PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (54)
 

Clipboard (0)
None

Select a Filter Below

Year of Publication
more »
1.  UltraFast Doppler ultrasonography for hepatic vessels of liver recipients: preliminary experiences 
Ultrasonography  2014;34(1):58-65.
Purpose:
The purpose of this study was to investigate the value of UltraFast Doppler ultrasonography (US) for evaluating hepatic vessels in liver recipients.
Methods:
Thirty-nine liver Doppler US sessions were conducted in 20 liver recipients. Each session consisted of UltraFast and conventional liver Doppler US in a random order. We compared the velocities and phasicities of the hepatic vessels, duration of each Doppler study, occurrence of technical failures, and differences in clinical decisions.
Results:
The velocities and resistive index values of hepatic vessels showed a strong positive correlation between the two Doppler studies (mean R=0.806; range, 0.710 to 0.924). The phasicities of the hepatic vessels were the same in both Doppler US exams. With respect to the duration of the Doppler US exam, there was no significant difference between the UltraFast (251±99 seconds) and conventional (231±117 seconds) Doppler studies (P=0.306). In five poor breath-holders, in whom the duration of conventional Doppler US was longer, UltraFast Doppler US (272±157 seconds) required a shorter time than conventional Doppler US (381±133 seconds; P=0.005). There was no difference between the two techniques with respect to technical failures and clinical decisions.
Conclusion:
UltraFast Doppler US is clinically equivalent to conventional Doppler US with advantages for poor breath-holders during the post-liver transplantation work-up.
doi:10.14366/usg.14038
PMCID: PMC4282230  PMID: 25409662
Doppler ultrasonography; Liver; Liver transplantation
2.  Early Left Ventricular Dysfunction in Children after Hematopoietic Stem Cell Transplantation for Acute Leukemia: A Case Control Study Using Speckle Tracking Echocardiography 
Korean Circulation Journal  2015;45(1):51-58.
Background and Objectives
Cardiovascular complications are the leading cause of morbidity and mortality in childhood cancer survivors. Hematopoietic stem cell transplantation (HSCT) is a curable therapy for pediatric cancer. However, changes in cardiac function in children after HSCT are not well known. We assessed left ventricular (LV) function in children after HSCT using speckle tracking echocardiography (STE).
Subjects and Methods
Forty consecutive patients with median age of 11.9 years (range, 1.5-16 years) who received HSCT for acute leukemia and had comprehensive echocardiography before and after (median 9.2 month) HSCT were included in this study. The LV function parameters including conventional tissue Doppler imaging (TDI) and STE data were collected from pre- and post-HSCT echocardiography. These data were compared to those of 39 age-matched normal controls.
Results
Compared to normal controls, post HSCT patients had similar (p=0.06) LV ejection fraction. However, the following three LV function parameters were significantly decreased in post HSCT patients: rate-corrected velocity of circumferential fiber shortening (p=0.04), mitral inflow E velocity (p<0.001), and mitral septal annular E' velocity (p=0.03). The following four STE parameters were also significantly decreased in post HSCT patients: LV global circumferential systolic strain (p<0.01), strain rate (SR, p=0.01), circumferential diastolic SR (p<0.01), and longitudinal diastolic SR (p<0.001). There was no significant change in TDI or STE parameters after HSCT compared to pre-HSCT. Patients with anthracycline cumulative dose >400 mg/m2 showed significantly (p<0.05) lower circumferential systolic strain and circumferential diastolic SR.
Conclusion
Subclinical cardiac dysfunction is evident in children after HSCT. It might be associated with pre-HSCT anthracycline exposure with little effect of conditioning regimens. Serial monitoring of cardiac function is mandatory for all children following HSCT.
doi:10.4070/kcj.2015.45.1.51
PMCID: PMC4310980  PMID: 25653704
Childhood leukemia; Stem cell transplantation; Heart function; Speckle tracking; Echocardiography; Strain rate
3.  Portable high-intensity focused ultrasound system with 3D electronic steering, real-time cavitation monitoring, and 3D image reconstruction algorithms: a preclinical study in pigs 
Ultrasonography  2014;33(3):191-199.
Purpose:
The aim of this study was to evaluate the safety and accuracy of a new portable ultrasonography-guided high-intensity focused ultrasound (USg-HIFU) system with a 3-dimensional (3D) electronic steering transducer, a simultaneous ablation and imaging module, real-time cavitation monitoring, and 3D image reconstruction algorithms.
Methods:
To address the accuracy of the transducer, hydrophones in a water chamber were used to assess the generation of sonic fields. An animal study was also performed in five pigs by ablating in vivo thighs by single-point sonication (n=10) or volume sonication (n=10) and ex vivo kidneys by single-point sonication (n=10). Histological and statistical analyses were performed.
Results:
In the hydrophone study, peak voltages were detected within 1.0 mm from the targets on the y- and z-axes and within 2.0-mm intervals along the x-axis (z-axis, direction of ultrasound propagation; y- and x-axes, perpendicular to the direction of ultrasound propagation). Twenty-nine of 30 HIFU sessions successfully created ablations at the target. The in vivo porcine thigh study showed only a small discrepancy (width, 0.5-1.1 mm; length, 3.0 mm) between the planning ultrasonograms and the pathological specimens. Inordinate thermal damage was not observed in the adjacent tissues or sonic pathways in the in vivo thigh and ex vivo kidney studies.
Conclusion:
Our study suggests that this new USg-HIFU system may be a safe and accurate technique for ablating soft tissues and encapsulated organs.
doi:10.14366/usg.14008
PMCID: PMC4104954  PMID: 25038809
High-intensity focused ultrasound ablation; Ablation techniques; Animal research; Equipment and supplies
4.  Differentiating between Adenomyomatosis and Gallbladder Cancer: Revisiting a Comparative Study of High-Resolution Ultrasound, Multidetector CT, and MR Imaging 
Korean Journal of Radiology  2014;15(2):226-234.
Objective
To compare the diagnostic performance of high-resolution ultrasound (HRUS) with contrast-enhanced CT and contrast-enhanced magnetic resonance imaging (MRI) with MR cholangiopancreatography (MRCP) to differentiate between adenomyomatosis (ADM) and gallbladder cancer (GBCA).
Materials and Methods
Forty patients with surgically proven ADM (n = 13) or GBCA at stage T2 or lower (n = 27) who previously underwent preoperative HRUS, contrast-enhanced CT, and contrast-enhanced MRI with MRCP were retrospectively included in this study. According to the well-known diagnostic criteria, two reviewers independently analyzed the images from each modality separately with a five-point confidence scale. The interobserver agreement was calculated using weighted κ statistics. A receiver operating characteristic curve analysis was performed and the sensitivity, specificity, and accuracy were calculated for each modality when scores of 1 or 2 indicated ADM.
Results
The interobserver agreement between the two reviewers was good to excellent. The mean Az values for HRUS, multidetector CT (MDCT), and MRI were 0.959, 0.898, and 0.935, respectively, without any statistically significant differences between any of the modalities (p > 0.05). The mean sensitivity of MRI with MRCP (80.8%) was significantly higher than that of MDCT (50.0%) (p = 0.0215). However, the mean sensitivity of MRI with MRCP (80.8%) was not significantly different from that of HRUS (73.1%) (p > 0.05). The mean specificities and accuracies among the three modalities were not significantly different (p > 0.05).
Conclusion
High-resolution ultrasound and MRI with MRCP have comparable sensitivity and accuracy and MDCT has the lowest sensitivity and accuracy for the differentiation of ADM and GBCA.
doi:10.3348/kjr.2014.15.2.226
PMCID: PMC3955789  PMID: 24643351
Gallbladder; Adenomyomatosis; Gallbladder cancer; High-resolution ultrasound; CT; MRI
5.  Acoustic Radiation Force Impulse Elastography for Focal Hepatic Tumors: Usefulness for Differentiating Hemangiomas from Malignant Tumors 
Korean Journal of Radiology  2013;14(5):743-753.
Objective
The purpose of this study is to investigate whether acoustic radiation force impulse (ARFI) elastography with ARFI quantification and ARFI 2-dimensional (2D) imaging is useful for differentiating hepatic hemangiomas from malignant hepatic tumors.
Materials and Methods
One-hundred-and-one tumors in 74 patients were included in this study: 28 hemangiomas, 26 hepatocellular carcinomas (HCCs), three cholangiocarcinomas (CCCs), 20 colon cancer metastases and 24 other metastases. B-mode ultrasound, ARFI 2D imaging, and ARFI quantification were performed in all tumors. Shear wave velocities (SWVs) of the tumors and the adjacent liver and their SWV differences were compared among the tumor groups. The ARFI 2D images were compared with B-mode images regarding the stiffness, conspicuity and size of the tumors.
Results
The mean SWV of the hemangiomas was significantly lower than the malignant hepatic tumor groups: hemangiomas, 1.80 ± 0.57 m/sec; HCCs, 2.66 ± 0.94 m/sec; CCCs, 3.27 ± 0.64 m/sec; colon cancer metastases, 3.70 ± 0.61 m/sec; and other metastases, 2.82 ± 0.96 m/sec (p < 0.05). The area under the receiver operating characteristics curve of SWV for differentiating hemangiomas from malignant tumors was 0.86, with a sensitivity of 96.4% and a specificity of 65.8% at a cut-off value of 2.73 m/sec (p < 0.05). In the ARFI 2D images, the malignant tumors except HCCs were stiffer and more conspicuous as compared with the hemangiomas (p < 0.05).
Conclusion
ARFI elastography with ARFI quantification and ARFI 2D imaging may be useful for differentiating hepatic hemangiomas from malignant hepatic tumors.
doi:10.3348/kjr.2013.14.5.743
PMCID: PMC3772253  PMID: 24043967
Acoustic radiation force impulse imaging; ARFI; Elastography; Ultrasound; Liver; Tumors
6.  Clinical presentations of critical cardiac defects in the newborn: Decision making and initial management 
Korean Journal of Pediatrics  2010;53(6):669-679.
The risk of mortality and morbidity of patients with congenital heart defects (CHDs) is highest during neonatal period and increases when diagnosis and proper management are delayed. Neonates with critical CHDs may present with severe cyanosis, respiratory distress, shock, or collapse, all of which are also frequent clinical presentations of various respiratory problems or sepsis in the newborn. Early diagnosis and stabilization and timely referral to a tertiary cardiac center are crucial to improve the outcomes in neonates with CHDs. In this review, the clinical presentation of critical and potentially life-threatening CHDs is discussed along with brief case reviews to help understand the hemodynamics of these defects and ensure proper decision-making in critically ill patients.
doi:10.3345/kjp.2010.53.6.669
PMCID: PMC2994134  PMID: 21189937
Congenital heart defect; Ductal-dependent lesions; Cyanosis; Shock
7.  A case report of nonepisodic angioedema with eosinophilia in a Korean patient and a review of the Korean literature 
Episodic angioedema with eosinophilia (EAE) is characterized by recurrent angioedema, peripheral eosinophilia, elevated serum IgM, fever, weight gain, and a benign course lacking any internal organ involvement. Dozens of cases of the nonepisodic variant (NEAE), which is limited to a single attack, have been reported in Japan. These NEAE cases normally have been less severe than the episodic type. In this paper, we describe the case of a Korean patient whose clinical and laboratory findings were consistent with NEAE, and review five other cases of EAE and NEAE reported in the Korean literature. The Korean NEAE cases outlined in this paper demonstrate that, as in Japan, NEAE is not uncommon in Korea, and also suggest that this disease exhibits a cultural predilection for Asian populations.
doi:10.3904/kjim.2006.21.4.275
PMCID: PMC3891036  PMID: 17249513
Angioedema; Eosinophilia
8.  Human induced pluripotent stem cell-based microphysiological tissue models of myocardium and liver for drug development 
Stem Cell Research & Therapy  2013;4(Suppl 1):S14.
Drug discovery and development to date has relied on animal models, which are useful but are often expensive, slow, and fail to mimic human physiology. The discovery of human induced pluripotent stem (iPS) cells has led to the emergence of a new paradigm of drug screening using human and disease-specific organ-like cultures in a dish. Although classical static culture systems are useful for initial screening and toxicity testing, they lack the organization of differentiated iPS cells into microphysiological, organ-like structures deemed necessary for high-content analysis of candidate drugs. One promising approach to produce these organ-like structures is the use of advanced microfluidic systems, which can simulate tissue structure and function at a micron level, and can provide high-throughput testing of different compounds for therapeutic and diagnostic applications. Here, we provide a brief outline on the different approaches, which have been used to engineer in vitro tissue constructs of iPS cell-based myocardium and liver functions on chip. Combining these techniques with iPS cell biology has the potential of reducing the dependence on animal studies for drug toxicity and efficacy screening.
doi:10.1186/scrt375
PMCID: PMC4029618  PMID: 24565415
9.  Preparation and characterization of self-assembled nanoparticles based on low-molecular-weight heparin and stearylamine conjugates for controlled delivery of docetaxel 
Low-molecular-weight heparin (LMWH)–stearylamine (SA) conjugates (LHSA)-based self-assembled nanoparticles were prepared for intravenous delivery of docetaxel (DCT). 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide and N-hydroxysuccinimide were used as coupling agents for synthesis of LHSA conjugates. The physicochemical properties, in vitro antitumor efficacy, in vitro cellular uptake efficiency, in vivo antitumor efficacy, and in vivo pharmacokinetics of LHSA nanoparticles were investigated. The LHSA nanoparticles exhibited a spherical shape with a mean diameter of 140–180 nm and a negative surface charge. According to in vitro release and in vivo pharmacokinetic test results, the docetaxel-loaded LHSA5 (LMWH:SA =1:5) nanoparticles exhibited sustained drug release profiles. The blank LHSA nanoparticles demonstrated only an insignificant cytotoxicity in MCF-7 and MDAMB 231 human breast cancer cells; additionally, higher cellular uptake of coumarin 6 (C6) in MCF-7 and MDAMB 231 cells was observed in the LHSA5 nanoparticles group than that in the C6 solution group. The in vivo tumor growth inhibition efficacy of docetaxel-loaded LHSA5 nanoparticles was also significantly higher than the Taxotere®-treated group in the MDAMB 231 tumor-xenografted mouse model. These results indicated that the LHSA5-based nanoparticles could be a promising anticancer drug delivery system.
doi:10.2147/IJN.S74353
PMCID: PMC4268911  PMID: 25525355
amphiphilic polymer; docetaxel; drug delivery; low-molecular-weight heparin; self-assembled nanoparticle
10.  Novel COL9A3 mutation in a family diagnosed with multiple epiphyseal dysplasia: a case report 
Background
Multiple epiphyseal dysplasia is a common skeletal dysplasia characterized by mild short stature, early-onset osteoarthritis mainly involving the hip and knee joints, and abnormally small and/or irregular epiphyses. Multiple epiphyseal dysplasia is clinically and genetically heterogeneous and six genes are associated with the phenotype of multiple epiphyseal dysplasia.
Case presentation
A 12-year-old Korean boy presented with intermittent knee pain. His height was 144.6 cm (20th percentile) and family history was notable for early-onset osteoarthritis in his father. The proband’s x-rays revealed epiphyseal changes characteristic of multiple epiphyseal dysplasia associated with a collagen IX defect, with manifestations primarily restricted to the knees. Mutational analysis identified a novel c.104G > A substitution in exon 2 of COL9A3, resulting in p.Gly35Asp in the proband and his father. In silico analyses predicted the p.Gly35Asp amino acid change to be detelerious, and molecular dynamics simulation demonstrated a major structural change in the heterotrimeric collagen IX.
Conclusion
So far, three COL9A3 mutations, have been reported. These three mutations are located at the splice donor or acceptor site of COL9A3 and cause skipping of exon 3, resulting in the deletion of 12 aminoacids in the COL3 domain of COL9A3. In contrast, the novel missense mutation identified in this two-generation family with multiple epiphyseal dysplasia is a missense mutation affecting the Gly residue of the Pro-Pro-Gly repeat sequence in the COL3 domain of collage IX, with accompanying major structural change of the collagen peptide.
doi:10.1186/1471-2474-15-371
PMCID: PMC4236474  PMID: 25381065
Multiple epiphyseal dysplasia; COL9A3; Molecular dynamics simulation
11.  House-plant placement for indoor air purification and health benefits on asthmatics 
Objectives
Some plants were placed in indoor locations frequented by asthmatics in order to evaluate the quality of indoor air and examine the health benefits to asthmatics.
Methods
The present study classified the participants into two groups: households of continuation and households of withdrawal by a quasi-experimental design. The households of continuation spent the two observation terms with indoor plants, whereas the households of withdrawal passed the former observation terms with indoor plants and went through the latter observation term without any indoor plants.
Results
The household of continuation showed a continual decrease in the indoor concentrations of volatile organic compounds (VOCs) during the entire observation period, but the household of withdrawal performed an increase in the indoor concentrations of VOCs, except formaldehyde and toluene during the latter observation term after the decrease during the former observation term. Peak expiratory flow rate (PEFR) increased in the households of continuation with the value of 13.9 L/min in the morning and 20.6 L/ min in the evening, but decreased in the households of withdrawal with the value of -24.7 L/min in the morning and -30.2 L/min in the evening in the first experimental season. All of the households exhibited a decrease in the value of PEFR in the second experimental season.
Conclusions
Limitations to the generalizability of findings regarding the presence of plants indoors can be seen as a more general expression of such a benefit of human-environment relations.
doi:10.5620/eht.e2014014
PMCID: PMC4258716  PMID: 25384387
Asthma; Formaldehyde; Health; House-plant; Indoor air quality; Volatile organic compounds
12.  Axonal degeneration in multiple sclerosis: can we predict and prevent permanent disability? 
Axonal degeneration is a major determinant of permanent neurological impairment during multiple sclerosis (MS). Due to the variable course of clinical disease and the heterogeneity of MS lesions, the mechanisms governing axonal degeneration may differ between disease stages. While the etiology of MS remains elusive, there now exist potential prognostic biomarkers that can predict the conversion to clinically definite MS. Specialized imaging techniques identifying axonal injury and drop-out are becoming established in clinical practice as a predictive measure of MS progression, such as optical coherence tomography (OCT) or diffusion tensor imaging (DTI). However, these imaging techniques are still being debated as predictive biomarkers since controversy surrounds their lesion-specific association with expanded disability status scale (EDSS). A more promising diagnostic measure of axonal degeneration has been argued for the detection of reduced N-acetyl aspartate (NAA) and Creatine ratios via magnetic resonance spectroscopic (MRS) imaging, but again fail with its specificity for predicting actual axonal degeneration. Greater accuracy of predictive biomarkers is therefore warranted and may include CSF neurofilament light chain (NF-L) and neurofilament heavy chain (NF-H) levels, for progressive MS. Furthermore, defining the molecular mechanisms that occur during the neurodegenerative changes in the various subgroups of MS may in fact prove vital for the future development of efficacious neuroprotective therapies. The clinical translation of a combined Na+ and Ca2+ channel blocker may lead to the establishment of a bona fide neuroprotective agent for the treatment of progressive MS. However, more specific therapeutic targets to limit axonal damage in MS need investigation and may include such integral axonal proteins such as the collapsin response mediator protein-2 (CRMP-2), a molecule which upon post-translational modification may propagate axonal degeneration in MS. In this review, we discuss the current clinical determinants of axonal damage in MS and consider the cellular and molecular mechanisms that may initiate these neurodegenerative changes. In particular we highlight the therapeutic candidates that may formulate novel therapeutic strategies to limit axonal degeneration and EDSS during progressive MS.
doi:10.1186/s40478-014-0097-7
PMCID: PMC4243718  PMID: 25159125
Axonal degeneration; Multiple sclerosis; Biomarkers; NF-L; N-Acetyl aspartate (NAA)/Creatine ratio; Microglia; Sodium channels; Collapsin response mediator protein 2; Calpain
13.  Crystallization and preliminary X-ray diffraction analysis of a fatty-acid metabolism regulatory protein, FadR, from Bacillus halodurans  
Trigonal crystals of FadR from B. halodurans have been obtained. X-ray data were collected to 2.05 Å resolution using synchrotron radiation.
FadR is an acyl-CoA-dependent transcription factor which regulates genes encoding proteins involved in fatty-acid degradation and synthesis in order to maintain lipid homeostasis. FadR from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. The FadR (Bh3102) protein from B. halodurans is composed of 195 amino-acid residues with a molecular mass of 22 378 Da. Crystals were obtained by the sitting-drop vapour-diffusion method and diffracted to 2.05 Å resolution. FadR was crystallized at 296 K using polyethylene glycol 3350 as a precipitant. The crystal belonged to the apparent trigonal space group P3221, with unit-cell parameters a = b = 56.34, c = 199.73 Å. The Matthews coefficient and solvent content were estimated to be 2.0 Å3 Da−1 and 39.8%, respectively, assuming that the asymmetric unit contained two molecules of FadR, which was subsequently confirmed by molecular-replacement calculations.
doi:10.1107/S1744309112029508
PMCID: PMC3412787  PMID: 22869136
FadR; transcriptional regulators; Bacillus halodurans
14.  Poly(styrene)-b-poly(DL-lactide) copolymer-based nanoparticles for anticancer drug delivery 
Poly(styrene)-b-poly(DL-lactide) (PS-PDLLA) copolymer-based nanoparticles (NPs) of a narrow size distribution, negative zeta potential, and spherical shape were fabricated for the delivery of docetaxel (DCT). The particle size was consistently maintained in serum for 24 hours and a sustained drug release pattern was observed for 10 days in the tested formulations. The cytotoxicity of the developed blank NPs was negligible in prostate cancer (PC-3) cells. Cellular uptake and distribution of the constructed NPs containing a hydrophobic fluorescent dye was monitored by confocal laser scanning microscopy (CLSM) for 24 hours. Anti-tumor efficacy of the PS-PDLLA/DCT NPs in PC-3 cells was significantly more potent than that of the group treated with commercially available DCT, Taxotere® (P<0.05). Blood biochemistry tests showed that no serious toxicity was observed with the blank NPs in the liver and kidney. In a pharmacokinetic study of DCT in rats, in vivo clearance of PS-PDLLA/DCT NPs decreased while the half-life in blood increased compared to the Taxotere-treated group (P<0.05). The PS-PDLLA NPs are expected to be a biocompatible and efficient nano-delivery system for anticancer drugs.
doi:10.2147/IJN.S62806
PMCID: PMC4051715  PMID: 24940058
docetaxel; prolonged blood circulation; prostate cancer
15.  Massive Cardiomegaly due to Dilated Cardiomyopathy Causing Bronchial Obstruction in an Infant 
Dilated cardiomyopathy (DCMP) remains a life threatening disease in young patients and is often difficult to differentiate from myocarditis. Early recognition and treatment of DCMP are crucial for good prognoses in this patient population. The clinical course of patients with DCMP that result in cardiogenic shock varies according to the etiology as well as patient age. The volumetric expansion of the enlarged heart can compress adjacent structures causing a number of related symptoms, especially in infants with soft cartilaginous bronchi. Therapeutic strategies for treating these issues vary according to the type of complication encountered. We report a case of severe DCMP with sudden onset of massive cardiomegaly with heart failure complicated by bronchial obstruction in an infant.
doi:10.4250/jcu.2014.22.2.84
PMCID: PMC4096670  PMID: 25031799
Dilated cardiomyopathy; Cardiomegaly; Infant; Bronchoconstriction
16.  A Case of Pulmonary Arterial Hypertension Associated with Congenital Extrahepatic Portocaval Shunt 
Journal of Korean Medical Science  2014;29(4):604-608.
Congenital extrahepatic portocaval shunt (CEPS) is a rare anomaly of the mesenteric vasculature in which the intestinal and splenic venous drainage bypasses the liver and drains directly into the inferior vena cava, the left hepatic vein or the left renal vein. This uncommon disease is frequently associated with other malformations and mainly affects females. Here we report a case of pulmonary arterial hypertension associated with CEPS (Abernethy type 1b shunt) in a 20-yr-old man who was incidentally diagnosed during evaluation of multiple nodules of the liver. The patient was treated by inhalation of iloprost (40 µg/day) with improved condition and walking test. Physicians should note that congenital portocaval shunt may cause pulmonary hypertension.
Graphical Abstract
doi:10.3346/jkms.2014.29.4.604
PMCID: PMC3991808  PMID: 24753712
Congenital Extrahepatic Portocaval Shunt; Pulmonary Arterial Hypertension; Heart Septal Defect, Ventricular; Multifocal Nodular Regenerative Hyperplasia of the Liver
17.  Baseline heart rate variability in children and adolescents with vasovagal syncope 
Korean Journal of Pediatrics  2014;57(4):193-198.
Purpose
This study aimed to evaluate the autonomic imbalance in syncope by comparing the baseline heart rate variability (HRV) between healthy children and those with vasovagal syncope.
Methods
To characterize the autonomic profile in children experiencing vasovagal syncope, we evaluated the HRV of 23 patients aged 7-18 years and 20 healthy children. These children were divided into preadolescent (<12 years) and adolescent groups. The following time-domain indices were calculated: root mean square of the successive differences (RMSSD); standard deviation of all average R-R intervals (SDNN); and frequency domain indices including high frequency (HF), low frequency (LF), normalized high frequency, normalized low frequency, and low frequency to high frequency ratio (LF/HF).
Results
HRV values were significantly different between healthy children and those with syncope. Student t test indicated significantly higher SNDD values (60.46 ms vs. 37.42 ms, P=0.003) and RMSSD (57.90 ms vs. 26.92 ms, P=0.000) in the patient group than in the control group. In the patient group, RMSSD (80.41 ms vs. 45.89 ms, P=0.015) and normalized HF (61.18 ms vs. 43.19 ms, P=0.022) were significantly higher in adolescents, whereas normalized LF (38.81 ms vs. 56.76 ms, P=0.022) and LF/HF ratio (0.76 vs. 1.89, P=0.041) were significantly lower in adolescents. In contrast, the control group did not have significant differences in HRV values between adolescents and preadolescents.
Conclusion
The results of this study indicated that children with syncope had a decreased sympathetic tone and increased vagal tone compared to healthy children. Additionally, more severe autonomic imbalances possibly occur in adolescents than in preadolescents.
doi:10.3345/kjp.2014.57.4.193
PMCID: PMC4030121  PMID: 24868217
Vasovagal syncope; Heart rate; Child; Adolescent
18.  Crystallization and preliminary X-ray diffraction analysis of the metalloregulatory protein DtxR from Thermoplasma acidophilum  
Orthorhombic crystals of DtxR from T. acidophilum have been obtained. X-ray data were collected to 1.8 Å resolution using synchrotron radiation.
The diphtheria toxin repressor (DtxR) is a metal-ion-dependent transcriptional regulator which regulates genes encoding proteins involved in metal-ion uptake to maintain metal-ion homeostasis. DtxR from Thermoplasma acidophilum was cloned and overexpressed in Escherichia coli. Crystals of N-terminally His-tagged DtxR were obtained by hanging-drop vapour diffusion and diffracted to 1.8 Å resolution. DtxR was crystallized at 296 K using polyethylene glycol 4000 as a precipitant. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 61.14, b = 84.61, c = 46.91 Å, α = β = γ = 90°. The asymmetric unit contained approximately one monomer of DtxR, giving a crystal volume per mass (V M) of 2.22 Å3 Da−1 and a solvent content of 44.6%.
doi:10.1107/S1744309111051700
PMCID: PMC3274395  PMID: 22297991
DtxR; transcriptional regulators; metalloregulatory proteins; Thermoplasma acidophilum
19.  Outcomes of Primary Ligation of Patent Ductus Arteriosus Compared With Secondary Ligation After Pharmacologic Failure in Very-Low-Birth-Weight Infants 
Pediatric Cardiology  2013;35(5):793-797.
This study aimed to determine whether primary surgical closure of patent ductus arteriosus (PDA) is a risk factor for morbidity and mortality compared with secondary surgical ligation. The study enrolled 178 very-low-birth-weight infants. The surgical group included 34 patients who did not respond to pharmacologic intervention and eventually required ligation of their PDA as well as 35 patients who underwent direct ligation because of contraindications to the use of oral ibuprofen. The overall outcomes for the primary and secondary ligation groups were compared. The outcome during hospitalization showed no statistically significant difference in terms of morbidity and mortality between the two groups. The group that had primary ligation for PDA experienced more complications associated with premature birth such as lower gestational age and birth weight. The two groups did not differ significantly in terms of overall outcomes.
doi:10.1007/s00246-013-0854-6
PMCID: PMC4015055  PMID: 24370764
Surgical ligation; Morbidity; Hemodynamically significant ductus arteriosus
20.  Nogo-Receptor 1 Deficiency Has No Influence on Immune Cell Repertoire or Function during Experimental Autoimmune Encephalomyelitis 
PLoS ONE  2013;8(12):e82101.
The potential role of Nogo-66 Receptor 1 (NgR1) on immune cell phenotypes and their activation during neuroinflammatory diseases such as multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE), is unclear. To further understand the function of this receptor on haematopoietically-derived cells, phenotypic and functional analyses were performed using NgR1-deficient (ngr1-/-) animals. Flow cytometry-based phenotypic analyses performed on blood, spleen, thymus, lymph nodes, bone marrow and central nervous-system (CNS)-infiltrating blood cells revealed no immunological defects in naïve ngr1-/- animals versus wild-type littermate (WTLM) controls. EAE was induced by either recombinant myelin oligodendrocyte glycoprotein (rMOG), a model in which B cells are considered to contribute pathogenically, or by MOG35–55 peptide, a B cell-independent model. We have demonstrated that in ngr1-/- mice injected with MOG35–55, a significant reduction in the severity of EAE correlated with reduced axonal damage present in the spinal cord when compared to their WTLM controls. However, despite a reduction in axonal damage observed in the CNS of ngr1-/- mice at the chronic stage of disease, no clinical differences could be attributed to a specific genotype when rMOG was used as the encephalitogen. Following MOG35–55-induction of EAE, we could not derive any major changes to the immune cell populations analyzed between ngr1-/- and WTLM mice. Collectively, these data demonstrate that NgR1 has little if any effects on the repertoire of immune cells, their activation and trafficking to the CNS.
doi:10.1371/journal.pone.0082101
PMCID: PMC3855334  PMID: 24339996
21.  Incidence and Risk Factors for Early-Onset Hypertension after Allogeneic Hematopoietic Stem Cell Transplantation in Children 
Korean Circulation Journal  2013;43(12):804-810.
Background and Objectives
Survivors of pediatric hematopoietic stem cell transplantation (HSCT) are at risk for developing hypertension. The objectives of this study are to evaluate the prevalence and risk factors of early onset hypertension during the engraftment period after HSCT.
Subjects and Methods
This is a retrospective study of 157 consecutive patients (mean age at HSCT: 9.1±5.1 years) who underwent HSCT for acute myeloid leukemia (n=47), acute lymphoblastic leukemia (n=43), severe aplastic anemia (n=41), and other reasons (n=26). Blood pressure data were collected at five time points: 0, 7, 14, 21, and 28 days after HSCT. Hypertension was defined as having systolic and/or diastolic blood pressure ≥95th percentile according to age, gender, and height. To analyze the risk factors related to hypertension, data, including patients' demographic and transplant characteristics, were reviewed.
Results
Hypertension developed in 59 patients (38%), among whom 12 (7.6%) required long term therapy. Thirty-two (54%) patients had systolic and diastolic, 8 (14%) had only systolic, and 19 (32%) had only diastolic hypertension. Younger age, acute graft-versus-host disease, sinusoidal obstruction syndrome, treatment with antifungal agent, and greater increase in serum creatinine (Cr) levels were associated with hypertension. Multivariate analysis showed that younger age at HSCT and greater increase in serum Cr level were independent risk factors for hypertension.
Conclusion
Prevalence of hypertension during immediate post-HSCT period is high, especially in younger children. A greater increase in Cr after HSCT was significantly associated with hypertension. Further study is needed to elucidate long-term cardiovascular complications in pediatric HSCT survivors.
doi:10.4070/kcj.2013.43.12.804
PMCID: PMC3875696  PMID: 24385991
Hematopoletic stem cell transplantation; Child; Incidence; Blood pressure; Hypertension
22.  Association Between Pet Ownership and the Sensitization to Pet Allergens in Adults With Various Allergic Diseases 
Purpose
As pet ownership increases, sensitization to animal allergens due to domestic exposure is a concern. Sensitization to animal allergens may occur from indirect exposure, as well as direct ownership of animals. However, there have been conflicting results regarding the association between pet ownership and sensitization to animal allergens in adults.
Methods
In total, 401 patients with various allergic diseases were enrolled in this study. We performed skin prick tests with 55 common inhalant and food allergens, including dog, cat, and rabbit allergens. A mean wheal diameter of 3 mm or greater was considered a positive reaction. The exposure modality to each animal allergen was investigated using a questionnaire and included present ownership, past ownership, occupational exposure, occasional exposure, contact with pet owner, and no contact. Present ownership, past ownership, occupational, and occasional exposure were regarded as direct exposure.
Results
The sensitization rate for animal allergens was 20.4% for dog, 15.0% for cat, and 9.0% for rabbit. Direct exposure to dogs (72.0%) was significantly higher than that of other animals (18.4% for cats and 16.7% for rabbits), whereas 'no contact' with cats (78.3%) and rabbits (83.3%) was significantly higher than with dogs (26.8%; P<0.0001). Independent risk factors for sensitization to animal allergens were sensitization to Dermatophagoides pteronyssinus (OR=2.4, P=0.052), Dermatophagoides farinae (OR=5.1, P<0.001), cat (OR=4.4, P<0.0001), and direct exposure to dogs (OR=1.5, P=0.029) for dog, and sensitization to dog (OR=4.4, P<0.0001) and rabbit (OR=2.6, P=0.036) for cats. Finally, for rabbits, the independent risk factor was sensitization to Alternaria (OR=6.0, P<0.002).
Conclusions
These results suggest that direct exposure to dogs contributes to the sensitization to dog allergens in patients with allergic diseases, whereas indirect exposure to cats and rabbits may induce sensitization to each animal's allergen.
doi:10.4168/aair.2013.5.5.295
PMCID: PMC3756176  PMID: 24003386
Cats; dogs; rabbits; pets; ownership; sensitization
23.  Structural basis for the inhibition of Mycobacterium tuberculosis l,d-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains 
The crystal structure of M. tuberculosis l,d-transpeptidase (LdtMt2; Rv2518c) has been determined in both ligand-free and meropenem-bound forms. The detailed view of the interactions between meropenem and LdtMt2 will be useful in structure-guided discovery of new antituberculosis drugs.
Difficulty in the treatment of tuberculosis and growing drug resistance in Mycobacterium tuberculosis (Mtb) are a global health issue. Carbapenems inactivate l,d-transpeptidases; meropenem, when administered with clavulanate, showed in vivo activity against extensively drug-resistant Mtb strains. LdtMt2 (Rv2518c), one of two functional l,d-transpeptidases in Mtb, is predominantly expressed over LdtMt1 (Rv0116c). Here, the crystal structure of N-terminally truncated LdtMt2 (residues Leu131–Ala408) is reported in both ligand-free and meropenem-bound forms. The structure of meropenem-inhibited LdtMt2 provides a detailed structural view of the interactions between a carbapenem drug and Mtb l,d-transpeptidase. The structures revealed that the catalytic l,d-­transpeptidase domain of LdtMt2 is preceded by a bacterial immunogloblin-like Big_5 domain and is followed by an extended C-terminal tail that interacts with both domains. Furthermore, it is shown using mass analyses that meropenem acts as a suicide inhibitor of LdtMt2. Upon acylation of the catalytic Cys354 by meropenem, the ‘active-site lid’ undergoes a large conformational change to partially cover the active site so that the bound meropenem is accessible to the bulk solvent via three narrow paths. This work will facilitate structure-guided discovery of l,d-transpeptidase inhibitors as novel antituberculosis drugs against drug-resistant Mtb.
doi:10.1107/S0907444912048998
PMCID: PMC3605043  PMID: 23519417
Rv2518c; Mt2594; LdtMt2; l,d-transpeptidases; Mycobacterium tuberculosis; meropenem; carbapenem; peptidoglycans; antituberculosis drug discovery
24.  Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus 
Triclinic crystals of a self-complementary DNA heptacosamer with 20-base-pair duplexes flanked by 3′-terminal seven-nucleotide overhangs have been obtained. X-ray data were collected to 2.8 Å resolution using synchrotron radiation.
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3′-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 Å resolution. The oligonucleotide was crystallized at 277 K using poly­ethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 Å, α = 91.37, β = 93.21, γ = 92.35°.
doi:10.1107/S1744309110010687
PMCID: PMC2864687  PMID: 20445254
DNA heptacosamer; oligonucleotides
25.  A Case of Korean Ginseng-Induced Anaphylaxis Confirmed by Open Oral Challenge and Basophil Activation Test 
Two case reports discussing Korean ginseng-induced allergic reactions have been published; both were inhalation-induced respiratory allergies in occupational settings. In this report we discuss the first case of anaphylaxis that developed after an oral intake of ginseng, confirmed by an open oral challenge, a skin prick test (SPT), and a basophil activation test (BAT). A 44-year-old man experienced rhinorrhea and nasal stiffness, followed by respiratory difficulty with wheeze and abdominal pain 10 minutes after oral intake of fresh ginseng. He had suffered from episodes of allergic rhinitis during the spring season for several years. Upon presentation, a physical examination, chest radiograph, and routine laboratory tests were unremarkable. Total serum IgE level was 41 IU/mL. The SPT results showed strong positive responses to alder, birch pollens, and ginseng extracts (1:500 w/v). The methacholine bronchial challenge test revealed a positive result at PC20 of 5.83 mg/mL. The open oral challenge was performed using 50 g of fresh ginseng and showed immediate onset of facial flushing, cough, respiratory difficulty with wheeze, and abdominal pain combined with a significant decrease in FEV1 levels (54% from the baseline). Serum-specific IgE and IgG4 antibodies were not detectable by enzyme-linked immunosorbent assay. BAT showed a remarkable increase in the expression of CD203c and CD63 with the addition of ginseng extract in a dose-dependent manner, while no changes were noted in the controls. In conclusion, oral intake of Korean ginseng could induce anaphylaxis, which is mediated by non-IgE-dependent direct activation of basophil/mast cells.
doi:10.4168/aair.2012.4.2.110
PMCID: PMC3283793  PMID: 22379608
Anaphylaxis; basophil; flow cytometry; Panax

Results 1-25 (54)