cholera. P. multocida strains simultaneously express two lipopolysaccharide (LPS) glycoforms (glycoforms A and B) that differ only in their inner core structure. Glycoform A contains a single 3-deoxy-d-manno-octulosonic acid (Kdo) residue that is phosphorylated by the Kdo kinase, KdkA, whereas glycoform B contains two unphosphorylated Kdo residues. We have previously shown that P. multocida mutants lacking the heptosyltransferase, HptA, produce full-length glycoform B LPS and a large amount of truncated glycoform A LPS, as they cannot add heptose to the glycoform A inner core. These hptA mutants were attenuated in chickens because the truncated LPS made them vulnerable to host defense mechanisms, including antimicrobial peptides. However, here we show that birds inoculated with high doses of the hptA mutant developed fowl cholera and the P. multocida isolates recovered from diseased birds no longer expressed truncated LPS. Sequencing analysis revealed that the in vivo-derived isolates had mutations in kdkA, thereby suppressing the production of glycoform A LPS. Interestingly, a number of the spontaneous KdkA mutant strains produced KdkA with a single amino acid substitution (A112V, R123P, H168Y, or D193N). LPS structural analysis showed that complementation of a P. multocida kdkA mutant with wild-type kdkA restored expression of glycoform A to wild-type levels, whereas complementation with any of the mutated kdkA genes did not. We conclude that in P. multocida KdkA, the amino acids A112, R123, H168, and D193 are critical for Kdo kinase function and therefore for glycoform A LPS assembly.
doi:10.1128/IAI.00457-10
PMCID: PMC2937434  PMID: 20566690
21.  Structural and Genetic Basis for the Serological Differentiation of Pasteurella multocida Heddleston Serotypes 2 and 5 ▿  
Journal of Bacteriology  2009;191(22):6950-6959.
Pasteurella multocida is classified into 16 serotypes according to the Heddleston typing scheme. As part of a comprehensive study to define the structural and genetic basis of this scheme, we have determined the structure of the lipopolysaccharide (LPS) produced by P. multocida strains M1404 (B:2) and P1702 (E:5), the type strains for serotypes 2 and 5, respectively. The only difference between the LPS structures made by these two strains was the absence of a phosphoethanolamine (PEtn) moiety at the 3 position of the second heptose (Hep II) in M1404. Analysis of the lpt-3 gene, required for the addition of this PEtn residue, revealed that the gene was intact in P1702 but contained a nonsense mutation in M1404. Expression of an intact copy of lpt-3 in M1404 resulted in the attachment of a PEtn residue to the 3 position of the Hep II residue, generating an LPS structure identical to that produced by P1702. We identified and characterized each of the glycosyltransferase genes required for assembly of the serotype 2 and 5 LPS outer core. Monoclonal antibodies raised against serotype 2 LPS recognized the serotype 2/5-specific outer core LPS structure, but recognition of this structure was inhibited by the PEtn residue on Hep II. These data indicate that the serological classification of strains into Heddleston serotypes 2 and 5 is dependent on the presence or absence of PEtn on Hep II.
doi:10.1128/JB.00787-09
PMCID: PMC2772478  PMID: 19767423
22.  Fis Is Essential for Capsule Production in Pasteurella multocida and Regulates Expression of Other Important Virulence Factors 
PLoS Pathogens  2010;6(2):e1000750.
P. multocida is the causative agent of a wide range of diseases of animals, including fowl cholera in poultry and wild birds. Fowl cholera isolates of P. multocida generally express a capsular polysaccharide composed of hyaluronic acid. There have been reports of spontaneous capsule loss in P. multocida, but the mechanism by which this occurs has not been determined. In this study, we identified three independent strains that had spontaneously lost the ability to produce capsular polysaccharide. Quantitative RT-PCR showed that these strains had significantly reduced transcription of the capsule biosynthetic genes, but DNA sequence analysis identified no mutations within the capsule biosynthetic locus. However, whole-genome sequencing of paired capsulated and acapsular strains identified a single point mutation within the fis gene in the acapsular strain. Sequencing of fis from two independently derived spontaneous acapsular strains showed that each contained a mutation within fis. Complementation of these strains with an intact copy of fis, predicted to encode a transcriptional regulator, returned capsule expression to all strains. Therefore, expression of a functional Fis protein is essential for capsule expression in P. multocida. DNA microarray analysis of one of the spontaneous fis mutants identified approximately 30 genes as down-regulated in the mutant, including pfhB_2, which encodes a filamentous hemagglutinin, a known P. multocida virulence factor, and plpE, which encodes the cross protective surface antigen PlpE. Therefore these experiments define for the first time a mechanism for spontaneous capsule loss in P. multocida and identify Fis as a critical regulator of capsule expression. Furthermore, Fis is involved in the regulation of a range of other P. multocida genes including important virulence factors.
Author Summary
Pasteurella multocida is an animal pathogen of worldwide economic significance. It causes fowl cholera in wild birds and poultry, hemorrhagic septicemia in ungulates, and atrophic rhinitis in swine. The major virulence factor in fowl cholera-causing isolates is the polysaccharide capsule, which is composed of hyaluronic acid. Although there have been reports of spontaneous capsule loss in some strains, to date there has been no systematic investigation into the molecular mechanisms of this phenomenon. In this study, we describe for the first time the underlying transcriptional mechanisms required for the expression of capsule in P. multocida, and identify a transcriptional regulator required for capsule production.
doi:10.1371/journal.ppat.1000750
PMCID: PMC2816674  PMID: 20140235
23.  Identification of Novel Glycosyltransferases Required for Assembly of the Pasteurella multocida A:1 Lipopolysaccharide and Their Involvement in Virulence▿ †  
Infection and Immunity  2009;77(4):1532-1542.
We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive.
doi:10.1128/IAI.01144-08
PMCID: PMC2663145  PMID: 19168738
24.  Comparative transcriptomic analysis of Porphyromonas gingivalis biofilm and planktonic cells 
BMC Microbiology  2009;9:18.
Background
Porphyromonas gingivalis in subgingival dental plaque, as part of a mature biofilm, has been strongly implicated in the onset and progression of chronic periodontitis. In this study using DNA microarray we compared the global gene expression of a P. gingivalis biofilm with that of its planktonic counterpart grown in the same continuous culture.
Results
Approximately 18% (377 genes, at 1.5 fold or more, P-value < 0.01) of the P. gingivalis genome was differentially expressed when the bacterium was grown as a biofilm. Genes that were down-regulated in biofilm cells, relative to planktonic cells, included those involved in cell envelope biogenesis, DNA replication, energy production and biosynthesis of cofactors, prosthetic groups and carriers. A number of genes encoding transport and binding proteins were up-regulated in P. gingivalis biofilm cells. Several genes predicted to encode proteins involved in signal transduction and transcriptional regulation were differentially regulated and may be important in the regulation of biofilm growth.
Conclusion
This study analyzing global gene expression provides insight into the adaptive response of P. gingivalis to biofilm growth, in particular showing a down regulation of genes involved in growth and metabolic activity.
doi:10.1186/1471-2180-9-18
PMCID: PMC2637884  PMID: 19175941
25.  NetB, a New Toxin That Is Associated with Avian Necrotic Enteritis Caused by Clostridium perfringens 
PLoS Pathogens  2008;4(2):e26.
For over 30 years a phospholipase C enzyme called alpha-toxin was thought to be the key virulence factor in necrotic enteritis caused by Clostridium perfringens. However, using a gene knockout mutant we have recently shown that alpha-toxin is not essential for pathogenesis. We have now discovered a key virulence determinant. A novel toxin (NetB) was identified in a C. perfringens strain isolated from a chicken suffering from necrotic enteritis (NE). The toxin displayed limited amino acid sequence similarity to several pore forming toxins including beta-toxin from C. perfringens (38% identity) and alpha-toxin from Staphylococcus aureus (31% identity). NetB was only identified in C. perfringens type A strains isolated from chickens suffering NE. Both purified native NetB and recombinant NetB displayed cytotoxic activity against the chicken leghorn male hepatoma cell line LMH; inducing cell rounding and lysis. To determine the role of NetB in NE a netB mutant of a virulent C. perfringens chicken isolate was constructed by homologous recombination, and its virulence assessed in a chicken disease model. The netB mutant was unable to cause disease whereas the wild-type parent strain and the netB mutant complemented with a wild-type netB gene caused significant levels of NE. These data show unequivocally that in this isolate a functional NetB toxin is critical for the ability of C. perfringens to cause NE in chickens. This novel toxin is the first definitive virulence factor to be identified in avian C. perfringens strains capable of causing NE. Furthermore, the netB mutant is the first rationally attenuated strain obtained in an NE-causing isolate of C. perfringens; as such it has considerable vaccine potential.
Author Summary
Clostridium perfringens can cause gas gangrene and food poisoning in humans and causes several enterotoxemic diseases in animals including avian necrotic enteritis. This disease affects all chicken producing countries worldwide and is a considerable burden on the commercial chicken production industry. Until recently alpha-toxin was thought to be the major virulence factor involved in necrotic enteritis. However, by using an alpha-toxin null mutant it has been demonstrated that this toxin is not essential for disease. This paper details the identification and characterisation of a novel toxin, NetB, and provides evidence that the protein is an essential factor in causing necrotic enteritis in chickens. NetB has limited protein sequence identity to the beta-toxin of C. perfringens, which causes mucosal necrosis of the small intestine in humans and animals. We demonstrate that NetB null mutants can no longer cause disease in chickens, whereas both the wild-type and mutant complemented with a wild-type netB gene caused significant levels of necrotic enteritis. The identification of this important toxin advances our understanding of the pathogenesis of the disease and opens significant opportunities for the development of novel vaccines against necrotic enteritis in poultry.
doi:10.1371/journal.ppat.0040026
PMCID: PMC2233674  PMID: 18266469

Results 1-25 (39)