Hel308 is a superfamily 2 helicase conserved in eukaryotes and archaea. It is thought to function in the early stages of recombination following replication fork arrest, and has a specificity for removal of the lagging strand in model replication forks. A homologous helicase constitutes the N-terminal domain of human DNA polymerase Q. The Drosophila homologue mus301 is implicated in double strand break repair and meiotic recombination. We have solved the high-resolution crystal structure of Hel308 from the crenarchaeon Sulfolobus solfataricus, revealing a five-domain structure with a central pore lined with essential DNA binding residues. The fifth domain is shown to act as a molecular brake, clamping the ssDNA extruded through the central pore of the helicase structure to limit the enzyme’s helicase activity. This provides an elegant mechanism to tune the enzyme’s processivity to its functional role. Hel308 can displace streptavidin from a biotinylated DNA molecule, suggesting that one function of the enzyme may be in the removal of bound proteins at stalled replication forks and recombination intermediates.

Summary

The XPD helicase (Rad3 in Saccharomyces cerevisiae) is a component of transcription factor IIH (TFIIH), which functions in transcription initiation and Nucleotide Excision Repair in eukaryotes, catalysing DNA duplex opening localised to the transcription start site or site of DNA damage, respectively. XPD has a 5′ to 3′ polarity and the helicase activity is dependent on an iron-sulfur cluster binding domain, a feature that is conserved in related helicases such as FancJ. The xpd gene is the target of mutation in patients with xeroderma pigentosum, trichothiodystrophy and Cockayne’s syndrome, characterised by a wide spectrum of symptoms ranging from cancer susceptibility to neurological and developmental defects. The 2.25 Å crystal structure of XPD from the crenarchaeon Sulfolobus tokodaii, presented here together with detailed biochemical analyses, allows a molecular understanding of the structural basis for helicase activity and explains the phenotypes of xpd mutations in humans.

In eukarya and bacteria, lysine methylation is relatively rare and is catalysed by sequence-specific lysine methyltransferases that typically have only a single-protein target. Using RNA polymerase purified from the thermophilic crenarchaeum Sulfolobus solfataricus, we identified 21 methyllysines distributed across 9 subunits of the enzyme. The modified lysines were predominantly in α-helices and showed no conserved sequence context. A limited survey of the Thermoproteus tenax proteome revealed widespread modification with 52 methyllysines in 30 different proteins. These observations suggest the presence of an unusual lysine methyltransferase with relaxed specificity in the crenarchaea. Since lysine methylation is known to enhance protein thermostability, this may be an adaptation to a thermophilic lifestyle. The implications of this modification for studies and applications of recombinant crenarchaeal enzymes are discussed.

Archaeal chromatin proteins share molecular and functional similarities with both bacterial and eukaryotic chromatin proteins. These proteins play an important role in functionally organizing the genomic DNA into a compact nucleoid. Cren7 and Sul7 are two crenarchaeal nucleoid-associated proteins, which are structurally homologous, but not conserved at the sequence level. Co-crystal structures have shown that these two proteins induce a sharp bend on binding to DNA. In this study, we have investigated the architectural properties of these proteins using atomic force microscopy, molecular dynamics simulations and magnetic tweezers. We demonstrate that Cren7 and Sul7 both compact DNA molecules to a similar extent. Using a theoretical model, we quantify the number of individual proteins bound to the DNA as a function of protein concentration and show that forces up to 3.5 pN do not affect this binding. Moreover, we investigate the flexibility of the bending angle induced by Cren7 and Sul7 and show that the protein–DNA complexes differ in flexibility from analogous bacterial and eukaryotic DNA-bending proteins.

XPF is a structure-specific endonuclease that preferentially cleaves 3′ DNA flaps during a variety of repair processes. The crystal structure of a crenarchaeal XPF protein bound to a DNA duplex yielded insights into how XPF might recognise branched DNA structures, and recent kinetic data have demonstrated that the sliding clamp PCNA acts as an essential cofactor, possibly by allowing XPF to distort the DNA structure into a proper conformation for efficient cleavage to occur. Here, we investigate the solution structure of the 3′-flap substrate bound to XPF in the presence and absence of PCNA using intramolecular Förster resonance energy transfer (FRET). We demonstrate that recognition of the flap substrate by XPF involves major conformational changes of the DNA, including a 90° kink of the DNA duplex and organization of the single-stranded flap. In the presence of PCNA, there is a further substantial reorganization of the flap substrate bound to XPF, providing a structural basis for the observation that PCNA has an essential catalytic role in this system. The wider implications of these observations for the plethora of PCNA-dependent enzymes are discussed.

The Cas4 protein is one of the core CRISPR-associated (Cas) proteins implicated in the prokaryotic CRISPR system for antiviral defence. Cas4 is thought to play a role in the capture of new viral DNA sequences for incorporation into the host genome. No biochemical activity has been reported for Cas4, but it is predicted to include a RecB nuclease domain. We show here that Cas4 family proteins from the archaeon Sulfolobus solfataricus utilise four conserved cysteine residues to bind an iron-sulfur cluster in an arrangement reminiscent of the AddB nuclease of Bacillus subtilis. The Cas4 family protein Sso0001 is a 5′ to 3′ single stranded DNA exonuclease in vitro that is stalled by extrahelical DNA adducts. A role for Cas4 in DNA duplex strand resectioning to generate recombinogenic 3′ single stranded DNA overhangs is proposed. Comparison of the AddB structure with that of a related bacterial nuclease from Eubacterium rectales reveals that the iron-sulfur cluster can be replaced by a zinc ion without disrupting the protein structure, with implications for the evolution of iron-sulfur binding proteins.

Site-directed spin labeling and pulsed electron–electron double resonance (PELDOR or DEER) have previously been applied successfully to study the structure and dynamics of nucleic acids. Spin labeling nucleic acids at specific sites requires the covalent attachment of spin labels, which involves rather complicated and laborious chemical synthesis. Here, we use a noncovalent label strategy that bypasses the covalent labeling chemistry and show that the binding specificity and efficiency are large enough to enable PELDOR or DEER measurements in DNA duplexes and a DNA duplex bound to the Lac repressor protein. In addition, the rigidity of the label not only allows resolution of the structure and dynamics of oligonucleotides but also the determination of label orientation and protein-induced conformational changes. The results prove that this labeling strategy in combination with PELDOR has a great potential for studying both structure and dynamics of oligonucleotides and their complexes with various ligands.

Summary

The prokaryotic Clusters of Regularly Interspaced Palindromic Repeats (CRISPR) system utilizes genomically-encoded CRISPR RNA (crRNA), derived from invading viruses and incorporated into ribonucleoprotein complexes with CRISPR-associated (CAS) proteins, to target and degrade viral DNA or RNA on subsequent infection. RNA is targeted by the CMR complex. In Sulfolobus solfataricus, this complex is composed of seven CAS protein subunits (Cmr1-7) and carries a diverse “payload” of targeting crRNA. The crystal structure of Cmr7 and low resolution structure of the complex are presented. S. solfataricus CMR cleaves RNA targets in an endonucleolytic reaction at UA dinucleotides. This activity is dependent on the 8-nucleotide repeat-derived 5′ sequence in the crRNA, but not on the presence of a proto-spacer associated motif (PAM) in the target. Both target and guide RNAs can be cleaved, although a single molecule of guide RNA can support the degradation of multiple targets.

Summary

DNA recombinases (RecA in bacteria, Rad51 in eukarya and RadA in archaea) catalyse strand-exchange between homologous DNA molecules, the central reaction of homologous recombination, and are among the most conserved DNA repair proteins known. In bacteria, RecA is the sole protein responsible for this reaction, whereas, in eukaryotes, there are several RAD51 paralogs that cooperate to catalyse strand exchange. All archaea have at least one (and as many as four) RadA paralogs, but their function remains unclear. Here we show the three RadA paralogs encoded by the Sulfolobus solfataricus genome are expressed under normal growth conditions, and are not UV-inducible. We demonstrate that one of these proteins, Sso2452, which is representative of the large aRadC sub-family of archaeal RadA paralogs, functions as an ATPase that binds tightly to ssDNA. However, Sso2452 is not an active recombinase in vitro, and inhibits D-loop formation by RadA. We present the high-resolution crystal structure of Sso2452, which reveals key structural differences from the canonical RecA family recombinases that may explain its functional properties. The possible roles of the archaeal RadA paralogs in vivo are discussed.

Ranasmurfin is an unusual blue protein isolated from the nests of a Malaysian tree frog, Polypedates leucomystax,[1] showing the rich chemical diversity displayed by biomolecular foams. Many species of tropical frogs use foams to protect delicate eggs and developing embryos against environmental challenges. These nests act as miniature ecosystems containing a spectrum of novel proteins and other macromolecules with functions related to foam stabilization and adhesion, resistance to microbial degradation, predation, or dehydration, providing a biocompatible environment for embryonic development.Thisworkformspartofourwiderstudyofthe intriguing physical and chemical properties of biofoams as unusual examples of biological soft matter.[2]

DinG (damage inducible gene G) is a bacterial superfamily 2 helicase with 5′→3′ polarity. DinG is related to the XPD (xeroderma pigmentosum complementation group D) helicase family, and they have in common an FeS (iron–sulfur)-binding domain that is essential for the helicase activity. In the bacilli and clostridia, the DinG helicase has become fused with an N-terminal domain that is predicted to be an exonuclease. In the present paper we show that the DinG protein from Staphylococcus aureus lacks an FeS domain and is not a DNA helicase, although it retains DNA-dependent ATP hydrolysis activity. Instead, the enzyme is an active 3′→5′ exonuclease acting on single-stranded DNA and RNA substrates. The nuclease activity can be modulated by mutation of the ATP-binding cleft of the helicase domain, and is inhibited by ATP or ADP, suggesting a modified role for the inactive helicase domain in the control of the nuclease activity. By degrading rather than displacing RNA or DNA strands, the S. aureus DinG nuclease may accomplish the same function as the canonical DinG helicase.

The Rudiviridae are a family of rod-shaped archaeal viruses with covalently closed, linear double-stranded DNA (dsDNA) genomes. Their replication mechanisms remain obscure, although parallels have been drawn to the Poxviridae and other large cytoplasmic eukaryotic viruses. Here we report that a protein encoded in the 34-kbp genome of the rudivirus SIRV1 is a member of the replication initiator (Rep) superfamily of proteins, which initiate rolling-circle replication (RCR) of diverse viruses and plasmids. We show that SIRV Rep nicks the viral hairpin terminus, forming a covalent adduct between an active-site tyrosine and the 5′ end of the DNA, releasing a 3′ DNA end as a primer for DNA synthesis. The enzyme can also catalyze the joining reaction that is necessary to reseal the DNA hairpin and terminate replication. The dimeric structure points to a simple mechanism through which two closely positioned active sites, each with a single tyrosine residue, work in tandem to catalyze DNA nicking and joining. We propose a novel mechanism for rudivirus DNA replication, incorporating the first known example of a Rep protein that is not linked to RCR. The implications for Rep protein function and viral replication are discussed.

hSSB1 is a recently discovered single-stranded DNA binding protein that is essential for efficient repair of DNA double-strand breaks (DSBs) by the homologous recombination pathway. hSSB1 is required for the efficient recruitment of the MRN complex to sites of DSBs and for the efficient initiation of ATM dependent signalling. Here we explore the interplay between hSSB1 and MRN. We demonstrate that hSSB1 binds directly to NBS1, a component of the MRN complex, in a DNA damage independent manner. Consistent with the direct interaction, we observe that hSSB1 greatly stimulates the endo-nuclease activity of the MRN complex, a process that requires the C-terminal tail of hSSB1. Interestingly, analysis of two point mutations in NBS1, associated with Nijmegen breakage syndrome, revealed weaker binding to hSSB1, suggesting a possible disease mechanism.

hSSB1 is a newly discovered single-stranded DNA (ssDNA)-binding protein that is essential for efficient DNA double-strand break signalling through ATM. However, the mechanism by which hSSB1 functions to allow efficient signalling is unknown. Here, we show that hSSB1 is recruited rapidly to sites of double-strand DNA breaks (DSBs) in all interphase cells (G1, S and G2) independently of, CtIP, MDC1 and the MRN complex (Rad50, Mre11, NBS1). However expansion of hSSB1 from the DSB site requires the function of MRN. Strikingly, silencing of hSSB1 prevents foci formation as well as recruitment of MRN to sites of DSBs and leads to a subsequent defect in resection of DSBs as evident by defective RPA and ssDNA generation. Our data suggests that hSSB1 functions upstream of MRN to promote its recruitment at DSBs and is required for efficient resection of DSBs. These findings, together with previous work establish essential roles of hSSB1 in controlling ATM activation and activity, and subsequent DSB resection and homologous recombination (HR).

AcsD, an NRPS-independent siderophore synthetase, has been crystallized.

AcsD, a type A siderophore synthetase with a molecular weight of 71 140 Da from Pectobacterium chrysanthemi, has been expressed, purified and crystallized at 293 K. The protein crystallized in the primitive orthorhombic space group P212121, with unit-cell parameters a = 80.3, b = 95.7, c = 161.1 Å, α = β = γ = 90°. Systematic absences were consistent with space group P212121. A complete data set has been collected to 2.25 Å resolution on BM14 at the ESRF. Consideration of the likely solvent content suggested that the asymmetric unit contained two molecules. Gel-filtration experiments indicated that the protein was a dimer, although self-rotation analyses did not detect a convincing twofold symmetry axis in the asymmetric unit. The protein has no convincing sequence match to any known structure and thus solution is likely to require experimental phasing.

Archaea use a variety of small basic proteins to package their DNA. One of the most widespread and highly conserved is the Alba (Sso10b) protein. Alba interacts with both DNA and RNA in vitro, and we show in the present study that it binds more tightly to dsDNA (double-stranded DNA) than to either ssDNA (single-stranded DNA) or RNA. The Alba protein is dimeric in solution, and forms distinct ordered complexes with DNA that have been visualized by electron microscopy studies; these studies suggest that, on binding dsDNA, the protein forms extended helical protein fibres. An end-to-end association of consecutive Alba dimers is suggested by the presence of a dimer–dimer interface in crystal structures of Alba from several species, and by the strong conservation of the interface residues, centred on Arg59 and Phe60. In the present study we map perturbation of the polypeptide backbone of Alba upon binding to DNA and RNA by NMR, and demonstrate the central role of Phe60 in forming the dimer–dimer interface. Site-directed spin labelling and pulsed ESR are used to confirm that an end-to-end, dimer–dimer interaction forms in the presence of dsDNA.

Xeroderma pigmentosum factor D (XPD) is a 5′–3′ superfamily 2 helicase and the founding member of a family of DNA helicases with iron–sulphur cluster domains. As a component of transcription factor II H (TFIIH), XPD is involved in DNA unwinding during nucleotide excision repair (NER). Archaeal XPD is closely related in sequence to the eukaryal enzyme and the crystal structure of the archaeal enzyme has provided a molecular understanding of mutations causing xeroderma pigmentosum and trichothiodystrophy in humans. Consistent with a role in NER, we show that archaeal XPD can initiate unwinding from a DNA bubble structure, differentiating it from the related helicases FancJ and DinG. XPD was not stalled by substrates containing extrahelical fluorescein adducts, abasic sites nor a cyclobutane pyrimidine dimer, regardless of whether these modifications were placed on either the displaced or translocated strands. This suggests that DNA lesions repaired by NER may not present a barrier to XPD translocation in vivo, in contrast to some predictions. Preferential binding of a fluorescein-adducted oligonucleotide was observed, and XPD helicase activity was readily inhibited by both single- and double-stranded DNA binding proteins. These observations have several implications for the current understanding of the NER pathway.

Bacterial pathogens need to scavenge iron from their host for growth and proliferation during infection. They have evolved several strategies to do this, one being the biosynthesis and excretion of small, high-affinity iron chelators known as siderophores. The biosynthesis of siderophores is an important area of study, not only for potential therapeutic intervention, but also to illuminate new enzyme chemistries. Two general pathways for siderophore biosynthesis exist: the well-characterized nonribosomal peptide synthetase (NRPS)-dependent pathway and the NRPS-independent (NIS) pathway, which relies on a different family of sparsely-investigated synthetases. Here, we report structural and biochemical studies of AcsD from Pectobacterium (formerly Erwinia) chrysanthemi, a NIS synthetase involved in achromobactin biosynthesis. The structures of ATP and citrate complexes provide a mechanistic rationale for stereospecific formation of an enzyme-bound (3R)-citryl-adenylate, which reacts with L-serine to form a likely achromobactin precursor. AcsD is a novel acyl adenylate-forming enzyme with a new fold and chemical catalysis strategy.

Sar2676, a pantothenate synthetase with a molecular weight of 31 419 Da from methicillin-resistant Staphylococcus aureus, has been expressed, purified and crystallized at 293 K.

Sar2676, a pantothenate synthetase with a molecular weight of 31 419 Da from methicillin-resistant Staphylococcus aureus, has been expressed, purified and crystallized at 293 K. The protein crystallizes in a primitive triclinic lattice, with unit-cell parameters a = 45.3, b = 60.5, c = 117.6 Å, α = 87.2, β = 81.2, γ = 68.4°. A complete data set has been collected to 2.3 Å resolution at the ESRF. Consideration of the likely solvent content suggested the asymmetric unit to contain four molecules. This has been confirmed by molecular-replacement phasing calculations, which give a solution with four monomers using a monomer of pantothenate synthetase from Escherichia coli (PDB code 1iho), which is 41% identical to Sar2676, as a search model.

As part of work on S. aureus, the crystallization of Sar2028, a protein that is upregulated in MRSA, is reported.

Sar2028, an aspartate/tyrosine/phenylalanine pyridoxal-5′-phosphate-dependent aminotransferase with a molecular weight of 48 168 Da, was overexpressed in methicillin-resistant Staphylococcus aureus compared with a methicillin-sensitive strain. The protein was expressed in Escherichia coli, purified and crystallized. The protein crystallized in a primitive orthorhombic Laue group with unit-cell parameters a = 83.6, b = 91.3, c = 106.0 Å, α = β = γ = 90°. Analysis of the systematic absences along the three principal axes indicated the space group to be P212121. A complete data set was collected to 2.5 Å resolution.

The sliding clamp Proliferating Cell Nuclear Antigen (PCNA) functions as a recruiter and organizer of a wide variety of DNA modifying enzymes including nucleases, helicases, polymerases and glycosylases. The 5′-flap endonuclease Fen-1 is essential for Okazaki fragment processing in eukaryotes and archaea, and is targeted to the replication fork by PCNA. Crenarchaeal XPF, a 3′-flap endonuclease, is also stimulated by PCNA in vitro. Using a novel continuous fluorimetric assay, we demonstrate that PCNA activates these two nucleases by fundamentally different mechanisms. PCNA stimulates Fen-1 by increasing the enzyme's binding affinity for substrates, as suggested previously. However, PCNA activates XPF by increasing the catalytic rate constant by four orders of magnitude without affecting the KM. PCNA may function as a platform upon which XPF exerts force to distort DNA substrates, destabilizing the substrate and/or stabilizing the transition state structure. This suggests that PCNA can function directly in supporting catalysis as an essential cofactor in some circumstances, a new role for a protein that is generally assumed to perform a passive targeting and organizing function in molecular biology. This could provide a mechanism for the exquisite control of nuclease activity targeted to specific circumstances, such as replication forks or damaged DNA with pre-loaded PCNA.

TarO (http://www.compbio.dundee.ac.uk/taro) offers a single point of reference for key bioinformatics analyses relevant to selecting proteins or domains for study by structural biology techniques. The protein sequence is analysed by 17 algorithms and compared to 8 databases. TarO gathers putative homologues, including orthologues, and then obtains predictions of properties for these sequences including crystallisation propensity, protein disorder and post-translational modifications. Analyses are run on a high-performance computing cluster, the results integrated, stored in a database and accessed through a web-based user interface. Output is in tabulated format and in the form of an annotated multiple sequence alignment (MSA) that may be edited interactively in the program Jalview. TarO also simplifies the gathering of additional annotations via the Distributed Annotation System, both from the MSA in Jalview and through links to Dasty2. Routes to other information gateways are included, for example to relevant pages from UniProt, COG and the Conserved Domains Database. Open access to TarO is available from a guest account with private accounts for academic use available on request. Future development of TarO will include further analysis steps and integration with the Protein Information Management System (PIMS), a sister project in the BBSRC ‘Structural Proteomics of Rational Targets’ initiative

Background

The ubiquitous Rad50 and Mre11 proteins play a key role in many processes involved in the maintenance of genome integrity in Bacteria and Eucarya, but their function in the Archaea is presently unknown. We showed previously that in most hyperthermophilic archaea, rad50-mre11 genes are linked to nurA encoding both a single-strand endonuclease and a 5' to 3' exonuclease, and herA, encoding a bipolar DNA helicase which suggests the involvement of the four proteins in common molecular pathway(s). Since genetic tools for hyperthermophilic archaea are just emerging, we utilized immuno-detection approaches to get the first in vivo data on the role(s) of these proteins in the hyperthermophilic crenarchaeon Sulfolobus acidocaldarius.

Results

We first showed that S. acidocaldarius can repair DNA damage induced by high doses of gamma rays, and we performed a time course analysis of the total levels and sub-cellular partitioning of Rad50, Mre11, HerA and NurA along with the RadA recombinase in both control and irradiated cells. We found that during the exponential phase, all proteins are synthesized and display constant levels, but that all of them exhibit a different sub-cellular partitioning. Following gamma irradiation, both Mre11 and RadA are immediately recruited to DNA and remain DNA-bound in the course of DNA repair. Furthermore, we show by immuno-precipitation assays that Rad50, Mre11 and the HerA helicase interact altogether.

Conclusion

Our analyses strongly support that in Sulfolobus acidocaldarius, the Mre11 protein and the RadA recombinase might play an active role in the repair of DNA damage introduced by gamma rays and/or may act as DNA damage sensors. Moreover, our results demonstrate the functional interaction between Mre11, Rad50 and the HerA helicase and suggest that each protein play different roles when acting on its own or in association with its partners. This report provides the first in vivo evidence supporting the implication of the Mre11 protein in DNA repair processes in the Archaea and showing its interaction with both Rad50 and the HerA bipolar helicase. Further studies on the functional interactions between these proteins, the NurA nuclease and the RadA recombinase, will allow us to define their roles and mechanism of action.

The transcriptional response to UV irradiation was analyzed in two related crenarchaea, Sulfolobus solfataricus and Sulfolobus acidocaldarius, showing a clear response to DNA damage but no increase in the expression of DNA repair genes.

Background

DNA damage leads to cellular responses that include the increased expression of DNA repair genes, repression of DNA replication and alterations in cellular metabolism. Archaeal information processing pathways resemble those in eukaryotes, but archaeal damage response pathways remain poorly understood.

Results

We analyzed the transcriptional response to UV irradiation in two related crenarchaea, Sulfolobus solfataricus and Sulfolobus acidocaldarius. Sulfolobus species encounter high levels of DNA damage in nature, as they inhabit high temperature, aerobic environments and are exposed to sunlight. No increase in expression of DNA repair genes following UV irradiation was observed. There was, however, a clear transcriptional response, including repression of DNA replication and chromatin proteins. Differential effects on the expression of the three transcription factor B (tfb) genes hint at a mechanism for the modulation of transcriptional patterns in response to DNA damage. TFB3, which is strongly induced following UV irradiation, competes with TFB1 for binding to RNA polymerase in vitro, and may act as a repressor of transcription or an alternative transcription factor for certain promoters.

Conclusion

A clear response to DNA damage was observed, with down-regulation of the DNA replication machinery, changes in transcriptional regulatory proteins, and up-regulation of the biosynthetic enzymes for beta-carotene, which has UV protective properties, and proteins that detoxify reactive oxygen species. However, unlike eukaryotes and bacteria, there was no induction of DNA repair proteins in response to DNA damage, probably because these are expressed constitutively to deal with increased damage arising due to high growth temperatures.

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.