PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (102)
 

Clipboard (0)
None

Select a Filter Below

Journals
Year of Publication
Document Types
1.  Theoretical Investigation of Halogen-Oxygen Bonding and Its Implications in Halogen Chemistry and Reactivity 
Trends in the properties of normal valent and multivalent halogen-oxygen bonding are examined for the isomers of the halogen polyoxide families of the types (YXO2) and (YXO3), Y = Cl, Br, I, H, CH3, X = Cl, Br, I. A qualitative model is formulated on the relationship between the X−O bond distance variations, the ionic character of the bonding, and the degree of halogen valence. The relative stability and enthalpy of formation of each species are also suggested to correlate with the ionic nature of the X−O bonding and the electrostatic character of the Y, YO fragments. In the model presented, halogen hypervalence is interpreted to be the result of partial p → d promotion of lone-pair valence electrons followed by the formation of two, four, or six additional pd hybrid bonds around the halogen atom.
doi:10.1155/2007/46393
PMCID: PMC1939913  PMID: 17713592
2.  New Perspectives on Thiamine Catalysis: From Enzymic to Biomimetic Catalysis 
This paper is a brief review of the detailed mechanism of action of thiamine enzymes, based on metal complexes of bivalent transition and post-transition metals of model compounds, thiamine derivatives, synthesized and characterized with spectroscopic techniques and X-ray crystal structure determinations. It is proposed that the enzymatic reaction is initiated with a V conformation of thiamine pyrophosphate, imposed by the enzymic environment. Thiamine pyrophosphate is linked with the proteinic substrate through its pyrophosphate oxygens. In the course of the reaction, the formation of the “active aldehyde” intermediate imposes the S conformation to thiamine, while a bivalent metal ion may be linked through the N1' site of the molecule, at this stage. Finally, the immobilization of thiamine and derivatives on silica has a dramatic effect on the decarboxylation of pyruvic acid, reducing the time of its conversion to acetaldehyde from 330 minutes for the homogeneous system to less than 5 minutes in the heterogenous system.
doi:10.1155/2007/23286
PMCID: PMC1939911  PMID: 17710108
3.  Regioselective Synthesis of Bis(2-halo-3-pyridyl) Dichalcogenides (E = S, Se and Te): Directed Ortho-Lithiation of 2-halopyridines 
A novel method for the preparation of hitherto unknown symmetrical bis(2-halo-3-pyridyl) dichalcogenides (E = S, Se and Te) by the oxidation of intermediate 2-halo-3-pyridyl chalcogenolate, prepared by lithiation of 2-halo pyridines using lithium diisopropylamine is being reported. All the newly synthesized compounds have been characterized through elemental analysis employing various spectroscopic techniques, namely, NMR (1H, 13C, 77Se), infrared, mass spectrometry, and X-ray crystal structures in representative cases.
doi:10.1155/2007/69263
PMCID: PMC1885866  PMID: 17611613
4.  Lower-Rim Substituted Calixarenes and Their Applications 
This review discusses in detail “calixarenes” since their discovery as by-products of the phenol formaldehyde bakelites till the present scenario wherein calixarene has assumed a new dimension in the field of supramolecular chemistry. Extensive literature exists for calixarenes; but herein we have tried to concentrate on the different lower-rim modified calixarenes with their potential applications. An attempt has also been made to critically evaluate the synthesis procedures for different lower-rim substituted calixarenes.
doi:10.1155/2007/65815
PMCID: PMC1885865  PMID: 17611612
5.  Chemical Analysis through CL-Detection Assisted by Periodate Oxidation 
The progress of the research work of the author and his colleagues on the field of CL-emission generated by pyrogallol oxidation and further application for the direct determination of periodate and indirect or direct determination of other compounds through flow-injection manifold/CL-detection set up is described. The instrumentation used for these studies was a simple flow-injection manifold that provides good reproducibility, coupled to a red sensitive photomultiplier that gives sensitive CL-detection. In addition, recent reports on studies and analytical methods based on CL-emission generated by periodate oxidation by other authors are included.
doi:10.1155/2007/92595
PMCID: PMC1878546  PMID: 17611611
6.  Platinum(II) and Palladium(II) Complexes of Pyridine-2-Carbaldehyde Thiosemicarbazone as Alternative Antiherpes Simplex Virus Agents 
The cytotoxicity and the antivirus activity of Pd(II) and Pt(II) complexes with pyridine-2-carbaldehyde thiosemicarbazone (HFoTsc) against HSV replication were evaluated on four HSV strains—two wt strains Victoria (HSV-1) and BJA (HSV-2) and two ACVR mutants with different tk gene mutations R-100 (TKA, HSV-1) and PU (TKN, HSV-2). The experiments were performed on continuous MDBK cells and four HSV 1 and HSV 2 strains were used, two sensitive to acyclovir and two resistant mutants. The five complexes of HFoTsc, [Pt(FoTsc)Cl], [Pt(FoTsc)(H2FoTsc)]Cl2, [Pt(FoTsc)2], [Pd(FoTsc)(H2FoTsc)]Cl2, and [Pd(FoTsc)2], were found to be effective inhibitors of HSV replication. The most promising, active, and selective anti-HSV agent was found to be complex [Pt(FoTsc)(H2FoTsc)]Cl2. This complex could be useful in the treatment of HSV infections, since it is resistant to ACV mutants. PCR study of immediate early 300 bp ReIV Us1 region reveals that the complex [Pt(FoTsc)(H2FoTsc)]Cl2 specifically suppressed wt HSV-1 genome 2 hours after the infection, not inducing apoptosis/necrosis on the 8 hours after virus infection. The target was found to be most probably the viral, instead of the host cell DNA.
doi:10.1155/2007/56165
PMCID: PMC1876625  PMID: 17541481
7.  Co(III) and Ni(II) Complexes Containing Bioactive Ligands: Synthesis, DNA Binding, and Photocleavage Studies 
DNA binding and photocleavage characteristics of a series of mixed ligand complexes of the type [M(bpy)2qbdp](PF6)n·xH2O (where M = Co(III) or Ni(II), bpy = 2.2′-bipryidine, qbdp = Quinolino[3,2-b]benzodiazepine, n = 3 or 2 and x = 5 or 2) have been investigated. The DNA binding property of the complexes with calf thymus DNA has been investigated by using absorption spectra, viscosity measurements, as well as thermal denaturation studies. Intrinsic binding constant (Kb) has been estimated under similar set of experimental conditions. Absorption spectral studies indicate that the Co(III) and Ni(II) complexes intercalate between the base pairs of the CT-DNA tightly with intrinsic DNA binding constant of 1.3 × 106 and 3.1 × 105 M−1 in Tris-HCl buffer containing 50 mM NaCl, respectively. The proposed DNA binding mode supports the large enhancement in the relative viscosity of DNA on binding to quinolo[3,2-b]benzodiazepine. The oxidative as well as photo-induced cleavage reactions were monitered by gel electrophoresis for both complexes. The photocleavage experiments showed that the cobalt(III) complex can cleave pUC19 DNA effectively in the absence of external additives as an effective inorganic nuclease.
doi:10.1155/2007/36497
PMCID: PMC1876624  PMID: 17541480
8.  Spectroscopic, Thermal and Biological Studies on Some Trivalent Ruthenium and Rhodium NS Chelating Thiosemicarbazone Complexes 
The synthetic, spectroscopic, and biological studies of sixteen ring-substituted 4-phenylthiosemicarbazones and 4-nitrophenyl-thiosemicarbazones of anisaldehyde, 4-chlorobenzaldehyde, 4-fluorobenzaldehyde, and vanillin with ruthenium(III) and rhodium(III) chlorides are reported here. Their structures were determined on the basis of the elemental analyses, spectroscopic data (IR, electronic, 1H and 13C NMR) along with magnetic susceptibility measurements, molar conductivity and thermogravimetric analyses. Electrical conductance measurement revealed a 1 : 3 electrolytic nature of the complexes. The resulting colored products are monomeric in nature. On the basis of the above studies, three ligands were suggested to be coordinated to each metal atom by thione sulphur and azomethine nitrogen to form low-spin octahedral complexes with ruthenium(III) while forming diamagnetic complexes with rhodium(III). Both ligands and their complexes have been screened for their bactericidal activities and the results indicate that they exhibit a significant activity.
doi:10.1155/2007/68374
PMCID: PMC1852900  PMID: 17505530
9.  Synthesis and Properties of N-Bromosuccinimide Derivatives of Ammonium Dialkyl/Alkylene Dithiophosphates 
Reaction of N-bromosuccinimide with ammonium salt of alkylene (dialkyl) dithiophosphates, [OGOPS2NH4; G=−CMe2CMe2−CH2CMe2CH2−, CMe2CH2CHMe2−, CH2CH2CHMe2−; (RO)2PS2NH4; R=C2H5, n−C3H7, i−C3H7], in 1 : 1 molor ratio in refluxing benzene solution yields red/brown-colored sticky liquids. These newly synthesized complexes have been characterised by physicochemical and spectroscopic techniques (MW, IR, NMR [1H and 31P]). The computational semiempirical calculations (MOPAC6P/c) have also been studied for these complexes. On the basis of the above studies, the formation of P−S−N chemical linkage has been established.
doi:10.1155/2007/24742
PMCID: PMC1852899  PMID: 17492049
10.  Metal-Based Antibacterial and Antifungal Agents: Synthesis, Characterization, and In Vitro Biological Evaluation of Co(II), Cu(II), Ni(II), and Zn(II) Complexes With Amino Acid-Derived Compounds 
A series of antibacterial and antifungal amino acid-derived compounds and their cobalt(II), copper(II), nickel(II), and zinc(II) metal complexes have been synthesized and characterized by their elemental analyses, molar conductances, magnetic moments, and IR, and electronic spectral measurements. Ligands (L1)−(L5) were derived by condensation of β-diketones with glycine, phenylalanine, valine, and histidine and act as bidentate towards metal ions (cobalt, copper, nickel, and zinc) via the azomethine-N and deprotonated-O of the respective amino acid. The stoichiometric reaction between the metal(II) ion and synthesized ligands in molar ratio of M : L (1 : 1) resulted in the formation of the metal complexes of type [M(L)(H2O)4]Cl (where M = Co(II), Cu(II), and Zn(II)) and of M : L (1 : 2) of type [M(L)2(H2O)2] (where M = Co(II), Cu(II), Ni(II), and Zn(II)). The magnetic moment data suggested for the complexes to have an octahedral geometry around the central metal atom. The electronic spectral data also supported the same octahedral geometry of the complexes. Elemental analyses and NMR spectral data of the ligands and their metal(II) complexes agree with their proposed structures. The synthesized ligands, along with their metal(II) complexes, were screened for their in vitro antibacterial activity against four Gram-negative (Escherichia coli, Shigella flexeneri, Pseudomonas aeruginosa, and Salmonella typhi) and two Gram-positive (Bacillus subtilis and Staphylococcus aureus) bacterial strains and for in vitro antifungal activity against Trichophyton longifusus, Candida albicans, Aspergillus flavus, Microsporum canis, Fusarium solani, and Candida glaberata. The results of these studies show the metal(II) complexes to be more antibacterial/antifungal against one or more species as compared to the uncomplexed ligands. The brine shrimp bioassay was also carried out to study their in vitro cytotoxic properties. Five compounds, (3), (7), (10), (11), and (22), displayed potent cytotoxic activity as LD50 = 8.974 × 10−4, 7.022 × 10−4, 8.839 × 10−4, 7.133 × 10−4, and 9.725 × 10−4 M/mL, respectively, against Artemia salina.
doi:10.1155/BCA/2006/83131
PMCID: PMC1800917  PMID: 17497020
11.  Proposal for Sets of 77Se NMR Chemical Shifts in Planar and Perpendicular Orientations of Aryl Group and the Applications 
The orientational effect of p-YC6H4 (Ar) on δ(Se) is elucidated for ArSeR, based on experimental and theoretical investigations. Sets of δ(Se) are proposed for pl and pd employing 9-(arylselanyl)anthracenes (1) and 1-(arylselanyl)anthraquinones (2), respectively, where Se–CR in ArSeR is on the Ar plane in pl and perpendicular to the plane in pd. Absolute magnetic shielding tensors of Se (σ(Se)) are calculated for ArSeR (R = H, Me, and Ph), assuming pl and pd, with the DFT-GIAO method. Observed characters are well reproduced by the total shielding tensors (σt(Se)). The paramagnetic terms (σP(Se)) are governed by σP(Se)xx + σP(Se)yy, where the direction of nP(Se) is set to the z-axis. The mechanisms of the orientational effect are established both for pl and pd. Sets of δ(Se: 1) and δ(Se: 2) act as the standards for pl and pd, respectively, when δ(Se) of ArSeR are analyzed based on the orientational effect.
doi:10.1155/BCA/2006/79327
PMCID: PMC1800916  PMID: 17497018
12.  Reactions Between Chalcogen Donors and Dihalogens/Interalogens: Typology of Products and Their Characterization by FT-Raman Spectroscopy 
The chemical bond and structural features for the most important classes of solid products obtained by reacting chalcogen donors with dihalogens and interhalogens are reviewed. Particular attention is paid to the information the FT-Raman spectroscopy can confidently give about each structural motif considered in the absence of X-ray structural analyses.
doi:10.1155/BCA/2006/58937
PMCID: PMC1800915  PMID: 17497008
13.  Kinetic Study of DNA Modification by Phthalocyanine Derivative of the Oligonucleotide 
Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the last decades. One actively pursued approach involves antisense or antigene constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. In this study, we have investigated the kinetics and thermodynamics of sequence-specific modification of DNA with deoxyribooligonucleotide linked to Co(II)-tetracarboxyphthalocyanine (PtcCo(II)) in the presence of H2O2.
doi:10.1155/BCA/2006/23560
PMCID: PMC1800914  PMID: 17497004
14.  Pressure-Tuning Raman Spectra of Diiodine Thioamide Compounds: Models for Antithyroid Drug Activity 
The pressure-tuning Raman spectra of five solid, diiodine heterocyclic thioamide compounds (mbztS)I2 (mbztS = N-methyl-2-mercaptobenzothiazole) (1); [(mbztS)2I]+[I7]− (2); (pySH)I2 (pySH = 2-mercaptopyridine) (3); [(pySH)(pyS]+[I3]− (4); (thpm)(I2)2 or possibly [(thpm)I2]+[I3]− (thpm = 2-mercapto-3,4,5,6-tertahydropyrimidine (5) have been measured for pressures up to ∼ 50 kbar using a diamond-anvil cell. Compounds 1, 4, and 5 undergo pressure-induced phase transitions at ∼ 35, ∼ 25, and ∼ 32 kbar, respectively. Following the phase transition in 1, the pressure dependences of the vibrational modes, which were originally located at 84, 111, and 161 cm−1 and are associated with the S⋯I–I linkage, are 2.08, 1.78, and 0.57 cm−1/kbar, respectively. These pressure dependences are typical of low-energy vibrations. The pressure-tuning FT-Raman results for the pairs of compounds 1 , 2, 3, and 4 are remarkably similar to each other suggesting that the compounds are most probably perturbed diiodide compounds rather than ionic ones. The Raman data for 5 show that it is best formulated as (thpm)(I2)2 rather than [(thpm)2I]+[I3]−.
doi:10.1155/BCA/2006/68542
PMCID: PMC1794079  PMID: 17497015
15.  Protective Effect of Meso-Tetrakis-(3,5-di-tert-butyl-4-hydroxyphenyl)porphyrin on the In Vivo Impact of Trimethyltin Chloride on the Antioxidative Defense System 
The in vivo effect of trimethyltin chloride (Me3SnCl), free base meso-tetrakis(3,5-di-tert-butyl-4-hydroxyphenyl)porphyrin (R′4PH2) and their equimolar mixture, on the enzymatic activity of catalase (CAT), superoxide dismutase (SOD), and on the total content of free sulfhydryl groups has been studied in rat liver and kidney. It was demonstrated that the simultaneous treatment of tested animals with the combination of Me3SnCl and R′4PH2 reduced the toxic impact of Me3SnCl.
doi:10.1155/BCA/2006/64927
PMCID: PMC1794078  PMID: 17497013
16.  Interaction of Thioamides, Selenoamides, and Amides With Diiodine 
We review the results of our work on the iodine interaction with thioamides, selenoamides, and amides. Complexes with (i) “spoke” or “extended spoke” structures, D · I2 and D · I2 · I2, respectively, (D is the ligand donor) (ii) iodonium salts of {[D2 − I]+[In]−} (n = 3, 7) and {[D2 − I]+[FeCl4]−} formulae and (iii) disulfides of the categories (a) [D − D], (b) {[D − DH]+[I3]−} have been isolated and characterized. A compound of formula {[D2 − I]+[I3]−[D · I2]} containing both types of complexes (i) and (ii) was also isolated. The interaction of diiodine with selenium analogs of the antithyroid drug 6-n-propyl-2-thiouracil (PTU), of formulae RSeU (6-alkyl-2-Selenouracil) results in the formation of complexes with formulae [(RSeU)I2]. All these results are correlated with the mechanism of action of antithyroid drugs. Finally, we review here our work on the diiodine interaction with the amides (LO).
doi:10.1155/BCA/2006/60291
PMCID: PMC1794077  PMID: 17497011
17.  Bioinorganic Chemistry in Thyroid Gland: Effect of Antithyroid Drugs on Peroxidase-Catalyzed Oxidation and Iodination Reactions 
Propylthiouracil (PTU) and methimazole (MMI) are the most commonly used antithyroid drugs. The available data suggest that these drugs may block the thyroid hormone synthesis by inhibiting the thyroid peroxidase (TPO) or diverting oxidized iodides away from thyroglobulin. It is also known that PTU inhibits the selenocysteine-containing enzyme ID-1 by reacting with the selenenyl iodide intermediate (E-SeI). In view of the current interest in antithyroid drugs, we have recently carried out biomimetic studies to understand the mechanism by which the antithyroid drugs inhibit the thyroid hormone synthesis and found that the replacement of sulfur with selenium in MMI leads to an interesting compound that may reversibly block the thyroid hormone synthesis. Our recent results on the inhibition of lactoperoxidase (LPO)-catalyzed oxidation and iodination reactions by antithyroid drugs are described.
doi:10.1155/BCA/2006/23214
PMCID: PMC1794076  PMID: 17497002
18.  Design and Synthesis of Redox-Switched Lariat Ethers and Their Application for Transport of Alkali and Alkaline-Earth Metal Cations Across Supported Liquid Membrane 
A new class of redox-switched anthraquinone derived lariat ethers 1-(1-anthraquinonyloxy) 3, 6, 9 trioxaundecane 11-ol (M1), 1-(1-anthraquinonyloxy) 3, 6 dioxaoctane 9-ol (M2), 1-(1-anthraquinonyloxy) 3 oxapentane 5-ol (M3), 1-(1-anthraquinonyloxy) 3 oxapentane 5-butane (M4), 1-(1-anthraquinonyloxy) 3, 6 dioxaoctane 9-methane (M5) and 1-(1-anthraquinonyloxy) 3 oxapentane 5-methane (M6) have been synthesized and characterized by spectral analysis. These ionophores were used in liquid membrane carrier facilitated transport of main group metal cations across supported liquid membrane (SLM). Cellulose nitrate membrane was used as membrane support. Effect of various parameters such as variation in concentration of metal as well as ionophore, effect of chain length and end group of ionophore have been studied. The sequence of metal ions transported by ionophore M1 is Na+ > Li+ > K+ > Ca2+ > Mg2+ and the order of metal ions transported by ionophores (M2–M6) is Li+ > Na+ > K+ > Ca2+ > Mg2+. Ionophore M1 is selective for Na+, Li+, and K+ and ionophores (M2–M6) are selective for Li+ and Na+.
doi:10.1155/BCA/2006/97141
PMCID: PMC1779550  PMID: 17497021
19.  Synthesis, Superoxide Dismutase Mimetic and Anticancer Activities of Metal Complexes of 2,2-Dimethylpentanedioic Acid(2dmepdaH2) and 3,3-Dimethylpentanedioic acid(3dmepdaH2): X-Ray Crystal Structures of [Cu(3dmepda)(bipy)]2· 6H2O and [Cu(2dmepda)(bipy)(EtOH)]2· 4EtOH (bipy = 2,2′Bipyridine) 
2,2-dimethylpentanedioic acid (2dmepdaH2) and 3,3-dimethylpentanedioic acid (3dmepdaH2) reacted with copper(II) acetate to give [Cu(2dmepda)(H2O)3]2 (1) and [Cu(3dmepda)(H2O)3]2 (2). Reaction of (1) and (2) with 1,10-phenanthroline and 2,2′-bipyridine yielded [Cu(2dmepda)(phen)(H2O)]20.5phen (3), [Cu(2dmepda)(bipy)(H2O)]2 (4), [Cu(2dmepda)(bipy)(EtOH)]2· 2EtOH (4A), [Cu(3dmepda)(phen)(H2O)]2 (5), and [Cu(3dmepda)(bipy)(H2O)]2· (6). The structures of (4A) and (6) each consists of a [Cu(bipy)(dicarboxylate)(solvent)]2 dimer. The superoxide dismutase (SOD) mimetic activity of the novel copper complexes and their manganese analogues was investigated. The dimethyl sulphoxide(DMSO) soluble complexes (1)–(4) and (6) were assessed for their cancer chemotherapeutic potential towards hepatocellular carcinoma and kidney adenocarcinoma cell lines. The 1,10-phenanthroline containing complex [Cu(2dmepda)(phen)(H2O)]20.5phen (3) was the most potent with activity that compares well to that of cisplatin.
doi:10.1155/BCA/2006/80283
PMCID: PMC1779549  PMID: 17497019
20.  Antihuman Immunodeficiency Virus Type 1 (HIV-1) Activity of Rare Earth Metal Complexes of 4-Hydroxycoumarins in Cell Culture 
The cerium Ce(III), lanthanum La(III), and neodymium Nd(III) complexes with 4-hydroxy-3-(3-oxo-1-phenylbutyl)-2H-1-benzopyran-2-one (warfarin) (W) and 3,3′-benzylidenebis[4-hydroxycoumarin] (1) were synthesized and studied for the first time for cytotoxicity (on MT-2 cells) and as anti-HIV agents under acute and chronic infection. The complexes were characterized by different physicochemical methods: mass spectrometry, 1H NMR, 13C NMR, and IR spectroscopy. The spectra of the complexes were interpreted on the basis of comparison with the spectrum of the free ligands. Anti-HIV effect of the complexes/ligands was measured in MT-2 cells by microtiter infection assay. Detection of endogenous reverse transcriptase (RT) activity and RT processivity by PCR indicative for proviral DNA synthesis demonstrated that anti-HIV activity has not been linked to early stages of viral replication. No effect on late steps of viral replication has been found using cells chronically producing HIV-1LAI virus. La(W) demonstrated anti-HIV activity (IC50=21.4 μM) close to maximal nontoxic concentration. Nd(W), Ce(1), and Nd(1) demonstrated limited anti-HIV potency, so none of the complexes seems appropriate to be used in clinic. Further targeting of HIV-1 inhibition by La(W) is under progress.
doi:10.1155/BCA/2006/71938
PMCID: PMC1779548  PMID: 17497016
21.  Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification 
Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.
doi:10.1155/BCA/2006/63703
PMCID: PMC1779547  PMID: 17497012
22.  Synthesis, Characterization, and Cytotoxic Activity of New Lanthanum(III) Complexes of Bis-Coumarins 
Complexes of lanthanum(III) with bis-coumarins: 3,3′-benzylidene-bis(4-hydroxy-2H-1-benzopyran-2-one) (H2L1) and bis(4-hydroxy-2-oxo-2H-chromen-3-yl)-(1H-pyrazol-3-yl)-methane (H2L2) were synthesized by reaction of lanthanum(III) salt and the ligands, in amounts equal to metal : ligand molar ratio of 1 : 2. The complexes were prepared by adding an aqueous solution of lanthanum(III) salt to an aqueous solution of the ligand subsequently raising the pH of the mixture gradually to circa 5.0 by adding dilute solution of sodium hydroxide. The lanthanum(III) complexes with bis-coumarins were characterized by different physicochemical methods—elemental analysis, IR-, 1H-, and 13C-NMR-spectroscopies, and mass spectral data. The spectral data of lanthanum(III) complexes were interpreted on the basis of comparison with the spectra of the free ligands. This analysis showed that in the La(III) complexes, the ligands coordinated to the metal ion through both deprotonated hydroxyl groups. On the basis of the ν(C=O) red shift observed, participation of the carbonyl groups in the coordination with the metal ion was also suggested. In the present study, we performed a cytotoxic-effects screening of the lanthanum complexes with H2L1 and H2L2 in a panel of human tumor cell lines, using the standard MTT-dye reduction assay for cell viability. The panel consisted of the acute myeloid leukemia-derived HL-60 and the chronic myeloid leukemia-derived BV-173. Following a 24- hour treatment of BV-173 cells with lanthanum complex of H2L1 at 100 or 200 μM led to a DNA-laddering. The findings suggest that the observed cytotoxicity of the lanthanum complex of H2L1 on BV-173 is at least partly mediated through induction of programmed cell death.
doi:10.1155/BCA/2006/25651
PMCID: PMC1686302  PMID: 17497005
23.  Synthesis, Spectral, and Biological Properties of Copper(II) Complexes of Thiosemicarbazones of Schiff Bases Derived from 4-Aminoantipyrine and Aromatic Aldehydes 
We have synthesized a novel series of Schiff bases by condensation of 4-aminoantipyrine and various aromatic aldehydes followed by reaction with thiosemicarbazide. These thiosemicarbazones are potential ligands toward transition metal ions. The reaction of copper(II) salts with 4[N-(benzalidene)amino]antipyrinethiosemicarbazone (BAAPTS), 4[N-(4′-methoxybenzalidene) amino] antipyrinethiosemicarbozone (MBAAPTS), 4[N-(4′-dimethylamino benzalidene) amino] antipyrinethiosemicarbazone (DABAAPTS), and 4[N-(cinnamalidene) amino] antipyrinethiosemicarbazone (CAAPTS) resulted in the formation of solid complexes with the general composition CuX2 · (H2O)(L)(X = Cl, Br,NO3,NCS, or CH3COO; L = BAAPTS, MBAAPTS, DABAAPTS, or CAAPTS). These complexes were characterized through elemental analysis, molecular weight, electrical conductance, infrared, electronic spectra, and magnetic susceptibilities at room temperature. Copper(II) complexes with BAAPTS and MBAAPTS were screened for antibacterial and antifungal properties and have exhibited potential activity. Thermal stabilities of two representative complexes were also investigated.
doi:10.1155/BCA/2006/59509
PMCID: PMC1686301  PMID: 17497009
24.  Assessment of Toxicity of Some Penta- and Hexacoordinated Organotin(IV) and Tetracoordinated Tin(II) Complexes of Heterocyclic β-Diketones 
A number of penta- and hexacoordinated organotin(IV) complexes and tetracoordinated tin(II) complexes of compositions Me2SnCl[RCOC:CON(C6H5)N:C⎴CH3] (where R = − CH3, −p−ClC6H4, and −C6H5), Me2Sn[RCOC:CON(C6H5)N:C⎴CH3]2 (where R = −CH3, and −C6H5), and Sn(II) [RCOC:CON(C6H5)N:C⎴CH3]2 (where R = −p−ClC6H4 and −C6H5) were screened for their toxicity against Musca domestica (house fly). In general, organotin(IV) complexes contribute more to the activity than tin(II) complexes.
doi:10.1155/BCA/2006/60140
PMCID: PMC1686300  PMID: 17497010
25.  Antispermatogenic Activity of the Benzothiazoline Ligand and Corresponding Organoantimony(V) Derivative in Male Albino Rats 
Triphenylantimony(V) derivative, Ph3Sb(OPri) [SC6H4N : C(CH3)CH2C(O)CH3], 1b, and the corresponding benzothiazoline ligand [1, 2], HNC6H4SC⎴(CH3)CH2C(O)CH3, 1a, have been tested for their effects on the reproductive system of male albino rats. The oral administration of both 1a and 1b at the dose level of 10 mg/rat/day produced significant reduction in the weights of testes, epididymides, seminal vesicles, and ventral prostate. Significant decrease in sperm motility as well as in sperm density resulted in 100% sterility. Significant (P < .01) alterations were also found in biochemical parameters of reproductive organs in treated male rats as compared to the control group. Production of preleptotene, pachytene, and secondary spermatocytes was decreased by 42%, 43%, 39%, and by 44%, 49%, 55% in the ligand, 1a, and organoantimony(V) derivative, 1b, treated rats, respectively. These results indicate that both compounds 1a and 1b are antispermatogenic in nature and on oral administration in male rats, and finally caused sterility. A comparison indicates that the organoantimony(V) derivative 1b is more effective pertaining to its antispermatogenic activity than the corresponding ligand 1a.
doi:10.1155/BCA/2006/16895
PMCID: PMC1686299  PMID: 17496999

Results 1-25 (102)