PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (327)
 

Clipboard (0)
None

Select a Filter Below

Journals
Year of Publication
1.  Utility of genetically modified mice for understanding the neurobiology of substance use disorders 
Human genetics  2011;131(6):941-957.
Advances in our ability to modify the mouse genome have enhanced our understanding of the genetic and neurobiological mechanisms contributing to addiction-related behaviors underlying substance use and abuse. These experimentally induced manipulations permit greater spatial and temporal specificity for modification of gene expression within specific cellular populations and during select developmental time periods. In this review, we consider the current mouse genetic model systems that have been employed to understand aspects of addiction and highlight significant conceptual advances achieved related to substance use and abuse. The mouse models reviewed herein include conventional knockout and knockin, conditional knockout, transgenic, inducible transgenic, mice suitable for optogenetic control of discrete neuronal populations, and phenotype-selected mice. By establishing a reciprocal investigatory relationship between genetic findings in humans and genomic manipulations in mice, a far better understanding of the discrete neuromechanisms underlying addiction can be achieved, which is likely to provide a strong foundation for developing and validating novel therapeutics for the treatment of substance abuse disorders.
doi:10.1007/s00439-011-1129-z
PMCID: PMC3977433  PMID: 22190154
2.  Dissecting direct and indirect genetic effects on chronic obstructive pulmonary disease (COPD) susceptibility 
Human genetics  2013;132(4):431-441.
Cigarette smoking is the major environmental risk factor for chronic obstructive pulmonary disease (COPD). Genome-wide association studies have provided compelling associations for three loci with COPD. In this study, we aimed to estimate direct, i.e., independent from smoking, and indirect effects of those loci on COPD development using mediation analysis. We included a total of 3,424 COPD cases and 1,872 unaffected controls with data on two smoking-related phenotypes: lifetime average smoking intensity and cumulative exposure to tobacco smoke (pack years). Our analysis revealed that effects of two linked variants (rs1051730 and rs8034191) in the AGPHD1/CHRNA3 cluster on COPD development are significantly, yet not entirely, mediated by the smoking-related phenotypes. Approximately 30 % of the total effect of variants in the AGPHD1/CHRNA3 cluster on COPD development was mediated by pack years. Simultaneous analysis of modestly (r2 = 0.21) linked markers in CHRNA3 and IREB2 revealed that an even larger (~42 %) proportion of the total effect of the CHRNA3 locus on COPD was mediated by pack years after adjustment for an IREB2 single nucleotide polymorphism. This study confirms the existence of direct effects of the AGPHD1/CHRNA3, IREB2, FAM13A and HHIP loci on COPD development. While the association of the AGPHD1/CHRNA3 locus with COPD is significantly mediated by smoking-related phenotypes, IREB2 appears to affect COPD independently of smoking.
doi:10.1007/s00439-012-1262-3
PMCID: PMC3600068  PMID: 23299987
3.  Linkage analysis of a large African family segregating stuttering suggests polygenic inheritance 
Human genetics  2012;132(4):385-396.
We describe a pedigree of 71 individuals from the Republic of Cameroon in which at least 33 individuals have a clinical diagnosis of stuttering. The high concentration of stuttering individuals suggests that the pedigree either contains a single highly penetrant gene variant or that assortative mating led to multiple stuttering-associated variants being transmitted in different parts of the pedigree. No single locus displayed significant linkage to stuttering in initial genome-wide scans with microsatellite and SNP markers. By dividing the pedigree into five sub-pedigrees, we found evidence for linkage to previously reported loci on 3q and 15q, and to novel loci on 2p, 3p, 14q, and a different region of 15q. Using the two-locus mode of Superlink, we showed that combining the recessive locus on 2p and a single-locus additive representation of the 15q loci is sufficient to achieve a two-locus score over 6 on the entire pedigree. For this 2p+15q analysis, we show LOD scores ranging from 4.69 to 6.57, and the scores are sensitive to which marker is chosen for 15q. Our findings provide strong evidence for linkage at several loci.
doi:10.1007/s00439-012-1252-5
PMCID: PMC3600087  PMID: 23239121
4.  Genetic variants associated with VLDL, LDL and HDL particle size differ with race/ethnicity 
Human genetics  2012;132(4):405-413.
Background
Specific constellations of lipoprotein particle features, reflected as differences in mean lipoprotein particle diameters, are associated with risk of insulin resistance (IR) and cardiovascular disease (CVD). The associations of lipid profiles with disease risk differ by race/ethnicity, the reason for this is not clear. We aimed to examine whether there were additional genetic differences between racial / ethnic groups on lipoprotein profile.
Methods and results
Genotypes were assessed using the Affymetrix 6.0 array in 817 related Caucasian participants of the Genetics of Lipid Lowering Drugs and Diet Network (GOLDN). Association analysis was conducted on fasting mean particle diameters using linear models, adjusted for age, sex and study center as fixed effects, and pedigree as a random effect. Replication of associations reaching P<1.97 * 10−05 (the level at which we achieved at least 80% power to replicate SNP-phenotype associations) was conducted in the Caucasian population of the Multi-Ethnic Study of Atherosclerosis (MESA; N=2430). Variants which replicated across both Caucasian populations were subsequently tested for association in the African-American (N=1594), Chinese (N=758) and Hispanic (N=1422) populations of MESA. Variants in the APOB gene region were significantly associated with mean VLDL diameter in GOLDN, and in the Caucasian and Hispanic populations of MESA, while variation in the hepatic lipase (LIPC) gene was associated with mean HDL diameter in both Caucasians populations only.
Conclusions
Our findings suggest the genetic underpinnings of mean lipoprotein diameter differ by race/ethnicity. As lipoprotein diameters are modifiable, this may lead new strategies to modify lipoprotein profiles during the reduction of IR that are sensitive to race / ethnicity.
doi:10.1007/s00439-012-1256-1
PMCID: PMC3600091  PMID: 23263444
Lipoprotein size; race / ethnicity; ApoB; Hepatic Lipase; NMR
5.  Germline Mutations of Regulator of Telomere Elongation Helicase 1, RTEL1, In Dyskeratosis Congenita 
Human genetics  2013;132(4):473-480.
Dyskeratosis congenita (DC) is an inherited bone marrow failure and cancer predisposition syndrome caused by aberrant telomere biology. The classic triad of dysplastic nails, abnormal skin pigmentation, and oral leukoplakia is diagnostic of DC, but substantial clinical heterogeneity exists; the clinically severe variant Hoyeraal Hreidarsson syndrome (HH) also includes cerebellar hypoplasia, severe immunodeficiency, enteropathy, and intrauterine growth retardation. Germline mutations in telomere biology genes account for approximately one-half of known DC families.
Using exome sequencing, we identified mutations in RTEL1, a helicase with critical telomeric functions, in two families with HH. In the first family, two siblings with HH and very short telomeres inherited a premature stop codon from their mother who has short telomeres. The proband from the second family has HH and inherited a premature stop codon in RTEL1 from his father and a missense mutation from his mother, who also has short telomeres. Additionally, inheritance of only the missense mutation led to very short telomeres in the proband’s brother. Targeted sequencing identified a different RTEL1 missense mutation in one additional DC proband who has bone marrow failure and short telomeres. Both missense mutations affect the helicase domain of RTEL1, and three in silico prediction algorithms suggest that they are likely deleterious. The nonsense mutations both cause truncation of the RTEL1 protein, resulting in loss of the PIP box; this may abrogate an important protein-protein interaction. These findings implicate a new telomere biology gene, RTEL1, in the etiology of DC.
doi:10.1007/s00439-013-1265-8
PMCID: PMC3600110  PMID: 23329068
Dyskeratosis congenita; telomere; bone marrow failure; RTEL1; exome sequencing
6.  Ordered subset linkage analysis based on admixture proportion identifies new linkage evidence for alcohol dependence in African-Americans 
Human genetics  2012;132(4):397-403.
Genetic heterogeneity could reduce the power of linkage analysis to detect risk loci for complex traits such as alcohol dependence (AD). Previously, we performed a genomewide linkage analysis for AD in African-Americans (AAs) (Gelernter et al., 2009). The power of that linkage analysis could have been reduced by the presence of genetic heterogeneity owing to differences in admixture among AA families. We hypothesized that by examining a study sample whose genetic ancestry was more homogeneous we could increase the power to detect linkage. To test this hypothesis, we performed ordered subset linkage analysis (OSA) in 384 AA families using admixture proportion as a covariate to identify a more homogeneous subset of families and determine whether there is increased evidence for linkage with AD. Statistically significant increases in lod scores in subsets relative to the overall sample were identified on chromosomes 4 (P=0.0001), 12 (P=0.021), 15 (P=0.026) and 22 (P=0.0069). In a subset of 44 families with African ancestry proportions ranging from 0.858 to 0.996, we observed a genomewide significant linkage at 180 cM on chromosome 4 (lod=4.24, pointwise P<0.00001, empirical genomewide P=0.008). A promising candidate gene located there, GLRA3, which encodes a subunit of the glycine neurotransmitter receptor. Our results demonstrate that admixture proportion can be used as a covariate to reduce genetic heterogeneity and enhance the detection of linkage for AD in an admixed population such as AAs. This approach could be applied to any linkage analysis for complex traits conducted in an admixed population.
doi:10.1007/s00439-012-1255-2
PMCID: PMC3751162  PMID: 23239122
linkage; ordered subset linkage analysis; genetic heterogeneity; alcohol dependence; admixture
7.  X chromosome inactivation in human and mouse pluripotent stem cells 
Human genetics  2011;130(2):217-222.
Since the groundbreaking hypothesis of X chromosome inactivation (XCI) proposed by Mary Lyon over 50 years ago, a great amount of knowledge has been gained regarding this essential dosage compensation mechanism in female cells. For the mammalian system, most of the mechanistic studies of XCI have so far been investigated in the mouse model system, but recently, a number of interesting XCI studies have been extended to human pluripotent stem cells, including both embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Emerging data indicate that XCI in hESCs and hiPSCs is much more complicated than that of their mouse counterparts. XCI in human pluripotent stem cells is not as stable and is subject to environmental influences and epi-genetic regulation in vitro. This mini-review highlights the key differences in XCI between mouse and human stem cells with a greater emphasis placed on the understanding of the epigenetic regulation of XCI in human stem cells.
doi:10.1007/s00439-011-1038-1
PMCID: PMC3965368  PMID: 21678064
8.  Promoter variants in the MSMB gene associated with prostate cancer regulate MSMB/NCOA4 fusion transcripts 
Human genetics  2012;131(9):1453-1466.
Beta-microseminoprotein (MSP)/MSMB is an immunoglobulin superfamily protein synthesized by prostate epithelial cells and secreted into seminal plasma. Variants in the promoter of the MSMB gene have been associated with the risk of prostate cancer (PCa) in several independent genome-wide association studies. Both MSMB and an adjacent gene, NCOA4, are subjected to transcriptional control via androgen response elements. The gene product of NCOA4 interacts directly with the androgen receptor as a co-activator to enhance AR transcriptional activity. Here, we provide evidence for the expression of full-length MSMB-NCOA4 fusion transcripts regulated by the MSMB promoter. The predominant MSMB-NCOA4 transcript arises by fusion of the 5′UTR and exons 1–2 of the MSMB pre-mRNA, with exons 2–10 of the NCOA4 premRNA, producing a stable fusion protein, comprising the essential domains of NCOA4. Analysis of the splice sites of this transcript shows an unusually strong splice acceptor at NCOA4 exon 2 and the presence of Alu repeats flanking the exons potentially involved in the splicing event. Transfection experiments using deletion clones of the promoter coupled with luciferase reporter assays define a core MSMB promoter element located between –27 and –236 of the gene, and a negative regulatory element immediately upstream of the start codon. Computational network analysis reveals that the MSMB gene is functionally connected to NCOA4 and the androgen receptor signaling pathway. The data provide an example of how GWAS-associated variants may have multiple genetic and epigenetic effects.
doi:10.1007/s00439-012-1182-2
PMCID: PMC3956317  PMID: 22661295
9.  Variants in GATA4 Are a Rare Cause of Familial and Sporadic Congenital Diaphragmatic Hernia 
Human genetics  2012;132(3):285-292.
Congenital diaphragmatic hernia (CDH) is characterized by incomplete formation of the diaphragm, occurring as either an isolated defect or in association with other anomalies. Genetic factors including aneuploidies and copy number variants are important in the pathogenesis of many cases of CDH, but few single genes have been definitively implicated in human CDH. In this study, we used whole exome sequencing (WES) to identify a paternally inherited novel missense GATA4 variant (c. 754C>T, p. R252W) in a familial case of CDH with incomplete penetrance. Phenotypic characterization of the family included magnetic resonance imaging (MRI) of the chest and abdomen demonstrating asymptomatic defects in the diaphragm in the two “unaffected” missense variant carriers. Screening 96 additional CDH patients identified a de novo heterozygous GATA4 variant (c.848G>A; p.R283H) in a non-isolated CDH patient. In summary, GATA4 is implicated in both familial and sporadic CDH, and our data suggests that WES may be a powerful tool to discover rare variants for CDH.
doi:10.1007/s00439-012-1249-0
PMCID: PMC3570587  PMID: 23138528
Congenital diaphragmatic Hernia (CDH); whole exome sequencing (WES); incomplete penetrance; missense variant; GATA4
10.  Altered patterns of multiple recombinant events are associated with nondisjunction of chromosome 21 
Human genetics  2011;131(7):1039-1046.
We have previously examined characteristics of maternal chromosomes 21 that exhibited a single recombination on 21q and proposed that certain recombination configurations are risk factors for either meiosis I (MI) or meiosis II (MII) nondisjunction. The primary goal of this analysis was to examine characteristics of maternal chromosomes 21 that exhibited multiple recombinant events on 21q to determine whether additional risk factors or mechanisms are suggested. In order to identify the origin (maternal or paternal) and stage (MI or MII) of the meiotic errors, as well as placement of recombination, we genotyped over 1,500 SNPs on 21q. Our analyses included 785 maternal MI errors, 87 of which exhibited two recombinations on 21q, and 283 maternal MII errors, 81 of which exhibited two recombinations on 21q. Among MI cases, the average location of the distal recombination was proximal to that of normally segregating chromosomes 21 (35.28 vs. 38.86 Mb), a different pattern than that seen for single events and one that suggests an association with genomic features. For MII errors, the most proximal recombination was closer to the centromere than that on normally segregating chromosomes 21 and this proximity was associated with increasing maternal age. This pattern is same as that seen among MII errors that exhibit only one recombination. These findings are important as they help us better understand mechanisms that may underlie both age-related and nonage-related meiotic chromosome mal-segregation.
doi:10.1007/s00439-011-1121-7
PMCID: PMC3925977  PMID: 22160426
11.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response
12.  Power analysis for case–control association studies of samples with known family histories 
Human genetics  2010;127(6):699-704.
Genome-wide case–control studies have been widely used to identify genetic variants that predispose to human diseases. Such studies are powerful in detecting common genetic variants with moderate effects, but quickly lose power as allele frequency and genotype relative risk decrease. Because patients with one or more affected relatives are more likely to inherit disease-predisposing alleles of a genetic disease than patients without family histories of the disease, sampling patients with affected relatives almost always increases the frequency of disease predisposing alleles in cases and improves the power of case–control association studies. This paper evaluates the power of case–control studies that select cases and/or controls according to their family histories of disease. Our results showed that this study design can dramatically increase the power of a case–control association study for a wide range of disease types. Because each additional affected relative of a patient reduces the required sample size roughly by a pair of case and control, inclusion of cases with affected relatives can dramatically decrease the required sample size and thus the cost of such studies.
doi:10.1007/s00439-010-0824-5
PMCID: PMC3914772  PMID: 20383776
13.  Suggestion of GLYAT gene underlying variation of bone size and body lean mass as revealed by a bivariate genome-wide association study 
Human genetics  2012;132(2):189-199.
Objective
Bone and muscle, two major tissue types of musculoskeletal system, have strong genetic determination. Abnormality in bone and/or muscle may cause musculoskeletal diseases such as osteoporosis and sarcopenia. Bone size phenotypes (BSPs), such as hip bone size (HBS), appendicular bone size (ABS), are genetically correlated with body lean mass (mainly muscle mass). However, the specific genes shared by these phenotypes are largely unknown. In this study, we aimed to identify the specific genes with pleiotropic effects on BSPs and appendicular lean mass (ALM).
Methods
We performed a bivariate genome-wide association study (GWAS) by analyzing ~690,000 SNPs in 1,627 unrelated Han Chinese adults (802 males and 825 females) followed by a replication study in 2,286 unrelated US Caucasians (558 males and 1728 females).
Results
We identified 14 interesting single nucleotide polymorphisms (SNPs) that may contribute to variation of both BSPs and ALM, with p values <10−6 in discovery stage. Among them, the association of three SNPs (rs2507838, rs7116722, and rs11826261) in/near GLYAT (glycine-N-acyltransferase) gene was replicated in US Caucasians, with p values ranging from 1.89×10−3 to 3.71×10−4 for ALM-ABS, from 5.14×10−3 to 1.11×10−2 for ALM-HBS, respectively. Meta-analyses yielded stronger association signals for rs2507838, rs7116722, and rs11826261, with pooled p values of 1.68×10−8, 7.94×10−8, 6.80×10−8 for ALB-ABS and 1.22×10−4, 9.85×10−5, 3.96×10−4 for ALM-HBS, respectively. Haplotype allele ATA based on these three SNPs were also associated with ALM-HBS and ALM-ABS in both discovery and replication samples. Interestingly, GLYAT was previously found to be essential to glucose metabolism and energy metabolism, suggesting the gene’s dual role in both bone development and muscle growth.
Conclusions
Our findings, together with the prior biological evidence, suggest the importance of GLYAT gene in co-regulation of bone phenotypes and body lean mass.
doi:10.1007/s00439-012-1236-5
PMCID: PMC3682481  PMID: 23108985
Bivariate GWAS; Bone size; Lean mass; GLYAT
14.  Genome-wide study identifies two loci associated with lung function decline in mild to moderate COPD 
Human genetics  2012;132(1):79-90.
Rationale
Accelerated lung function decline is a key COPD phenotype; however its genetic control remains largely unknown.
Methods
We performed a genome-wide association study using the Illumina Human660W-Quad v.1_A BeadChip. Generalized estimation equations were used to assess genetic contributions to lung function decline over a 5-year period in 4,048 European-American Lung Health Study participants with largely mild COPD. Genotype imputation was performed using reference HapMap II data. To validate regions meeting genome-wide significance, replication of top SNPs was attempted in independent cohorts. Three genes (TMEM26, ANK3 and FOXA1) within the regions of interest were selected for tissue expression studies using immunohistochemistry.
Measurements and Main Results
Two intergenic SNPs (rs10761570, rs7911302) on chromosome 10 and one SNP on chromosome 14 (rs177852) met genome-wide significance after Bonferroni. Further support for the chromosome 10 region was obtained by imputation, the most significantly associated imputed SNPs (rs10761571, rs7896712) being flanked by observed markers rs10761570 and rs7911302. Results were not replicated in four general population cohorts or a smaller cohort of subjects with moderate to severe COPD; however, we show novel expression of genes near regions of significantly associated SNPS, including TMEM26 and FOXA1 in airway epithelium and lung parenchyma, and ANK3 in alveolar macrophages. Levels of expression were associated with lung function and COPD status.
Conclusions
We identified two novel regions associated with lung function decline in mild COPD. Genes within these regions were expressed in relevant lung cells and their expression related to airflow limitation suggesting they may represent novel candidate genes for COPD susceptibility.
doi:10.1007/s00439-012-1219-6
PMCID: PMC3536920  PMID: 22986903
COPD; lung function decline; GWAS; genome wide association; genes; polymorphisms
15.  A genome-wide association study of breast cancer in women of African ancestry 
Human genetics  2012;132(1):39-48.
Genome-wide association studies (GWAS) in diverse populations are needed to reveal variants that are more common and/or limited to defined populations. We conducted a GWAS of breast cancer in women of African ancestry, with genotyping of > 1,000,000 SNPs in 3,153 African American cases and 2,831 controls, and replication testing of the top 66 associations in an additional 3,607 breast cancer cases and 11,330 controls of African ancestry. Two of the 66 SNPs replicated (p < 0.05) in stage 2, which reached statistical significance levels of 10−6 and 10−5 in the stage 1 and 2 combined analysis (rs4322600 at chromosome 14q31: OR = 1.18, p = 4.3×10−6; rs10510333 at chromosome 3p26: OR = 1.15, p = 1.5×10−5). These suggestive risk loci have not been identified in previous GWAS in other populations and will need to be examined in additional samples. Identification of novel risk variants for breast cancer in women of African ancestry will demand testing of a substantially larger set of markers from stage 1 in a larger replication sample.
doi:10.1007/s00439-012-1214-y
PMCID: PMC3749077  PMID: 22923054
GWAS; breast cancer; African ancestry; common genetic variation
16.  Investigation of genetic risk factors for chronic adult diseases for association with preterm birth 
Human genetics  2012;132(1):10.1007/s00439-012-1223-x.
Preterm birth (PTB) is the leading cause of infant mortality. PTB pathophysiology overlaps with those of adult cardiovascular, immune and metabolic disorders (CIMD), with mechanisms including inflammation, immunotolerance, thrombosis, and nutrient metabolism. Whereas many genetic factors for CIMD have been identified, progress in PTB has lagged. We hypothesized that highly validated genetic risk factors for CIMD may also be associated with PTB. We conducted case–control study of four female cohorts with spontaneous PTB (n = 673) versus term (n = 1119). Of 35 SNPs genotyped, there were 13 statistically significant associations (P<0.05), which were more than expected (binomial test; P = 0.02). In US White (307 cases/342 controls), the G allele of HLA-DQA1 (A/G) rs9272346 was protective for PTBin the initial discovery cohort (P = 0.02; OR = 0.65; 95 % CI 0.46, 0.94). This protective association replicated (P = 0.02; OR = 0.85; 95 % CI 0.75, 0.97) nominally in the Danish Cohort (883 cases, 959 controls), but lost significance upon multiple testing correction. We observed more statistically significant associations than expected, suggesting that chance is an unlikely explanation for one or more of the associations. Particularly, a protective association of the G allele of HLA-DQA1 was found in two independent cohorts, and in previous studies, this same allele was found to protect against type-1-diabetes (meta-analysis P value 5.52 × 10−219). Previous investigations have implicated HLA phenotypic variation in recurrent fetal loss and in chronic chorioamnionitis. Given the limited sample size in his study, we suggest larger studies to further investigate possible HLA genetic involvement in PTB.
doi:10.1007/s00439-012-1223-x
PMCID: PMC3864772  PMID: 22972380
17.  Genetic variant in TP63 on locus 3q28 is associated with risk of lung adenocarcinoma among never-smoking females in Asia 
Hosgood, H. Dean | Wang, Wen-Chang | Hong, Yun-Chul | Wang, Jiu-Cun | Chen, Kexin | Chang, I-Shou | Chen, Chien-Jen | Lu, Daru | Yin, Zhihua | Wu, Chen | Zheng, Wei | Qian, Biyun | Park, Jae Yong | Kim, Yeul Hong | Chatterjee, Nilanjan | Chen, Ying | Chang, Gee-Chen | Hsiao, Chin-Fu | Yeager, Meredith | Tsai, Ying-Huang | Wei, Hu | Kim, Young Tae | Wu, Wei | Zhao, Zhenhong | Chow, Wong-Ho | Zhu, Xiaoling | Lo, Yen-Li | Sung, Sook Whan | Chen, Kuan-Yu | Yuenger, Jeff | Kim, Joo Hyun | Huang, Liming | Chen, Ying-Hsiang | Gao, Yu-Tang | Kim, Jin Hee | Huang, Ming-Shyan | Jung, Tae Hoon | Caporaso, Neil | Zhao, Xueying | Huan, Zhang | Yu, Dianke | Kim, Chang Ho | Su, Wu-Chou | Shu, Xiao-Ou | Kim, In-San | Bassig, Bryan | Chen, Yuh-Min | Cha, Sung Ick | Tan, Wen | Chen, Hongyan | Yang, Tsung-Ying | Sung, Jae Sook | Wang, Chih-Liang | Li, Xuelian | Park, Kyong Hwa | Yu, Chong-Jen | Ryu, Jeong-Seon | Xiang, Yongbing | Hutchinson, Amy | Kim, Jun Suk | Cai, Qiuyin | Landi, Maria Teresa | Lee, Kyoung-Mu | Hung, Jen-Yu | Park, Ju-Yeon | Tucker, Margaret | Lin, Chien-Chung | Ren, Yangwu | Perng, Reury-Perng | Chen, Chih-Yi | Jin, Li | Chen, Kun-Chieh | Li, Yao-Jen | Chiu, Yu-Fang | Tsai, Fang-Yu | Yang, Pan-Chyr | Fraumeni, Joseph F. | Seow, Adeline | Lin, Dongxin | Zhou, Baosen | Chanock, Stephen | Hsiung, Chao Agnes | Rothman, Nathaniel | Lan, Qing
Human genetics  2012;131(7):10.1007/s00439-012-1144-8.
A recent genome-wide association study (GWAS) of subjects from Japan and South Korea reported a novel association between the TP63 locus on chromosome 3q28 and risk of lung adenocarcinoma (p = 7.3 × 10−12); however, this association did not achieve genome-wide significance (p < 10−7) among never-smoking males or females. To determine if this association with lung cancer risk is independent of tobacco use, we genotyped the TP63 SNPs reported by the previous GWAS (rs10937405 and rs4488809) in 3,467 never-smoking female lung cancer cases and 3,787 never-smoking female controls from 10 studies conducted in Taiwan, Mainland China, South Korea, and Singapore. Genetic variation in rs10937405 was associated with risk of lung adenocarcinoma [n = 2,529 cases; p = 7.1 × 10−8; allelic risk = 0.80, 95% confidence interval (CI) = 0.74–0.87]. There was also evidence of association with squamous cell carcinoma of the lung (n = 302 cases; p = 0.037; allelic risk = 0.82, 95% CI = 0.67–0.99). Our findings provide strong evidence that genetic variation in TP63 is associated with the risk of lung adenocarcinoma among Asian females in the absence of tobacco smoking.
doi:10.1007/s00439-012-1144-8
PMCID: PMC3875137  PMID: 22367405
18.  Pharmacogenetics of smoking cessation: role of nicotine target and metabolism genes 
Human genetics  2012;10.1007/s00439-012-1143-9.
Many smokers attempt to quit smoking but few are successful in the long term. The heritability of nicotine addiction and smoking relapse have been documented, and research is focused on identifying specific genetic influences on the ability to quit smoking and response to specific medications. Research in genetically modified cell lines and mice has identified nicotine acetylcholine receptor subtypes that mediate the pharmacological and behavioral effects of nicotine sensitivity and withdrawal. Human genetic association studies have identified single nucleotide polymorphisms (SNPs) in genes encoding nicotine acetylcholine receptor subunits and nicotine metabolizing enzymes that influence smoking cessation phenotypes. There is initial promising evidence for a role in smoking cessation for SNPs in the β2 and α5/α3/β4 nAChR subunit genes; however, effects are small and not consistently replicated. There are reproducible and clinically significant associations of genotypic and phenotypic measures of CYP2A6 enzyme activity and nicotine metabolic rate with smoking cessation as well as response to nicotine replacement therapies and bupropion. Prospective clinical trials to identify associations of genetic variants and gene–gene interactions on smoking cessation are needed to generate the evidence base for both medication development and targeted therapy approaches based on genotype.
doi:10.1007/s00439-012-1143-9
PMCID: PMC3864572  PMID: 22290489
19.  Zebrafish: A Model for the Study of Addiction Genetics 
Human genetics  2011;131(6):10.1007/s00439-011-1128-0.
Drug abuse and dependence are multifaceted disorders with complex genetic underpinnings. Identifying specific genetic correlates is challenging and may be more readily accomplished by defining endophenotypes specific for addictive disorders. Symptoms and syndromes, including acute drug response, consumption, preference, and withdrawal, are potential endophenotypes characterizing addiction that have been investigated using model organisms. We present a review of major genes involved in serotonergic, dopaminergic, GABAergic, and adrenoreceptor signaling that are considered to be directly involved in nicotine, opioid, cannabinoid, and ethanol use and dependence. The zebrafish genome encodes likely homologs of the vast majority of these loci. We also review the known expression patterns of these genes in zebrafish. The information presented in this review provides support for the use of zebrafish as a viable model for studying genetic factors related to drug addiction. Expansion of investigations into drug response using model organisms holds the potential to advance our understanding of drug response and addiction in humans.
doi:10.1007/s00439-011-1128-0
PMCID: PMC3860818  PMID: 22207143
Addiction; Zebrafish; Endophenotype; Genetics; Genomics; Behavior
20.  Human subtelomeric copy number gains suggest a DNA replication mechanism for formation: beyond breakage – fusion - bridge for telomere stabilization 
Human genetics  2012;131(12):1895-1910.
Constitutional deletions of distal 9q34 encompassing the EHMT1 (euchromatic histone methyltransferase 1) gene, or loss-of-function point mutations in EHMT1, are associated with the 9q34.3 microdeletion, also known as Kleefstra syndrome [MIM#610253]. We now report further evidence for genomic instability of the subtelomeric 9q34.3 region as evidenced by copy number gains of this genomic interval that include duplications, triplications, derivative chromosomes and complex rearrangements. Comparisons between the observed shared clinical features and molecular analyses in 20 subjects suggest that increased dosage of EHMT1 may be responsible for the neurodevelopmental impairment, speech delay, and autism spectrum disorders revealing the dosage sensitivity of yet another chromatin remodeling protein in human disease. Five patients had 9q34 genomic abnormalities resulting in complex deletion-duplication or duplication-triplication rearrangements; such complex triplications were also observed in six other subtelomeric intervals. Based on the specific structure of these complex genomic rearrangements (CGR) a DNA replication mechanism is proposed confirming recent findings in C elegans telomere healing. The end-replication challenges of subtelomeric genomic intervals may make them particularly prone to rearrangements generated by errors in DNA replication.
doi:10.1007/s00439-012-1216-9
PMCID: PMC3493700  PMID: 22890305
chromosome 9q34.3; duplication; triplication; molecular mechanism; subtelomeric rearrangements; genomic disorder; telomere stabilization
21.  Mutation Risk Associated with Paternal and Maternal Age in a Cohort of Retinoblastoma Survivors 
Human genetics  2011;131(7):10.1007/s00439-011-1126-2.
Autosomal dominant conditions are known to be associated with advanced paternal age, and it has been suggested that retinoblastoma (Rb) also exhibits a paternal age effect due to the paternal origin of most new germline RB1 mutations. To further our understanding of the association of parental age and risk of de novo germline Rb mutations, we evaluated the effect of parental age in a cohort of Rb survivors in the United States. A cohort of 262 retinoblastoma patients was retrospectively identified at one institution, and telephone interviews were conducted with parents of 160 survivors (65.3%). We built two sets of hierarchical stepwise logistic regression models to detect an increased odds of a de novo germline mutation related to older parental age compared to sporadic and familial Rb. The modeling strategy evaluated effects of continuous increasing maternal and paternal age and five-year age increases adjusted for the age of the other parent. Mean maternal ages for patients with de novo germline mutations and sporadic Rb were similar (28.3 and 28.5 respectively) as were mean paternal ages (31.9 and 31.2 respectively), and all were significantly higher than the weighted general U.S. population means. In contrast, maternal and paternal ages for familial Rb did not differ significantly from the weighted U.S. general population means. Although we noted no significant differences between mean maternal and paternal ages between each of the three Rb classification groups, we found increased odds of having a de novo germline mutation for each five-year increase in paternal age, but these findings were not statistically significant (de novo versus sporadic ORs: 30-34 = 1.65 [0.69-4], ≥35 = 1.34 [0.54-3.3]; de novo versus familial ORs: 30-34 = 2.82 [0.95 – 8.4], ≥35 = 1.61 [0.57-4.6]). Our study suggests a weak paternal age effect for Rb resulting from de novo germline mutations consistent with the paternal origin of most of these mutations.
doi:10.1007/s00439-011-1126-2
PMCID: PMC3841976  PMID: 22203219
22.  MicroRNA-related sequence variations in human cancers 
Human Genetics  2013;133:463-469.
MicroRNAs are emerging as a most promising field in basic and translational research, explaining the pathogenesis of numerous human diseases and providing excellent tools for their management. This review considers the effects of microRNA sequence variations and their implication in pathogenesis and predisposition to human cancers. Although the role of microRNAs still remains to be elucidated, functional, and populational studies indicate that microRNA variants are important factors underlying the process of carcinogenesis. Further understanding of the cellular and molecular basis of microRNA action will lead to the identification of their new target genes and microRNA-regulated pathways. As a consequence, novel models of cancer pathogenesis can be proposed, and serve as a basis for elucidation of new prognostic and diagnostic tools for human cancers.
doi:10.1007/s00439-013-1397-x
PMCID: PMC3953544  PMID: 24241281
23.  Novel neurodevelopmental information revealed in amniotic fluid supernatant transcripts from fetuses with trisomies 18 and 21 
Human genetics  2012;131(11):1751-1759.
Trisomies 18 and 21 are the two most common live born autosomal aneuploidies in humans. While the anatomic abnormalities in affected fetuses are well documented, the dysregulated biological pathways associated with the development of the aneuploid phenotype are less clear. Amniotic fluid (AF) cell-free RNA is a valuable source of biological information obtainable from live fetuses. In this study, we mined gene expression data previously produced by our group from mid-trimester AF supernatant samples. We identified the euploid, trisomy 18 and trisomy 21 AF transcriptomes, and analyzed them with a particular focus on the nervous system. We used multiple bioinformatics resources, including DAVID, Ingenuity Pathway Analysis, and the BioGPS Gene Expression Atlas. Our analyses confirmed that AF supernatant from aneuploid fetuses is enriched for nervous system gene expression and neurological disease pathways. Tissue analysis showed that fetal brain cortex and Cajal–Retzius cells were significantly enriched for genes contained in the AF transcriptomes. We also examined AF transcripts known to be dysregulated in aneuploid fetuses compared with euploid controls and identified several brain-specific transcripts among them. Many of these genes play critical roles in nervous system development. NEUROD2, which was downregulated in trisomy 18, induces neurogenic differentiation. SOX11, downregulated in trisomy 21, is a transcription factor that is essential for pan-neuronal protein expression and axonal growth of sensory neurons. Our results show that whole transcriptome analysis of cell-free RNA in AF from live pregnancies permits discovery of biomarkers of abnormal human neurodevelopment and advances our understanding of the pathophysiology of aneuploidy.
doi:10.1007/s00439-012-1195-x
PMCID: PMC3472090  PMID: 22752091
24.  Traditional and targeted exome sequencing reveals common, rare and novel functional deleterious variants in RET signaling complex in a cohort of living US patients with urinary tract malformations 
Human genetics  2012;131(11):1725-1738.
Signaling by the glial cell line-derived neurotrophic factor (GDNF)-RET receptor tyrosine kinase and SPRY1, a RET repressor, is essential for early urinary tract development. Individual or a combination of GDNF, RET and SPRY1 mutant alleles in mice cause renal malformations reminiscent of congenital anomalies of the kidney or urinary tract (CAKUT) in humans and distinct from renal agenesis phenotype in complete GDNF or RET null mice. We sequenced GDNF, SPRY1 and RET in 122 unrelated living CAKUT patients to discover deleterious mutations that cause CAKUT. Novel or rare deleterious mutations in GDNF or RET were found in 6 unrelated patients. A family with duplicated collecting system had a novel mutation, RETR831Q, which showed markedly decreased GDNF dependent MAPK activity. Two patients with RET-G691S polymorphism harbored additional rare non-synonymous variants GDNF-R93W and RET-R982C. The patient with double RET-G691S/R982C genotype had multiple defects including renal dysplasia, megaureters and cryptorchidism. Presence of both mutations were necessary to affect RET activity. Targeted whole exome and next-generation sequencing revealed a novel deleterious mutation G443D in GFRα1, the co-receptor for RET, in this patient. Pedigree analysis indicated that the GFRα1 mutation was inherited from the unaffected mother and the RET mutations from the unaffected father. Our studies indicate that 5% of living CAKUT patients harbor deleterious rare variants or novel mutations in GDNF-GFRα1-RET pathway. We provide evidence for the coexistence of deleterious rare and common variants in genes in the same pathway as a cause of CAKUT and discovered novel phenotypes associated with the RET pathway.
doi:10.1007/s00439-012-1181-3
PMCID: PMC3551468  PMID: 22729463
RET; CAKUT; kidney; exome; genetics; renal malformations
25.  Identification of germline genomic copy number variation in familial pancreatic cancer 
Human genetics  2012;131(9):10.1007/s00439-012-1183-1.
Adenocarcinoma of the pancreas is a significant cause of cancer mortality, and up to 10 % of cases appear to be familial. Heritable genomic copy number variants (CNVs) can modulate gene expression and predispose to disease. Here, we identify candidate predisposition genes for familial pancreatic cancer (FPC) by analyzing germline losses or gains present in one or more high-risk patients and absent in a large control group. A total of 120 FPC cases and 1,194 controls were genotyped on the Affymetrix 500K array, and 36 cases and 2,357 controls were genotyped on the Affymetrix 6.0 array. Detection of CNVs was performed by multiple computational algorithms and partially validated by quantitative PCR. We found no significant difference in the germline CNV profiles of cases and controls. A total of 93 non-redundant FPC-specific CNVs (53 losses and 40 gains) were identified in 50 cases, each CNV present in a single individual. FPC-specific CNVs overlapped the coding region of 88 RefSeq genes. Several of these genes have been reported to be differentially expressed and/or affected by copy number alterations in pancreatic adenocarcinoma. Further investigation in high-risk subjects may elucidate the role of one or more of these genes in genetic predisposition to pancreatic cancer.
doi:10.1007/s00439-012-1183-1
PMCID: PMC3808836  PMID: 22665139

Results 1-25 (327)