PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (113)
 

Clipboard (0)
None

Select a Filter Below

Year of Publication
more »
1.  Biological Cost of Different Mechanisms of Colistin Resistance and Their Impact on Virulence in Acinetobacter baumannii 
Two mechanisms of resistance to colistin have been described in Acinetobacter baumannii. One involves complete loss of lipopolysaccharide (LPS), resulting from mutations in lpxA, lpxC, or lpxD, and the second is associated with phosphoethanolamine addition to LPS, mediated through mutations in pmrAB. In order to assess the clinical impacts of both resistance mechanisms, A. baumannii ATCC 19606 and its isogenic derivatives, AL1851 ΔlpxA, AL1852 ΔlpxD, AL1842 ΔlpxC, and ATCC 19606 pmrB, were analyzed for in vitro growth rate, in vitro and in vivo competitive growth, infection of A549 respiratory alveolar epithelial cells, virulence in the Caenorhabditis elegans model, and virulence in a systemic mouse infection model. The in vitro growth rate of the lpx mutants was clearly diminished; furthermore, in vitro and in vivo competitive-growth experiments revealed a reduction in fitness for both mutant types. Infection of A549 cells with ATCC 19606 or the pmrB mutant resulted in greater loss of viability than with lpx mutants. Finally, the lpx mutants were highly attenuated in both the C. elegans and mouse infection models, while the pmrB mutant was attenuated only in the C. elegans model. In summary, while colistin resistance in A. baumannii confers a clear selective advantage in the presence of colistin treatment, it causes a noticeable cost in terms of overall fitness and virulence, with a more striking reduction associated with LPS loss than with phosphoethanolamine addition. Therefore, we hypothesize that colistin resistance mediated by changes in pmrAB will be more likely to arise in clinical settings in patients treated with colistin.
doi:10.1128/AAC.01597-13
PMCID: PMC3910726  PMID: 24189257
2.  Evolutionary Analysis of Burkholderia pseudomallei Identifies Putative Novel Virulence Genes, Including a Microbial Regulator of Host Cell Autophagy 
Journal of Bacteriology  2013;195(24):5487-5498.
Burkholderia pseudomallei, the causative agent of melioidosis, contains a large pathogen genome (7.2 Mb) with ∼2,000 genes of putative or unknown function. Interactions with potential hosts and environmental factors may induce rapid adaptations in these B. pseudomallei genes, which can be discerned through evolutionary analysis of multiple B. pseudomallei genomes. Here we show that several previously uncharacterized B. pseudomallei genes bearing genetic signatures of rapid adaptation (positive selection) can induce diverse cellular phenotypes when expressed in mammalian cells. Notably, several of these phenotypes are plausibly related to virulence, including multinuclear giant cell formation, apoptosis, and autophagy induction. Specifically, we show that BPSS0180, a type VI cluster-associated gene, is capable of inducing autophagy in both phagocytic and nonphagocytic mammalian cells. Following infection of macrophages, a B. pseudomallei mutant disrupted in BPSS0180 exhibited significantly decreased colocalization with LC3 and impaired intracellular survival; these phenotypes were rescued by introduction of an intact BPSS0180 gene. The results suggest that BPSS0180 may be a novel inducer of host cell autophagy that contributes to B. pseudomallei intracellular growth. More generally, our study highlights the utility of applying evolutionary principles to microbial genomes to identify novel virulence genes.
doi:10.1128/JB.00718-13
PMCID: PMC3889600  PMID: 24097950
3.  Structural and Functional Characterization of an Orphan ATP-Binding Cassette ATPase Involved in Manganese Utilization and Tolerance in Leptospira spp. 
Journal of Bacteriology  2013;195(24):5583-5591.
Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn2+, we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn2+, suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn2+ toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg2+-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.
doi:10.1128/JB.00915-13
PMCID: PMC3889601  PMID: 24123817
4.  Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii 
Journal of Bacteriology  2013;195(24):5577-5582.
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
doi:10.1128/JB.00853-13
PMCID: PMC3889614  PMID: 24123815
5.  Pasteurella multocida Heddleston Serovar 3 and 4 Strains Share a Common Lipopolysaccharide Biosynthesis Locus but Display both Inter- and Intrastrain Lipopolysaccharide Heterogeneity 
Journal of Bacteriology  2013;195(21):4854-4864.
Pasteurella multocida is a Gram-negative multispecies pathogen and the causative agent of fowl cholera, a serious disease of poultry which can present in both acute and chronic forms. The major outer membrane component lipopolysaccharide (LPS) is both an important virulence factor and a major immunogen. Our previous studies determined the LPS structures expressed by different P. multocida strains and revealed that a number of strains belonging to different serovars contain the same LPS biosynthesis locus but express different LPS structures due to mutations within glycosyltransferase genes. In this study, we report the full LPS structure of the serovar 4 type strain, P1662, and reveal that it shares the same LPS outer core biosynthesis locus, L3, with the serovar 3 strains P1059 and Pm70. Using directed mutagenesis, the role of each glycosyltransferase gene in LPS outer core assembly was determined. LPS structural analysis of 23 Australian field isolates that contain the L3 locus revealed that at least six different LPS outer core structures can be produced as a result of mutations within the LPS glycosyltransferase genes. Moreover, some field isolates produce multiple but related LPS glycoforms simultaneously, and three LPS outer core structures are remarkably similar to the globo series of vertebrate glycosphingolipids. Our in-depth analysis showing the genetics and full range of P. multocida lipopolysaccharide structures will facilitate the improvement of typing systems and the prediction of the protective efficacy of vaccines.
doi:10.1128/JB.00779-13
PMCID: PMC3807493  PMID: 23974032
6.  Leptospiral LruA Is Required for Virulence and Modulates an Interaction with Mammalian Apolipoprotein AI 
Infection and Immunity  2013;81(10):3872-3879.
Leptospirosis is a worldwide zoonosis caused by spirochetes of the genus Leptospira. While understanding of pathogenesis remains limited, the development of mutagenesis in Leptospira has provided a powerful tool for identifying novel virulence factors. LruA is a lipoprotein that has been implicated in leptospiral uveitis as a target of the immune response. In this study, two lruA mutants, M754 and M765, generated by transposon mutagenesis from Leptospira interrogans serovar Manilae, were characterized. In M754, the transposon inserted in the middle of lruA, resulting in no detectable expression of LruA. In M765, the transposon inserted toward the 3′ end of the gene, resulting in expression of a truncated protein. LruA was demonstrated to be on the cell surface in M765 and the wild type (WT). M754, but not M765, was attenuated in a hamster model of acute infection. A search for differential binding to human serum proteins identified a serum protein of around 30 kDa bound to the wild type and the LruA deletion mutant (M754), but not to the LruA truncation mutant (M765). Two-dimensional separation of proteins from leptospiral cells incubated with guinea pig serum identified the 28-kDa apolipoprotein A-I (ApoA-I) as a major mammalian serum protein that binds Leptospira in vitro. Interestingly, M754 (with no detectable LruA) bound more ApoA-I than did the LruA-expressing strains Manilae wild type and M765. Our data thus identify LruA as a surface-exposed leptospiral virulence factor that contributes to leptospiral pathogenesis, possibly by modulating cellular interactions with serum protein ApoA-I.
doi:10.1128/IAI.01195-12
PMCID: PMC3811782  PMID: 23918777
7.  Precipitation of Iron on the Surface of Leptospira interrogans Is Associated with Mutation of the Stress Response Metalloprotease HtpX 
Applied and Environmental Microbiology  2013;79(15):4653-4660.
High concentrations of free metal ions in the environment can be detrimental to bacterial survival. However, bacteria utilize strategies, including the activation of stress response pathways and immobilizing chemical elements on their surface, to limit this toxicity. In this study, we characterized LA4131, the HtpX-like M48 metalloprotease from Leptospira interrogans, with a putative role in bacterial stress response and membrane homeostasis. Growth of the la4131 transposon mutant strain (L522) in 360 μM FeSO4 (10-fold the normal in vitro concentration) resulted in the production of an amorphous iron precipitate. Atomic force microscopy and transmission electron microscopy analysis of the strain demonstrated that precipitate production was associated with the generation and release of outer membrane vesicles (OMVs) from the leptospiral surface. Transcriptional studies indicated that inactivation of la4131 resulted in altered expression of a subset of metal toxicity and stress response genes. Combining these findings, this report describes OMV production in response to environmental stressors and associates OMV production with the in vitro activity of an HtpX-like metalloprotease.
doi:10.1128/AEM.01097-13
PMCID: PMC3719529  PMID: 23709510
8.  Leptospiral Outer Membrane Protein LipL41 Is Not Essential for Acute Leptospirosis but Requires a Small Chaperone Protein, Lep, for Stable Expression 
Infection and Immunity  2013;81(8):2768-2776.
Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.
doi:10.1128/IAI.00531-13
PMCID: PMC3719587  PMID: 23690405
9.  Neisseria gonorrhoeae Modulates Iron-Limiting Innate Immune Defenses in Macrophages 
PLoS ONE  2014;9(1):e87688.
Neisseria gonorrhoeae is a strict human pathogen that causes the sexually transmitted infection termed gonorrhea. The gonococcus can survive extracellularly and intracellularly, but in both environments the bacteria must acquire iron from host proteins for survival. However, upon infection the host uses a defensive response by limiting the bioavailability of iron by a number of mechanisms including the enhanced expression of hepcidin, the master iron-regulating hormone, which reduces iron uptake from the gut and retains iron in macrophages. The host also secretes the antibacterial protein NGAL, which sequesters bacterial siderophores and therefore inhibits bacterial growth. To learn whether intracellular gonococci can subvert this defensive response, we examined expression of host genes that encode proteins involved in modulating levels of intracellular iron. We found that N. gonorrhoeae can survive in association (tightly adherent and intracellular) with monocytes and macrophages and upregulates a panel of its iron-responsive genes in this environment. We also found that gonococcal infection of human monocytes or murine macrophages resulted in the upregulation of hepcidin, NGAL, and NRAMP1 as well as downregulation of the expression of the gene encoding the short chain 3-hydroxybutyrate dehydrogenase (BDH2); BDH2 catalyzes the production of the mammalian siderophore 2,5-DHBA involved in chelating and detoxifying iron. Based on these findings, we propose that N. gonorrhoeae can subvert the iron-limiting innate immune defenses to facilitate iron acquisition and intracellular survival.
doi:10.1371/journal.pone.0087688
PMCID: PMC3905030  PMID: 24489950
10.  Species-Specificity of the BamA Component of the Bacterial Outer Membrane Protein-Assembly Machinery 
PLoS ONE  2013;8(12):e85799.
The BamA protein is the key component of the Bam complex, the assembly machinery for outer membrane proteins (OMP) in gram-negative bacteria. We previously demonstrated that BamA recognizes its OMP substrates in a species-specific manner in vitro. In this work, we further studied species specificity in vivo by testing the functioning of BamA homologs of the proteobacteria Neisseria meningitidis, Neisseria gonorrhoeae, Bordetella pertussis, Burkholderia mallei, and Escherichia coli in E. coli and in N. meningitidis. We found that no BamA functioned in another species than the authentic one, except for N. gonorrhoeae BamA, which fully complemented a N. meningitidis bamA mutant. E. coli BamA was not assembled into the N. meningitidis outer membrane. In contrast, the N. meningitidis BamA protein was assembled into the outer membrane of E. coli to a significant extent and also associated with BamD, an essential accessory lipoprotein of the Bam complex.Various chimeras comprising swapped N-terminal periplasmic and C-terminal membrane-embedded domains of N. meningitidis and E. coli BamA proteins were also not functional in either host, although some of them were inserted in the OM suggesting that the two domains of BamA need to be compatible in order to function. Furthermore, conformational analysis of chimeric proteins provided evidence for a 16-stranded β-barrel conformation of the membrane-embedded domain of BamA.
doi:10.1371/journal.pone.0085799
PMCID: PMC3869937  PMID: 24376896
11.  LipL41, a Hemin Binding Protein from Leptospira santarosai serovar Shermani 
PLoS ONE  2013;8(12):e83246.
Leptospirosis is one of the most widespread zoonotic diseases in the world. It is caused by the pathogen Leptospira that results in multiple-organ failure, in particular of the kidney. Outer membrane lipoprotein is the suspected virulence factor of Leptospira. In Leptospira spp LipL41 is one major lipoprotein and is highly conserved. Previous study suggests that LipL41 bears hemin-binding ability and might play a possible role in iron regulation and storage. However, the characterization of hemin-binding ability of LipL41 is still unclear. Here the hemin-binding ability of LipL41 was examined, yielding a Kd = 0.59 ± 0.14 μM. Two possible heme regulatory motifs (HRMs), C[P/S], were found in LipL41 at 140Cys-Ser and 220Cys-Pro. The mutation study indicates that Cys140 and Cys220 might be cooperatively involved in hemin binding. A supramolecular assembly of LipL41 was determined by transmission electron microscopy. The LipL41 oligomer consists of 36 molecules and folds as a double-layered particle. At the C-terminus of LipL41, there are two tetratricopeptide repeats (TPRs), which might be involved in the protein-protein interaction of the supramolecular assembly.
doi:10.1371/journal.pone.0083246
PMCID: PMC3861479  PMID: 24349474
12.  The Fimbrial Protein FlfA from Gallibacterium anatis Is a Virulence Factor and Vaccine Candidate 
Infection and Immunity  2013;81(6):1964-1973.
The Gram-negative bacterium Gallibacterium anatis is a major cause of salpingitis and peritonitis in egg-laying chickens, leading to decreased egg production worldwide. Widespread multidrug resistance largely prevents treatment of this organism using traditional antimicrobial agents, while antigenic diversity hampers disease prevention by classical vaccines. Thus, insight into its pathogenesis and knowledge about important virulence factors is urgently required. A key event during the colonization and invasion of mucosal surfaces is adherence, and recently, at least three F17-like fimbrial gene clusters were identified in the genomes of several G. anatis strains. The objective of this study was to characterize the putative F17-like fimbrial subunit protein FlfA from G. anatis 12656-12 and determine its importance for virulence. In vitro expression and surface exposure of FlfA was demonstrated by flow cytometry and immunofluorescence microscopy. The predicted function of FlfA as a fimbrial subunit protein was confirmed by immunogold electron microscopy. An flfA deletion mutant (ΔflfA) was generated in G. anatis 12656-12, and importantly, this mutant was significantly attenuated in the natural chicken host. Furthermore, protection against G. anatis 12656-12 could be induced by immunizing chickens with recombinant FlfA. Finally, in vitro expression of FlfA homologs was observed in a genetically diverse set of G. anatis strains, suggesting the potential of FlfA as a serotype-independent vaccine candidate This is the first study describing a fimbrial subunit protein of G. anatis with a clear potential as a vaccine antigen.
doi:10.1128/IAI.00059-13
PMCID: PMC3676021  PMID: 23509151
13.  Identification of Novel Vaccine Candidates against Multidrug-Resistant Acinetobacter baumannii 
PLoS ONE  2013;8(10):e77631.
Acinetobacter baumannii is an emerging opportunistic bacterium associated with nosocomial infections in intensive care units. The alarming increase in infections caused by A. baumannii is strongly associated with enhanced resistance to antibiotics, in particular carbapenems. This, together with the lack of a licensed vaccine, has translated into significant economic, logistic and health impacts to health care facilities. In this study, we combined reverse vaccinology and proteomics to identify surface-exposed and secreted antigens from A. baumannii. Using in silico prediction tools and comparative genome analysis in combination with in vitro proteomic approaches, we identified 42 antigens that could be used as potential vaccine targets. Considering the paucity of effective antibiotics available to treat multidrug-resistant A. baumannii infections, these vaccine targets may serve as a framework for the development of a broadly protective multi-component vaccine, an outcome that would have a major impact on the burden of A. baumannii infections in intensive care units across the globe.
doi:10.1371/journal.pone.0077631
PMCID: PMC3792912  PMID: 24116234
14.  Cell surface hydrophobicity of colistin-susceptible versus -resistant Acinetobacter baumannii determined by contact angles: methodological considerations and implications 
Journal of applied microbiology  2012;113(4):940-951.
AIMS
Contact angle analysis of cell surface hydrophobicity (CSH) describes the tendency of a water droplet to spread across a lawn of filtered bacterial cells. Colistin-induced disruption of the Gram-negative outer membrane necessitates hydrophobic contacts with lipopolysaccharide (LPS). We aimed to characterize the CSH of Acinetobacter baumannii using contact angles, to provide insight into the mechanism of colistin resistance.
METHODS AND RESULTS
Contact angles were analysed for five paired colistin-susceptible and -resistant A. baumannii strains. Drainage of the water droplet through bacterial layers was demonstrated to influence results. Consequently, measurements were performed 0.66-sec after droplet deposition. Colistin-resistant cells exhibited lower contact angles (38.8±2.8° to 46.8±1.3°) compared to their paired-susceptible strains (40.7±3.0° to 48.0±1.4°; ANOVA; p<0.05). Contact angles increased at stationary phase (50.3±2.9° to 61.5±2.5° and 47.4±2.0° to 50.8±3.2°, susceptible and resistant, respectively, ANOVA; p<0.05), and in response to colistin 32-mgL−1 exposure (44.5±1.5° to 50.6±2.8° and 43.5±2.2° to 48.0±2.2°, susceptible and resistant, respectively; ANOVA; p<0.05). Analysis of complemented strains constructed with an intact lpxA gene, or empty vector, highlighted the contribution of LPS to CSH.
CONCLUSIONS
Compositional outer-membrane variations likely account for CSH differences between A. baumannii phenotypes, which influence the hydrophobic colistin-bacterium interaction.
SIGNIFICANCE AND IMPACT OF STUDY
Important insight into the mechanism of colistin resistance has been provided. Greater consideration of contact angle mehodology is nescessary to ensure accurate analyses are performed.
doi:10.1111/j.1365-2672.2012.05337.x
PMCID: PMC3434258  PMID: 22574702
Antimicrobials; Lipopolysaccharide; Mechanism of Action
15.  Characterization of the Kingella kingae Polysaccharide Capsule and Exopolysaccharide 
PLoS ONE  2013;8(9):e75409.
Recent evidence indicates that Kingella kingae produces a polysaccharide capsule. In an effort to determine the composition and structure of this polysaccharide capsule, in the current study we purified capsular material from the surface of K. kingae strain 269–492 variant KK01 using acidic conditions to release the capsule and a series of steps to remove DNA, RNA, and protein. Analysis of the resulting material by gas chromatography and mass spectrometry revealed N-acetyl galactosamine (GalNAc), 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo), and galactose (Gal). Further analysis by NMR demonstrated two distinct polysaccharides, one consisting of GalNAc and Kdo with the structure →3)-β-GalpNAc-(1→5)-β-Kdop-(2→ and the other containing galactose alone with the structure →5)-β-Galf-(1→. Disruption of the ctrA gene required for surface localization of the K. kingae polysaccharide capsule resulted in elimination of GalNAc and Kdo but had no effect on the presence of Gal in bacterial surface extracts. In contrast, deletion of the pamABCDE locus involved in production of a reported galactan exopolysaccharide eliminated Gal but had no effect on the presence of GalNAc and Kdo in surface extracts. Disruption of ctrA and deletion of pamABCDE resulted in a loss of all carbohydrates in surface extracts. These results establish that K. kingae strain KK01 produces a polysaccharide capsule with the structure →3)-β-GalpNAc-(1→5)-β-Kdop-(2→ and a separate exopolysaccharide with the structure →5)-β-Galf-(1→. The polysaccharide capsule and the exopolysaccharide require distinct genetic loci for surface localization.
doi:10.1371/journal.pone.0075409
PMCID: PMC3787102  PMID: 24098695
16.  Lipopolysaccharide-Deficient Acinetobacter baumannii Shows Altered Signaling through Host Toll-Like Receptors and Increased Susceptibility to the Host Antimicrobial Peptide LL-37 
Infection and Immunity  2013;81(3):684-689.
Infections caused by multidrug-resistant Acinetobacter baumannii have emerged as a serious global health problem. We have shown previously that A. baumannii can become resistant to the last-line antibiotic colistin via the loss of lipopolysaccharide (LPS), including the lipid A anchor, from the outer membrane (J. H. Moffatt, M. Harper, P. Harrison, J. D. Hale, E. Vinogradov, T. Seemann, R. Henry, B. Crane, F. St. Michael, A. D. Cox, B. Adler, R. L. Nation, J. Li, and J. D. Boyce, Antimicrob. Agents Chemother. 54:4971–4977, 2010). Here, we show how these LPS-deficient bacteria interact with components of the host innate immune system. LPS-deficient A. baumannii stimulated 2- to 4-fold lower levels of NF-κB activation and tumor necrosis factor alpha (TNF-α) secretion from immortalized murine macrophages, but it still elicited low levels of TNF-α secretion via a Toll-like receptor 2-dependent mechanism. Furthermore, we show that while LPS-deficient A. baumannii was not altered in its resistance to human serum, it showed increased susceptibility to the human antimicrobial peptide LL-37. Thus, LPS-deficient, colistin-resistant A. baumannii shows significantly altered activation of the host innate immune inflammatory response.
doi:10.1128/IAI.01362-12
PMCID: PMC3584870  PMID: 23250952
17.  Mechanical signals as anabolic agents in bone 
Nature reviews. Rheumatology  2010;6(1):50-59.
Aging and a sedentary lifestyle conspire to reduce bone quantity and quality, decrease muscle mass and strength, and undermine postural stability, culminating in an elevated risk of skeletal fracture. Concurrently, a marked reduction in the available bone-marrow-derived population of mesenchymal stem cells (MSCs) jeopardizes the regenerative potential that is critical to recovery from musculoskeletal injury and disease. A potential way to combat the deterioration involves harnessing the sensitivity of bone to mechanical signals, which is crucial in defining, maintaining and recovering bone mass. To effectively utilize mechanical signals in the clinic as a non-drug-based intervention for osteoporosis, it is essential to identify the components of the mechanical challenge that are critical to the anabolic process. Large, intense challenges to the skeleton are generally presumed to be the most osteogenic, but brief exposure to mechanical signals of high frequency and extremely low intensity, several orders of magnitude below those that arise during strenuous activity, have been shown to provide a significant anabolic stimulus to bone. Along with positively influencing osteoblast and osteocyte activity, these low-magnitude mechanical signals bias MSC differentiation towards osteoblastogenesis and away from adipogenesis. Mechanical targeting of the bone marrow stem-cell pool might, therefore, represent a novel, drug-free means of slowing the age-related decline of the musculoskeletal system.
doi:10.1038/nrrheum.2009.239
PMCID: PMC3743048  PMID: 20046206
18.  Evaluation of a Salmonella Vectored Vaccine Expressing Mycobacterium avium Subsp. paratuberculosis Antigens Against Challenge in a Goat Model 
PLoS ONE  2013;8(8):e70171.
Johnes disease (JD), caused by Mycobacterium avium subsp paratuberculosis (MAP), occurs worldwide as chronic granulomatous enteritis of domestic and wild ruminants. To develop a cost effective vaccine, in a previous study we constructed an attenuated Salmonella strain that expressed a fusion product made up of partial fragments of MAP antigens (Ag85A, Ag85B and SOD) that imparted protection against challenge in a mouse model. In the current study we evaluated the differential immune response and protective efficacy of the Sal-Ag vaccine against challenge in a goat model as compared to the live attenuated vaccine MAP316F. PBMCs from goats vaccinated with Sal-Ag and challenged with MAP generated significantly lower levels of IFN-γ, following in vitro stimulation with either Antigen-mix or PPD jhonin, than PBMC from MAP316F vaccinated animals. Flow cytometric analysis showed the increase in IFN-γ correlated with a significantly higher level of proliferation of CD4, CD8 and γδT cells and an increased expression of CD25 and CD45R0 in MAP316F vaccinated animals as compared to control animals. Evaluation of a range of cytokines involved in Th1, Th2, Treg, and Th17 immune responses by quantitative PCR showed low levels of expression of Th1 (IFN-γ, IL-2, IL-12) and proinflammatory cytokines (IL-6, IL-8, IL-18, TNF-α) in the Sal-Ag immunized group. Significant levels of Th2 and anti-inflammatory cytokines transcripts (IL-4, IL-10, IL-13, TGF-β) were expressed but their level was low and with a pattern similar to the control group. Over all, Sal-Ag vaccine imparted partial protection that limited colonization in tissues of some animals upon challenge with wild type MAP but not to the level achieved with MAP316F. In conclusion, the data indicates that Sal-Ag vaccine induced only a low level of protective immunity that failed to limit the colonization of MAP in infected animals. Hence the Sal-Ag vaccine needs further refinement to increase its efficacy.
doi:10.1371/journal.pone.0070171
PMCID: PMC3739776  PMID: 23950909
19.  Elevated Carbon Monoxide in the Exhaled Breath of Mice during a Systemic Bacterial Infection 
PLoS ONE  2013;8(7):e69802.
Blood is the specimen of choice for most laboratory tests for diagnosis and disease monitoring. Sampling exhaled breath is a noninvasive alternative to phlebotomy and has the potential for real-time monitoring at the bedside. Improved instrumentation has advanced breath analysis for several gaseous compounds from humans. However, application to small animal models of diseases and physiology has been limited. To extend breath analysis to mice, we crafted a means for collecting nose-only breath samples from groups and individual animals who were awake. Samples were subjected to gas chromatography and mass spectrometry procedures developed for highly sensitive analysis of trace volatile organic compounds (VOCs) in the atmosphere. We evaluated the system with experimental systemic infections of severe combined immunodeficiency Mus musculus with the bacterium Borrelia hermsii. Infected mice developed bacterial densities of ∼107 per ml of blood by day 4 or 5 and in comparison to uninfected controls had hepatosplenomegaly and elevations of both inflammatory and anti-inflammatory cytokines. While 12 samples from individual infected mice on days 4 and 5 and 6 samples from uninfected mice did not significantly differ for 72 different VOCs, carbon monoxide (CO) was elevated in samples from infected mice, with a mean (95% confidence limits) effect size of 4.2 (2.8–5.6), when differences in CO2 in the breath were taken into account. Normalized CO values declined to the uninfected range after one day of treatment with the antibiotic ceftriaxone. Strongly correlated with CO in the breath were levels of heme oxygenase-1 protein in serum and HMOX1 transcripts in whole blood. These results (i) provide further evidence of the informativeness of CO concentration in the exhaled breath during systemic infection and inflammation, and (ii) encourage evaluation of this noninvasive analytic approach in other various other rodent models of infection and for utility in clinical management.
doi:10.1371/journal.pone.0069802
PMCID: PMC3729689  PMID: 23936104
20.  Toward Repurposing Ciclopirox as an Antibiotic against Drug-Resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae 
PLoS ONE  2013;8(7):e69646.
Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5–15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ΔgalU, ΔgalE, ΔrfaI, or ΔrfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety profiles, novel target(s), and efficacy, make ciclopirox a promising potential antimicrobial agent to use against multidrug-resistant problematic gram-negative pathogens.
doi:10.1371/journal.pone.0069646
PMCID: PMC3720592  PMID: 23936064
21.  Beclin 1 Is Required for Starvation-Enhanced, but Not Rapamycin-Enhanced, LC3-Associated Phagocytosis of Burkholderia pseudomallei in RAW 264.7 Cells 
Infection and Immunity  2013;81(1):271-277.
LC3-associated phagocytosis (LAP) of Burkholderia pseudomallei by murine macrophage (RAW 264.7) cells is an intracellular innate defense mechanism. Beclin 1, a protein with several roles in autophagic processes, is known to be recruited to phagosomal membranes as a very early event in LAP. We sought to determine whether knockdown of Beclin 1 by small interfering RNA (siRNA) would affect recruitment of LC3 and subsequent LAP of infecting B. pseudomallei. Both starvation and rapamycin treatment can induce Beclin 1-dependent autophagy. Therefore, we analyzed the consequences of Beclin 1 knockdown for LAP in infected cells that had been either starved or treated with rapamycin by determining the levels of bacterial colocalization with LC3 and intracellular survival. Concurrently, we confirmed the location of bacteria as either contained in phagosomes or free in the cytoplasm. We found that both rapamycin and starvation treatment enhanced LAP of B. pseudomallei but that the rapamycin response is Beclin 1 independent whereas the starvation response is Beclin 1 dependent.
doi:10.1128/IAI.00834-12
PMCID: PMC3536138  PMID: 23115045
22.  Leptospira interrogans Catalase Is Required for Resistance to H2O2 and for Virulence 
Infection and Immunity  2012;80(11):3892-3899.
Pathogenic Leptospira spp. are likely to encounter higher concentrations of reactive oxygen species induced by the host innate immune response. In this study, we characterized Leptospira interrogans catalase (KatE), the only annotated catalase found within pathogenic Leptospira species, by assessing its role in resistance to H2O2-induced oxidative stress and during infection in hamsters. Pathogenic L. interrogans bacteria had a 50-fold-higher survival rate under H2O2-induced oxidative stress than did saprophytic L. biflexa bacteria, and this was predominantly catalase dependent. We also characterized KatE, the only annotated catalase found within pathogenic Leptospira species. Catalase assays performed with recombinant KatE confirmed specific catalase activity, while protein fractionation experiments localized KatE to the bacterial periplasmic space. The insertional inactivation of katE in pathogenic Leptospira bacteria drastically diminished leptospiral viability in the presence of extracellular H2O2 and reduced virulence in an acute-infection model. Combined, these results suggest that L. interrogans KatE confers in vivo resistance to reactive oxygen species induced by the host innate immune response.
doi:10.1128/IAI.00466-12
PMCID: PMC3486042  PMID: 22927050
23.  MtrR Control of a Transcriptional Regulatory Pathway in Neisseria meningitidis That Influences Expression of a Gene (nadA) Encoding a Vaccine Candidate 
PLoS ONE  2013;8(2):e56097.
The surface-exposed NadA adhesin produced by a subset of capsular serogroup B strains of Neisseria meningitidis is currently being considered as a vaccine candidate to prevent invasive disease caused by a hypervirulent lineage of meningococci. Levels of NadA are known to be controlled by both transcriptional regulatory factors and a component of human saliva, 4-hydroxyphenylacetic acid. Herein, we confirmed the capacity of a DNA-binding protein termed FarR to negatively control nadA expression. We also found that a known transcriptional regulator of farR in N. gonorrhoeae termed MtrR can have a negative regulatory impact on farR and nadA expression, especially when over-expressed. MtrR-mediated repression of nadA was found to be direct, and its binding to a target DNA sequence containing the nadA promoter influenced formation and/or stability of FarR::nadA complexes. The complexity of the multi-layered regulation of nadA uncovered during this investigation suggests that N. meningitidis modulates NadA adhesin protein levels for the purpose of interacting with host cells yet avoiding antibody directed against surface exposed epitopes.
doi:10.1371/journal.pone.0056097
PMCID: PMC3568044  PMID: 23409129
24.  Identification of Shigella flexneri IcsA Residues Affecting Interaction with N-WASP, and Evidence for IcsA-IcsA Co-Operative Interaction 
PLoS ONE  2013;8(2):e55152.
The Shigella flexneri IcsA (VirG) protein is a polarly distributed outer membrane protein that is a fundamental virulence factor which interacts with neural Wiskott-Aldrich syndrome protein (N-WASP). The activated N-WASP then activates the Arp2/3 complex which initiates de novo actin nucleation and polymerisation to form F-actin comet tails and allows bacterial cell-to-cell spreading. In a previous study, IcsA was found to have three N-WASP interacting regions (IRs): IR I (aa 185–312), IR II (aa 330–382) and IR III (aa 508–730). The aim of this study was to more clearly define N-WASP interacting regions II and III by site-directed mutagenesis of specific amino acids. Mutant IcsA proteins were expressed in both smooth lipopolysaccharide (S-LPS) and rough LPS (R-LPS) S. flexneri strains and characterised for IcsA production level, N-WASP recruitment and F-actin comet tail formation. We have successfully identified new amino acids involved in N-WASP recruitment within different N-WASP interacting regions, and report for the first time using co-expression of mutant IcsA proteins, that N-WASP activation involves interactions with different regions on different IcsA molecules as shown by Arp3 recruitment. In addition, our findings suggest that autochaperone (AC) mutant protein production was not rescued by another AC region provided in trans, differing to that reported for two other autotransporters, PrtS and BrkA autotransporters.
doi:10.1371/journal.pone.0055152
PMCID: PMC3566212  PMID: 23405119
25.  Application of protein purification methods for the enrichment of a cytotoxin from Campylobacter jejuni 
BMC Microbiology  2012;12:303.
Background
Campylobater jejuni, a major foodborne diarrhoeal pathogen is reported to produce a number of cytotoxins of which only a cytolethal distending toxin (CDT) has been characterised so far. One or more additional cytotoxins other than CDT, including a Chinese hamster ovary (CHO) cell active, Vero cell inactive cytotoxin, may mediate inflammatory diarrhoea. Our objective was to develop a method to enrich and thus partially characterise this cytotoxin, as a pathway to the eventual identification and characterisation of the toxin.
Results
A number of biochemical methods including cation- and anion-exchange chromatography were evaluated to enrich the cytotoxin from a cell lysate of a known cytotoxin-producing C. jejuni, C31. The cytotoxin in crude lysate was initially prepared by size-exclusion desalting and then subjected to high pressure liquid chromatography (HPLC) ion-exchange fractionation. One pooled fraction (pool B) was cytotoxic for CHO cells equivalent to crude toxin (tissue culture infectivity dose 50 [TCID50] of 1–2 μg/ml). The proteins of pool B were identified by mass spectrometry (MS) after separation by SDS-PAGE and trypsin digestion. Also, pool B was directly digested with trypsin and then subjected to liquid chromatography tandem mass spectrometry (LCMS) analysis for identification of lesser abundant proteins in the fraction. A total of 41 proteins were found in the fraction, which included enzymes involved in metabolic and transport functions. Eighteen non-cytoplasmic proteins including 2 major antigenic peptide proteins (PEB2 and PEB3) and 3 proteins of unknown function were also identified in the screen. Cytotoxicity in pool B was trypsin-sensitive indicating its protein nature. The cytotoxic activity was heat-stable to 50°C, and partially inactivated at 60-70°C. The pool B fraction also induced fluid accumulation in the adult rabbit ileal loop assay with cytotoxicity for mucosa confirming the presence of the cytotoxin.
Conclusions
We report the enrichment and partial purification of C. jejuni cytotoxin by HPLC ion-exchange chromatography. Further purification may be achieved using additional complementary chromatographic techniques. A short-list of six candidate cytotoxin proteins was identified using an LCMS screen of pool B. Successful isolation of the cytotoxin will initiate steps for the determination of the role of this cytotoxin in the pathogenesis of C. jejuni diarrhoea.
doi:10.1186/1471-2180-12-303
PMCID: PMC3541203  PMID: 23259594
C. jejuni; Cytotoxin; Biochemical methods; HPLC ion-exchange chromatography

Results 1-25 (113)