PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (71)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
more »
1.  CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication 
Journal of Virology  2014;88(13):7389-7401.
ABSTRACT
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF.
IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.
doi:10.1128/JVI.00845-14
PMCID: PMC4054410  PMID: 24741094
2.  Epigenetic Deregulation of the LMP1/LMP2 Locus of Epstein-Barr Virus by Mutation of a Single CTCF-Cohesin Binding Site 
Journal of Virology  2014;88(3):1703-1713.
The chromatin regulatory factors CTCF and cohesin have been implicated in the coordinated control of multiple gene loci in Epstein-Barr virus (EBV) latency. We have found that CTCF and cohesin are highly enriched at the convergent and partially overlapping transcripts for the LMP1 and LMP2A genes, but it is not yet known how CTCF and cohesin may coordinately regulate these transcripts. We now show that genetic disruption of this CTCF binding site (EBVΔCTCF166) leads to a deregulation of LMP1, LMP2A, and LMP2B transcription in EBV-immortalized B lymphocytes. EBVΔCTCF166 virus-immortalized primary B lymphocytes showed a decrease in LMP1 and LMP2A mRNA and a corresponding increase in LMP2B mRNA. The reduction of LMP1 and LMP2A correlated with a loss of euchromatic histone modification H3K9ac and a corresponding increase in heterochromatic histone modification H3K9me3 at the LMP2A promoter region in EBVΔCTCF166. Chromosome conformation capture (3C) revealed that DNA loop formation with the origin of plasmid replication (OriP) enhancer was eliminated in EBVΔCTCF166. We also observed that the EBV episome copy number was elevated in EBVΔCTCF166 and that this was not due to increased lytic cycle activity. These findings suggest that a single CTCF binding site controls LMP2A and LMP1 promoter selection, chromatin boundary function, DNA loop formation, and episome copy number control during EBV latency.
doi:10.1128/JVI.02209-13
PMCID: PMC3911611  PMID: 24257606
3.  Cleavage of TFIIA by Taspase1 Activates TRF2-Specified Mammalian Male Germ Cell Programs 
Developmental cell  2013;27(2):188-200.
SUMMARY
The evolution of tissue-specific general transcription factors (GTF), such as testis-specific TBP-related factor 2 (TRF2), enables the spatiotemporal expression of highly specialized genetic programs. Taspase1 is a protease that cleaves nuclear factors MLL1, MLL2, TFIIAα-β, and ALFα-β (TFIIAτ). Here we demonstrate that Taspase1-mediated processing of TFIIAα-β drives mammalian spermatogenesis. Both Taspase1−/− and non-cleavable TFIIAα-βnc/nc testes release immature germ cells with impaired transcription of Transition proteins (Tnp) and Protamines (Prm), exhibiting chromatin compaction defects, recapitulating those observed with TRF2−/− testes. Although the unprocessed TFIIA still complexes with TRF2, this complex is impaired in targeting and thus activating Tnp1 and Prm1 promoters. Current study presents a paradigm in which a protease (Taspase1) cleaves a ubiquitously expressed GTF (TFIIA) to enable tissue-specific (testis) transcription, meeting the demand for sophisticated regulation of distinct subsets of genes in higher organisms.
doi:10.1016/j.devcel.2013.09.025
PMCID: PMC3947863  PMID: 24176642
4.  Development of Drugs for Epstein - Barr virus using High-Throughput in silico Virtual Screening 
Expert opinion on drug discovery  2010;5(12):10.1517/17460441.2010.524640.
Importance of the field
Epstein-Barr virus (EBV) is a ubiquitious human herpesvirus that is causally associated with endemic forms of Burkitt’s lymphoma (BL), nasopharyngeal carcinoma, and lymphoproliferative disease in immunosuppressed individuals. On a global scale, EBV infects over 90% of the adult population and is responsible for ~1% of all human cancers. To date, there is no efficacious drug or therapy for the treatment of EBV infection and EBV-related diseases.
Areas covered in this review
In this review, we discuss the existing anti-EBV inhibitors and those under development. We discuss the value of different molecular targets, including EBV lytic DNA replication enzymes, as well as proteins that are expressed exclusively during latent infection, like EBNA1 and LMP1. Since the atomic structure of the EBNA1 DNA binding domain has been described, it is an attractive target for in silico methods of drug design and small molecule screening. We discuss the use of computational methods that can greatly facilitate the development of novel inhibitors and how in silico screening methods can be applied to target proteins with known structures, like EBNA1, to treat EBV infection and disease.
What the reader will gain
The reader will be familiarized with the problems in targeting of EBV for inhibition by small molecules and how computational methods can greatly facilitate this process.
Take home message
Despite the impressive efficacy of nucleoside analogues for the treatment of herpesvirus lytic infection, there remain few effective treatments for latent infections. Since EBV-latent infection persists within and contributes to the formation of EBV-associated cancers, targeting EBV latent proteins is an unmet medical need. High throughput in silico screening can accelerate the process of drug discovery for novel and selective agents that inhibit EBV latent infection and associated disease.
doi:10.1517/17460441.2010.524640
PMCID: PMC3816986  PMID: 22822721
Epstein-Barr virus (EBV); DNA polymerase; LMP1; EBNA1; computational screening
5.  Timeless-Dependent DNA Replication-Coupled Recombination Promotes Kaposi's Sarcoma-Associated Herpesvirus Episome Maintenance and Terminal Repeat Stability 
Journal of Virology  2013;87(7):3699-3709.
Kaposi's Sarcoma-associated herpesvirus (KSHV) is maintained as a stable episome in latently infected pleural effusion lymphoma (PEL) cells. Episome maintenance is conferred by the binding of the KSHV-encoded LANA protein to the viral terminal repeats (TR). Here, we show that DNA replication in the KSHV TR is coupled with DNA recombination and mediated in part through the cellular replication fork protection factors Timeless (Tim) and Tipin. We show by two-dimensional (2D) agarose gel electrophoresis that replication forks naturally stall and form recombination-like structures at the TR during an unperturbed cell cycle. Chromatin immunoprecipitation (ChIP) assays revealed that Tim and Tipin are selectively enriched at the KSHV TR during S phase and in a LANA-dependent manner. Tim depletion inhibited LANA-dependent TR DNA replication and caused the loss of KSHV episomes from latently infected PEL cells. Tim depletion resulted in the aberrant accumulation of recombination structures and arrested MCM helicase at TR. Tim depletion did not induce the KSHV lytic cycle or apoptotic cell death. We propose that KSHV episome maintenance requires Tim-assisted replication fork protection at the viral terminal repeats and that Tim-dependent recombination-like structures form at TR to promote DNA repeat stability and viral genome maintenance.
doi:10.1128/JVI.02211-12
PMCID: PMC3624199  PMID: 23325691
7.  Epigenetic Regulation of EBV and KSHV Latency 
Current opinion in virology  2013;3(3):251-259.
The gammaherpesviruses are unique for their capacity to establish a variety of gene expression programs during latent and lytic infection. This capacity enables the virus to control host-cell proliferation, prevent programmed cell death, elude immune cell detection, and ultimately adapt to a wide range of environmental and developmental changes in the host cell. This remarkable plasticity of gene expression results from the combined functionalities of viral and host factors that biochemically remodel and epigenetically modify the viral chromosome. These epigenetic modifications range from primary DNA methylations, to chromatin protein post-translational modifications, to higher-order chromosome conformations. In addition, gammaherpesviruses have acquired specialized tools to modulate the epigenetic processes that promote viral genome propagation and host-cell survival.
doi:10.1016/j.coviro.2013.03.004
PMCID: PMC3947873  PMID: 23601957
8.  CTCF Regulates Kaposi's Sarcoma-Associated Herpesvirus Latency Transcription by Nucleosome Displacement and RNA Polymerase Programming 
Journal of Virology  2013;87(3):1789-1799.
CCCTC-binding factor (CTCF) has been implicated in various aspects of viral and host chromatin organization and transcriptional control. We showed previously that CTCF binds to a cluster of three sites in the first intron of the Kaposi's sarcoma-associated herpesvirus (KSHV) multicistronic latency-associated transcript that encodes latency-associated nuclear antigen (LANA), viral cyclin (vCyclin), vFLIP, viral microRNAs, and kaposin. We show here that these CTCF binding sites regulate mRNA production, RNA polymerase II (RNAPII) programming, and nucleosome organization of the KSHV latency transcript control region. We also show that KSHV bacmids lacking these CTCF binding sites have elevated and altered ratios of spliced latency transcripts. CTCF binding site mutations altered RNAPII and RNAPII-accessory factor interactions with the latency control region. CTCF binding sites were required for the in vitro recruitment of RNAPII to the latency control region, suggesting that direct interactions between CTCF and RNAPII contribute to transcription regulation. Histone modifications in the latency control region were also altered by mutations in the CTCF binding sites. Finally, we show that CTCF binding alters the regular phasing of nucleosomes in the latency gene transcript and intron, suggesting that nucleosome positioning can be an underlying biochemical mechanism of CTCF function. We propose that RNAPII interactions and nucleosome displacement serve as a biochemical basis for programming RNAPII in the KSHV transcriptional control region.
doi:10.1128/JVI.02283-12
PMCID: PMC3554185  PMID: 23192870
9.  TERRA, CpG methylation and telomere heterochromatin 
Cell cycle (Georgetown, Tex.)  2010;9(1):69-74.
Self-reinforcing negative feedback loops are commonly observed in biological systems. RNA-mediated negative feedback loops have been described in the formation of heterochromatin at centromeres in fission yeast and the inactive X chromosome in mammalian cells. The telomere repeat-containing RNA (TERRA) has also been implicated in the formation of telomeric heterochromatin through a self-reinforcing negative feedback loop. In cells derived from human ICF syndrome, TERRA levels are abnormally elevated and telomeres are abnormally shortened. We now show that telomere heterochromatin is also abnormal in ICF cells. We propose that ICF cells fail to reinforce the TERRA-dependent negative feedback loop as a result of the inability to establish heterochromatin at subtelomeres. This failure is likely due to the lack of DNMT3b and DNA methylation, which is a genetic lesion associated with ICF syndrome. Failure of this feedback mechanism leads to catastrophic telomere dysfunction and chromosome instability.
PMCID: PMC3664275  PMID: 20016274
TERRA; TRF2; CpG methylation; heterochromatin; ICF syndrome
10.  Cohesins Repress Kaposi's Sarcoma-Associated Herpesvirus Immediate Early Gene Transcription during Latency 
Journal of Virology  2012;86(17):9454-9464.
Chromatin-organizing factors such as CTCF and cohesins have been implicated in the control of complex viral regulatory programs. We investigated the role of CTCF and cohesins in the control of the switch from latency to the lytic cycle for Kaposi's sarcoma-associated herpesvirus (KSHV). We found that cohesin subunits but not CTCF are required for the repression of KSHV immediate early gene transcription. Depletion of the cohesin subunits Rad21, SMC1, and SMC3 resulted in lytic cycle gene transcription and viral DNA replication. In contrast, depletion of CTCF failed to induce lytic transcription or DNA replication. Chromatin immunoprecipitation with high-throughput sequencing (ChIP-Seq) revealed that cohesins and CTCF bound to several sites within the immediate early control region for ORF50 and to more distal 5′ sites that also regulate the divergently transcribed ORF45-ORF46-ORF47 gene cluster. Rad21 depletion led to a robust increase in ORF45, ORF46, ORF47, and ORF50 transcripts, with similar kinetics to that observed with chemical induction by sodium butyrate. During latency, the chromatin between the ORF45 and ORF50 transcription start sites was enriched in histone H3K4me3, with elevated H3K9ac at the ORF45 promoter and elevated H3K27me3 at the ORF50 promoter. A paused form of RNA polymerase II (Pol II) was loosely associated with the ORF45 promoter region during latency but was converted to an active elongating form upon reactivation induced by Rad21 depletion. Butyrate treatment caused a rapid dissociation of cohesins and loss of CTCF binding at the immediate early gene locus, suggesting that cohesins may be a direct target of butyrate-mediated lytic induction. Our findings implicate cohesins as a major repressor of KSHV lytic gene activation and show that they function coordinately with CTCF to regulate the switch between latent and lytic gene activity.
doi:10.1128/JVI.00787-12
PMCID: PMC3416178  PMID: 22740398
11.  EBNA1 binding and epigenetic regulation of gastrokine tumor suppressor genes in gastric carcinoma cells 
Virology Journal  2014;11:12.
Background
Epstein-Barr Virus (EBV) latently infects ~10% of gastric carcinomas (GC). Epstein-Barr Nuclear Antigen 1 (EBNA1) is expressed in EBV-associated GC, and can bind host DNA, where it may impact cellular gene regulation. Here, we show that EBNA1 binds directly to DNA upstream of the divergently transcribed GC-specific tumor suppressor genes gastrokine 1 (GKN1) and gastrokine 2 (GKN2).
Methods
We use ChIP-Seq, ChIP-qPCR, and EMSA to demonstrate that EBNA1 binds directly to the GKN1 and GKN2 promoter locus. We generate AGS-EBV, and AGS-EBNA1 cell lines to study the effects of EBNA1 on GKN1 and GKN2 mRNA expression with or without 5′ azacytidine treatment.
Results
We show that gastrokine genes are transcriptionally silenced by DNA methylation. We also show that latent EBV infection further reduces GKN1 and GKN2 expression in AGS gastric carcinoma cells, and that siRNA depletion of EBNA1 partially alleviates this repression. However, ectopic expression of EBNA1 slightly increased GKN1 and GKN2 basal mRNA levels, but reduced their responsiveness to demethylating agent.
Conclusions
These findings demonstrate that EBNA1 binds to the divergent promoter of the GKN1 and GKN2 genes in GC cells, and suggest that EBNA1 contributes to the complex transcriptional and epigenetic deregulation of the GKN1 and GKN2 tumor suppressor genes in EBV positive GC.
doi:10.1186/1743-422X-11-12
PMCID: PMC3904692  PMID: 24460791
EBV; EBNA1; Gastric carcinoma; Gastrokine; ChIP-Seq; Epigenetic
12.  Snapshots: Chromatin Control of Viral Infection 
Virology  2013;435(1):141-156.
Like their cellular host counterparts, many invading viral pathogens must contend with, modulate, and utilize the host cell’s chromatin machinery to promote efficient lytic infection or control persistent-latent states. While not intended to be comprehensive, this review represents a compilation of conceptual snapshots of the dynamic interplay of viruses with the chromatin environment. Contributions focus on chromatin dynamics during infection, viral circumvention of cellular chromatin repression, chromatin organization of large DNA viruses, tethering and persistence, viral interactions with cellular chromatin modulation machinery, and control of viral latency-reactivation cycles.
doi:10.1016/j.virol.2012.09.023
PMCID: PMC3531885  PMID: 23217624
Chromatin; Virus; Herpesvirus; Adenovirus; Papillomavirus; Human Immunodeficiency Virus; Influenza virus
13.  Identification of Host-Chromosome Binding Sites and Candidate Gene Targets for Kaposi's Sarcoma-Associated Herpesvirus LANA 
Journal of Virology  2012;86(10):5752-5762.
LANA is essential for tethering the Kaposi's sarcoma-associated herpesvirus (KSHV) genome to metaphase chromosomes and for modulating host-cell gene expression, but the binding sites in the host-chromosome remain unknown. Here, we use LANA-specific chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-Seq) to identify LANA binding sites in the viral and host-cell genomes of a latently infected pleural effusion lymphoma cell line BCBL1. LANA bound with high occupancy to the KSHV genome terminal repeats (TR) and to a few minor binding sites in the KSHV genome, including the LANA promoter region. We identified 256 putative LANA binding site peaks with P < 0.01 and overlap in two independent ChIP-Seq experiments. We validated several of the high-occupancy binding sites by conventional ChIP assays and quantitative PCR. Candidate cellular LANA binding motifs were identified and assayed for binding to purified recombinant LANA protein in vitro but bound with low affinity compared to the viral TR binding site. More than half of the LANA binding sites (170/256) could be mapped to within 2.5 kb of a cellular gene transcript. Pathways and Gene Ontogeny (GO) analysis revealed that LANA binds to genes within the p53 and tumor necrosis factor (TNF) regulatory network. Further analysis revealed partial overlap of LANA and STAT1 binding sites in several gamma interferon (IFN-γ)-regulated genes. We show that ectopic expression of LANA can downmodulate IFN-γ-mediated activation of a subset of genes, including the TAP1 peptide transporter and proteasome subunit beta type 9 (PSMB9), both of which are required for class I antigen presentation. Our data provide a potential mechanism through which LANA may regulate several host cell pathways by direct binding to gene regulatory elements.
doi:10.1128/JVI.07216-11
PMCID: PMC3347294  PMID: 22419807
14.  Molecular Basis for Oligomeric-DNA Binding and Episome Maintenance by KSHV LANA 
PLoS Pathogens  2013;9(10):e1003672.
LANA is the KSHV-encoded terminal repeat binding protein essential for viral replication and episome maintenance during latency. We have determined the X-ray crystal structure of LANA C-terminal DNA binding domain (LANADBD) to reveal its capacity to form a decameric ring with an exterior DNA binding surface. The dimeric core is structurally similar to EBV EBNA1 with an N-terminal arm that regulates DNA binding and is required for replication function. The oligomeric interface between LANA dimers is dispensable for single site DNA binding, but is required for cooperative DNA binding, replication function, and episome maintenance. We also identify a basic patch opposite of the DNA binding surface that is responsible for the interaction with BRD proteins and contributes to episome maintenance function. The structural features of LANADBD suggest a novel mechanism of episome maintenance through DNA-binding induced oligomeric assembly.
Author Summary
Kaposi's sarcoma-associated herpesvirus (KSHV) establishes latent infections that are associated with several cancers including Kaposi's sarcoma, pleural effusion lymphoma, and multicentric Caslteman's disease. One of the major viral proteins required for establishment and maintenance of the latent state is the latency-associated nuclear antigen (LANA). LANA binds to DNA sequences within the terminal repeats (TR) of the viral genome and stimulates both DNA replication and episome maintenance during latency. Here we present the X-ray crystal structure of the DNA binding domain of LANA (LANADBD) and show that it has the capacity to form oligomeric complexes upon DNA binding. We characterize structural features of LANADBD that are required for oligomerization, DNA binding, and interaction with host cell BET proteins, BRD2 and BRD4, which are important for mediating multiple functions of LANA, including episome maintenance.
doi:10.1371/journal.ppat.1003672
PMCID: PMC3798644  PMID: 24146617
15.  CTCF binding site sequence differences are associated with unique regulatory and functional trends during embryonic stem cell differentiation 
Nucleic Acids Research  2013;42(2):774-789.
CTCF (CCCTC-binding factor) is a highly conserved multifunctional DNA-binding protein with thousands of binding sites genome-wide. Our previous work suggested that differences in CTCF’s binding site sequence may affect the regulation of CTCF recruitment and its function. To investigate this possibility, we characterized changes in genome-wide CTCF binding and gene expression during differentiation of mouse embryonic stem cells. After separating CTCF sites into three classes (LowOc, MedOc and HighOc) based on similarity to the consensus motif, we found that developmentally regulated CTCF binding occurs preferentially at LowOc sites, which have lower similarity to the consensus. By measuring the affinity of CTCF for selected sites, we show that sites lost during differentiation are enriched in motifs associated with weaker CTCF binding in vitro. Specifically, enrichment for T at the 18th position of the CTCF binding site is associated with regulated binding in the LowOc class and can predictably reduce CTCF affinity for binding sites. Finally, by comparing changes in CTCF binding with changes in gene expression during differentiation, we show that LowOc and HighOc sites are associated with distinct regulatory functions. Our results suggest that the regulatory control of CTCF is dependent in part on specific motifs within its binding site.
doi:10.1093/nar/gkt910
PMCID: PMC3902912  PMID: 24121688
17.  Therapeutic doses of hydroxyurea cause telomere dysfunction and reduce TRF2 binding to telomeres 
Cancer biology & therapy  2009;8(12):1136-1145.
Hydroxyurea (HU) is a chemotherapeutic agent commonly used for various malignancies and hematological disorders, including chronic myelogenous leukemia and sickle cell anemia. We show here that chronic, low-level treatment with HU induces a variety of defects in telomere replication and maintenance. HU treatment preferentially decreased the rate of telomere DNA synthesis and altered the cell cycle timing of telomere replication. HU reduced the expression levels of telomere repeat RNA (TERRA). In some cells, HU caused a rapid loss of telomere restriction fragment length. Chromatin immunoprecipitation (ChIP) assay indicated that telomere repeat binding factors TRF1 and TRF2 dissociate from telomere DNA after HU treatment. TRF2 protein purified from HU treated cells showed a modest reduction in DNA binding activity and a change in isoelectric point as measured by 2D gel electrophoresis. However, chronic low level HU treatment did not evoke a DNA replication checkpoint response, suggesting that the mechanism of action is distinct from the well-characterized S-phase checkpoint pathway. We conclude that therapeutic doses of HU preferentially effects telomere replication and maintenance, through a mechanism that may involve the direct modification of TRF2. These findings provide new insight into the potential mechanisms of action of HU at telomeres and in cancer chemotherapies.
PMCID: PMC3313557  PMID: 19363303
hydroxyurea; telomere; TRF2; replication; TERRA
18.  Development of a High-Throughput Screen for Inhibitors of Epstein-Barr Virus EBNA1 
Journal of Biomolecular Screening  2010;15(9):1107-1115.
Latent infection with Epstein-Barr Virus (EBV) is a carcinogenic cofactor in several lymphoid and epithelial cell malignancies. At present, there are no small molecule inhibitors that specifically target EBV latent infection or latency-associated oncoproteins. EBNA1 is an EBV-encoded sequence-specific DNA-binding protein that is consistently expressed in EBV-associated tumors and required for stable maintenance of the viral genome in proliferating cells. EBNA1 is also thought to provide cell survival function in latently infected cells. In this work we describe the development of a biochemical high-throughput screening (HTS) method using a homogenous fluorescence polarization (FP) assay monitoring EBNA1 binding to its cognate DNA binding site. An FP-based counterscreen was developed using another EBV-encoded DNA binding protein, Zta, and its cognate DNA binding site. We demonstrate that EBNA1 binding to a fluorescent labeled DNA probe provides a robust assay with a Z-factor consistently greater than 0.6. A pilot screen of a small molecule library of ~14,000 compounds identified 3 structurally related molecules that selectively inhibit EBNA1, but not Zta. All three compounds had activity in a cell-based assay specific for the disruption of EBNA1 transcription repression function. One of the compounds was effective in reducing EBV genome copy number in Raji Burkitt lymphoma cells. These experiments provide a proof-of-concept that small molecule inhibitors of EBNA1 can be identified by biochemical high-throughput screening of compound libraries. Further screening in conjunction with medicinal chemistry optimization may provide a selective inhibitor of EBNA1 and EBV latent infection.
doi:10.1177/1087057110379154
PMCID: PMC3310380  PMID: 20930215
19.  Telomeres and viruses: common themes of genome maintenance 
Frontiers in Oncology  2012;2:201.
Genome maintenance mechanisms actively suppress genetic instability associated with cancer and aging. Some viruses provoke genetic instability by subverting the host’s control of genome maintenance. Viruses have their own specialized strategies for genome maintenance, which can mimic and modify host cell processes. Here, we review some of the common features of genome maintenance utilized by viruses and host chromosomes, with a particular focus on terminal repeat (TR) elements. The TRs of cellular chromosomes, better known as telomeres, have well-established roles in cellular chromosome stability. Cellular telomeres are themselves maintained by viral-like mechanisms, including self-propagation by reverse transcription, recombination, and retrotransposition. Viral TR elements, like cellular telomeres, are essential for viral genome stability and propagation. We review the structure and function of viral repeat elements and discuss how they may share telomere-like structures and genome protection functions. We consider how viral infections modulate telomere regulatory factors for viral repurposing and can alter normal host telomere structure and chromosome stability. Understanding the common strategies of viral and cellular genome maintenance may provide new insights into viral–host interactions and the mechanisms driving genetic instability in cancer.
doi:10.3389/fonc.2012.00201
PMCID: PMC3533235  PMID: 23293769
virus; telomere; replication; EBV; KSHV; HHV6; MDV
20.  An Atlas of the Epstein-Barr Virus Transcriptome and Epigenome Reveals Host-Virus Regulatory Interactions 
Cell host & microbe  2012;12(2):233-245.
Epstein-Barr Virus (EBV), which is associated with multiple human tumors, persists as a minichromosome in the nucleus of B-lymphocytes and induces malignancies through incompletely understood mechanisms. Here, we present a large-scale functional genomic analysis of EBV. Our experimentally generated nucleosome positioning maps and viral protein binding data were integrated with over 700 publicly available high-throughput sequencing data sets for human lymphoblastoid cell lines mapped to the EBV genome. We found that viral lytic genes are coexpressed with cellular cancer-associated pathways, suggesting that the lytic cycle may play an unexpected role in virus-mediated oncogenesis. Host regulators of viral oncogene expression and chromosome structure were identified and validated, revealing a role for the B-cell-specific protein Pax5 in viral gene regulation and the cohesin complex in regulating higher order chromatin structure. Our findings provide a deeper understanding of latent viral persistence in oncogenesis and establish a valuable viral genomics resource for future exploration.
doi:10.1016/j.chom.2012.06.008
PMCID: PMC3424516  PMID: 22901543
21.  Timeless preserves telomere length by promoting efficient DNA replication through human telomeres 
Cell Cycle  2012;11(12):2337-2347.
A variety of telomere protection programs are utilized to preserve telomere structure. However, the complex nature of telomere maintenance remains elusive. The Timeless protein associates with the replication fork and is thought to support efficient progression of the replication fork through natural impediments, including replication fork block sites. However, the mechanism by which Timeless regulates such genomic regions is not understood. Here, we report the role of Timeless in telomere length maintenance. We demonstrate that Timeless depletion leads to telomere shortening in human cells. This length maintenance is independent of telomerase, and Timeless depletion causes increased levels of DNA damage, leading to telomere aberrations. We also show that Timeless is associated with Shelterin components TRF1 and TRF2. Timeless depletion slows telomere replication in vitro, and Timeless-depleted cells fail to maintain TRF1-mediated accumulation of replisome components at telomeric regions. Furthermore, telomere replication undergoes a dramatic delay in Timeless-depleted cells. These results suggest that Timeless functions together with TRF1 to prevent fork collapse at telomere repeat DNA and ensure stable maintenance of telomere length and integrity.
doi:10.4161/cc.20810
PMCID: PMC3383593  PMID: 22672906
TRF1; replication efficiency; telomere; telomere aberration; the fork protection complex; timeless
22.  Chromatin Organization of Gammaherpesvirus Latent Genomes 
Biochimica et biophysica acta  2009;1799(3-4):236-245.
The gammaherpesviruses are a subclass of the herpesvirus family that establish stable latent infections in proliferating lymphoid and epithelial cells. The latent genomes are maintained as multicopy chromatinized episomes that replicate in synchrony with the cellular genome. Importantly, most of the episomes do not integrate into the host chromosome. Therefore, it is essential that the viral “minichromosome” establish a chromatin structure that is suitable for gene expression, DNA replication, and chromosome segregation. Evidence suggests that chromatin organization is important for each of these functions and plays a regulatory role in the establishment and maintenance of latent infection. Here, we review recent studies on the chromatin organization of the human gammaherpesviruses, Epstein-Barr Virus (EBV) and Kaposi’s Sarcoma-Associated Herpesvirus (KSHV). We discuss the potential role of viral origins of DNA replication and viral encoded origin-binding proteins like EBNA1 and LANA in establishment of viral chromosome organization during latent infection. We also discuss the roles of host cell factors, like CTCF and Cohesins, that contribute to higher order chromosome structures that may be important for stable gene expression programs during latent infection in proliferating cells.
doi:10.1016/j.bbagrm.2009.10.004
PMCID: PMC2839031  PMID: 19853673
23.  Interpreting the Epstein-Barr Virus (EBV) Epigenome Using High-Throughput Data 
Viruses  2013;5(4):1042-1054.
The Epstein-Barr virus (EBV) double-stranded DNA genome is subject to extensive epigenetic regulation. Large consortiums and individual labs have generated a vast number of genome-wide data sets on human lymphoblastoid and other cell lines latently infected with EBV. Analysis of these data sets reveals important new information on the properties of the host and viral chromosome structure organization and epigenetic modifications. We discuss the mapping of these data sets and the subsequent insights into the chromatin structure and transcription factor binding patterns on latent EBV genomes. Colocalization of multiple histone modifications and transcription factors at regulatory loci are considered in the context of the biology and regulation of EBV.
doi:10.3390/v5041042
PMCID: PMC3705264  PMID: 23549386
Epstein-Barr virus; gammaherpesvirus; chromatin; histone modification; CTCF; OriP
24.  Mechanism of Glycyrrhizic Acid Inhibition of Kaposi's Sarcoma-Associated Herpesvirus: Disruption of CTCF-Cohesin-Mediated RNA Polymerase II Pausing and Sister Chromatid Cohesion ▿  
Journal of Virology  2011;85(21):11159-11169.
Glycyrrhizic acid (GA), a derivative of licorice, selectively inhibits the growth of lymphocytes latently infected with Kaposi's sarcoma-associated herpesvirus. The mechanism involves the deregulation of the multicistronic latency transcript, including the failure to generate the mature forms of viral mRNA encoding LANA. We show here that GA disrupts an RNA polymerase II (RNAPII) complex that accumulates at the CTCF-cohesin binding site within the first intron of the latency transcript. GA altered the enrichment of the RNAPII pausing complex, along with pausing factors SPT5 and NELF-A, at the intragenic CTCF-cohesin binding sites. GA blocked the interaction of cohesin subunit SMC3 with another cohesin subunit, RAD21, and reduced SPT5 interaction with RNAPII. Covalent coupling of GA to a solid support revealed that GA interacts with several cellular proteins, including SMC3 and SPT5, but not their respective interaction partners RAD21 and RNAPII. GA treatment also inhibited the transcription of some cellular genes, like c-myc, which contain a similar CTCF-cohesin binding site within the first intron. We also found that GA leads to a more general loss of sister chromatid cohesion for cellular chromosomes. These findings suggest that RNAPII pauses at intragenic CTCF-cohesin binding sites and that abrogation of this pausing by GA leads to loss of proper mRNA production and defects in sister chromatid cohesion, a process important for both viral and cellular chromosome stability.
doi:10.1128/JVI.00720-11
PMCID: PMC3194953  PMID: 21880767
25.  Initiation of lytic DNA replication in Epstein–Barr virus: search for a common family mechanism 
Future virology  2010;5(1):65-83.
Herpesviruses are a complex family of dsDNA viruses that are a major cause of human disease. All family members share highly related viral replication proteins, such as DNA polymerase, ssDNA-binding proteins and processivity factors. Consequently, it is generally thought that lytic replication occurs through a common and conserved mechanism. However, considerable evidence indicates that proteins controlling initiation of DNA replication vary greatly among the herepesvirus subfamilies. In this article, we focus on some of the known mechanisms that regulate Epstein-Barr virus lytic-cycle replication, and compare this to other herpesvirus family members. Our reading of the literature leads us to conclude that diverse viral mechanisms generate a common nucleoprotein prereplication structure that can be recognized by a highly conserved family of viral replication enzymes.
doi:10.2217/fvl.09.69
PMCID: PMC3314400  PMID: 22468146
BZLF1; EBV; Epstein–Barr; OriLyt; recombination; repair; replication; Zta

Results 1-25 (71)