PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (144)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Authors
more »
Year of Publication
more »
1.  Variability in Humoral Immunity to Measles Vaccine: New Developments 
Trends in molecular medicine  2015;21(12):789-801.
Despite the existence of an effective measles vaccine, resurgence in measles cases in the United States and across Europe has occurred, including in individuals vaccinated with two doses of the vaccine. Host genetic factors result in inter-individual variation in measles vaccine-induced antibodies, and play a role in vaccine failure. Studies have identified HLA and non-HLA genetic influences that individually or jointly contribute to the observed variability in the humoral response to vaccination among healthy individuals. In this exciting era, new high-dimensional approaches and techniques including vaccinomics, systems biology, GWAS, epitope prediction and sophisticated bioinformatics/statistical algorithms, provide powerful tools to investigate immune response mechanisms to the measles vaccine. These might predict, on an individual basis, outcomes of acquired immunity post measles vaccination.
doi:10.1016/j.molmed.2015.10.005
PMCID: PMC4679650  PMID: 26602762
2.  Vitamin D, leptin and impact on immune response to seasonal influenza A/H1N1 vaccine in older persons  
ABSTRACT
Background: Influenza-related complications are highest in the elderly. Vaccine efficacy is lower due to immunosenescence. Vitamin D's immunomodulatory role was studied in the context of vaccine response.
Methods: We evaluated the effect of baseline 25-(OH) D on vaccine-induced immunological response in a cohort of 159 healthy subjects ages 50–74 in Rochester, MN, who received one dose of seasonal trivalent 2010–2011 influenza vaccine, containing A/California/H1N1- like virus. We examined correlations between 25-(OH) D, leptin, and leptin-related gene SNPs to understand the role of leptin and vitamin D's effects.
Results: The median (IQR) baseline for total 25-(OH) D was 44.4 ng/mL (36.6–52.2 ng/mL). No correlation was observed with age. No correlation between 25-(OH) D levels and humoral immune outcomes existed at any timepoint. There was a weak positive correlation between 25-(OH) D levels and change (Day 75-Day 0) in influenza-specific granzyme-B response (r=0.16, p=0.04). We found significant associations between 3 SNPs in the PPARG gene and 25-(OH) D levels (rs1151996, p=0.01; rs1175540, p= 0.02; rs1175544, p=0.03).
Conclusion: Several SNPs in the PPARG gene were significantly associated with baseline 25-(OH) D levels. Understanding the functional and mechanistic relationships between vitamin D and influenza vaccine-induced immunity could assist in directing new influenza vaccine design.
doi:10.1080/21645515.2015.1097015
PMCID: PMC4964629  PMID: 26575832
H1N1 subtype; influenza A virus; influenza vaccines; leptin; receptors; vitamin D; vitamin D deficiency
3.  “Let There Be Light”: The Role of Vitamin D in the Immune Response to Vaccines 
Expert review of vaccines  2015;14(11):1427-1440.
Vitamin D’s non-skeletal actions, including immunomodulatory role, have been increasingly recognized. Of significance, many immune cells are able to synthesize a biologically active form of vitamin D from circulating 25-(OH) D with subsequent intracrine actions, and the vitamin D receptor (VDR) is broadly distributed. In this review, we discuss vitamin D’s potent role in innate and adaptive immune responses and published studies evaluating the impact of serum vitamin D, vitamin D gene pathway polymorphisms or empiric vitamin D supplementation on vaccine immunogenicity. We highlight existing knowledge gaps and propose the steps needed to advance the science and answer the question of whether vitamin D may prove valuable as a vaccine adjuvant for certain vaccines against infectious diseases.
doi:10.1586/14760584.2015.1082426
PMCID: PMC4913549  PMID: 26325349
Vitamin D; Immunization; Immunity; Innate; Immunity; Cellular; Adaptive Immunity; Vaccines
4.  Humoral and Cell-Mediated Immune Responses to Alternate Booster Schedules of Anthrax Vaccine Adsorbed in Humans 
Protective antigen (PA)-specific antibody and cell-mediated immune (CMI) responses to annual and alternate booster schedules of anthrax vaccine adsorbed (AVA; BioThrax) were characterized in humans over 43 months. Study participants received 1 of 6 vaccination schedules: a 3-dose intramuscular (IM) priming series (0, 1, and 6 months) with a single booster at 42 months (4-IM); 3-dose IM priming with boosters at 18 and 42 months (5-IM); 3-dose IM priming with boosters at 12, 18, 30, and 42 months (7-IM); the 1970 licensed priming series of 6 doses (0, 0.5, 1, 6, 12, and 18 months) and two annual boosters (30 and 42 months) administered either subcutaneously (SQ) (8-SQ) or IM (8-IM); or saline placebo control at all eight time points. Antibody response profiles included serum anti-PA IgG levels, subclass distributions, avidity, and lethal toxin neutralization activity (TNA). CMI profiles included frequencies of gamma interferon (IFN-γ)- and interleukin 4 (IL-4)-secreting cells and memory B cells (MBCs), lymphocyte stimulation indices (SI), and induction of IFN-γ, IL-2, IL-4, IL-6, IL-1β, and tumor necrosis factor alpha (TNF-α) mRNA. All active schedules elicited high-avidity PA-specific IgG, TNA, MBCs, and T cell responses with a mixed Th1-Th2 profile and Th2 dominance. Anti-PA IgG and TNA were highly correlated (e.g., month 7, r2 = 0.86, P < 0.0001, log10 transformed) and declined in the absence of boosters. Boosters administered IM generated the highest antibody responses. Increasing time intervals between boosters generated antibody responses that were faster than and superior to those obtained with the final month 42 vaccination. CMI responses to the 3-dose IM priming remained elevated up to 43 months. (This study has been registered at ClinicalTrials.gov under registration no. NCT00119067.)
doi:10.1128/CVI.00696-15
PMCID: PMC4820509  PMID: 26865594
5.  Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children 
Immunogenetics  2015;67(10):547-561.
Background
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation.
Methods
In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers.
Results
Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic: 4.43, p<0.0001) and higher neutralizing antibody titers (t-statistic: 3.14, p=0.002).
Conclusions
Our results suggest that there is evidence of multigenic associations among identified gene SNPs, and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
doi:10.1007/s00251-015-0864-z
PMCID: PMC4587390  PMID: 26329766
Rubella vaccine; single nucleotide polymorphisms (SNPs); genetic association; neutralizing antibodies; cytokines; Rubella; Rubella Vaccine; Rubella virus; Measles-Mumps-Rubella Vaccine; Polymorphism; Single Nucleotide; Genetic Association Studies; Antibodies; Neutralizing; Cytokines
6.  Lessons learned in the analysis of high-dimensional data in vaccinomics 
Vaccine  2015;33(40):5262-5270.
The field of vaccinology is increasingly moving toward the generation, analysis, and modeling of extremely large and complex high-dimensional datasets. We have used data such as these in the development and advancement of the field of vaccinomics to enable prediction of vaccine responses and to develop new vaccine candidates. However, the application of systems biology to what has been termed “big data,” or “high-dimensional data,” is not without significant challenges—chief among them a paucity of gold standard analysis and modeling paradigms with which to interpret the data. In this article, we relate some of the lessons we have learned over the last decade of working with high-dimensional, high-throughput data as applied to the field of vaccinomics. The value of such efforts, however, is ultimately to better understand the immune mechanisms by which protective and non-protective responses to vaccines are generated, and to use this information to support a personalized vaccinology approach in creating better, and safer, vaccines for the public health.
doi:10.1016/j.vaccine.2015.04.088
PMCID: PMC4581898  PMID: 25957070
7.  Taxa of the Nasal Microbiome Are Associated with Influenza-Specific IgA Response to Live Attenuated Influenza Vaccine 
PLoS ONE  2016;11(9):e0162803.
Live attenuated influenza vaccine (LAIV) has demonstrated varying levels of efficacy against seasonal influenza; however, LAIV may be used as a tool to measure interactions between the human microbiome and a live, replicating virus. To increase our knowledge of this interaction, we measured changes to the nasal microbiome in subjects who received LAIV to determine if associations between influenza-specific IgA production and the nasal microbiome exist after immunization with a live virus vaccine. The anterior nares of 47 healthy subjects were swabbed pre- (Day 0) and post- (Days 7 and 28) LAIV administration, and nasal washes were conducted on Days 0 and 28. We performed next-generation sequencing on amplified 16s rRNA genes and measured mucosal influenza-specific IgA titers via enzyme-linked immunosorbent assay (ELISA). A significant increase in alpha diversity was identified (Observed, CHAO, and ACE) between Days 7 vs 0 (p-values = 0.017, 0.005, 0.005, respectively) and between Days 28 vs 0 (p-values = 0.054, 0.030, 0.050, respectively). Several significant associations between the presence of different microbial species, including Lactobacillus helveticus, Prevotella melaninogenica, Streptococcus infantis, Veillonella dispar, and Bacteroides ovatus, and influenza-specific H1 and H3 IgA antibody response were demonstrated. These data suggest that LAIV alters the nasal microbiome, allowing several less-abundant OTUs to establish a community niche. Additionally, specific alterations in the nasal microbiome are significantly associated with variations in influenza-specific IgA antibody production and could be clinically relevant.
doi:10.1371/journal.pone.0162803
PMCID: PMC5028048  PMID: 27643883
8.  The weight of obesity on the human immune response to vaccination 
Vaccine  2015;33(36):4422-4429.
Despite the high success of protection against several infectious diseases through effective vaccines, some sub-populations have been observed to respond poorly to vaccines, putting them at increased risk for vaccine-preventable diseases. In particular, the limited data concerning the effect of obesity on vaccine immunogenicity and efficacy suggests that obesity is a factor that increases the likelihood of a poor vaccine-induced immune response. Obesity occurs through the deposition of excess lipids into adipose tissue through the production of adipocytes, and is defined as a body-mass index (BMI) ≥ 30 kg/m2. The immune system is adversely affected by obesity, and these “immune consequences” raise concern for the lack of vaccine-induced immunity in the obese patient requiring discussion of how this sub-population might be better protected.
doi:10.1016/j.vaccine.2015.06.101
PMCID: PMC4547886  PMID: 26163925
Vaccination; Immunization; Obesity; Immunity; Communicable Diseases
9.  Whole Transcriptome Profiling Identifies CD93 and Other Plasma Cell Survival Factor Genes Associated with Measles-Specific Antibody Response after Vaccination 
PLoS ONE  2016;11(8):e0160970.
Background
There are insufficient system-wide transcriptomic (or other) data that help explain the observed inter-individual variability in antibody titers after measles vaccination in otherwise healthy individuals.
Methods
We performed a transcriptome(mRNA-Seq)-profiling study after in vitro viral stimulation of PBMCs from 30 measles vaccine recipients, selected from a cohort of 764 schoolchildren, based on the highest and lowest antibody titers. We used regression and network biology modeling to define markers associated with neutralizing antibody response.
Results
We identified 39 differentially expressed genes that demonstrate significant differences between the high and low antibody responder groups (p-value≤0.0002, q-value≤0.092), including the top gene CD93 (p<1.0E-13, q<1.0E-09), encoding a receptor required for antigen-driven B-cell differentiation, maintenance of immunoglobulin production and preservation of plasma cells in the bone marrow. Network biology modeling highlighted plasma cell survival (CD93, IL6, CXCL12), chemokine/cytokine activity and cell-cell communication/adhesion/migration as biological processes associated with the observed differential response in the two responder groups.
Conclusion
We identified genes and pathways that explain in part, and are associated with, neutralizing antibody titers after measles vaccination. This new knowledge could assist in the identification of biomarkers and predictive signatures of protective immunity that may be useful in the design of new vaccine candidates and in clinical studies.
doi:10.1371/journal.pone.0160970
PMCID: PMC4987012  PMID: 27529750
10.  The Integration of Epistasis Network and Functional Interactions in a GWAS Implicates RXR Pathway Genes in the Immune Response to Smallpox Vaccine 
PLoS ONE  2016;11(8):e0158016.
Although many diseases and traits show large heritability, few genetic variants have been found to strongly separate phenotype groups by genotype. Complex regulatory networks of variants and expression of multiple genes lead to small individual-variant effects and difficulty replicating the effect of any single variant in an affected pathway. Interaction network modeling of GWAS identifies effects ignored by univariate models, but population differences may still cause specific genes to not replicate. Integrative network models may help detect indirect effects of variants in the underlying biological pathway. In this study, we used gene-level functional interaction information from the Integrative Multi-species Prediction (IMP) tool to reveal important genes associated with a complex phenotype through evidence from epistasis networks and pathway enrichment. We test this method for augmenting variant-based network analyses with functional interactions by applying it to a smallpox vaccine immune response GWAS. The integrative analysis spotlights the role of genes related to retinoid X receptor alpha (RXRA), which has been implicated in a previous epistasis network analysis of smallpox vaccine.
doi:10.1371/journal.pone.0158016
PMCID: PMC4981436  PMID: 27513748
11.  Immunization of Health-Care Providers: Necessity and Public Health Policies 
Healthcare  2016;4(3):47.
Health-care providers (HCPs) are at increased risk for exposure to vaccine-preventable diseases (VPDs) in the workplace. The rationale for immunization of HCPs relies on the need to protect them and, indirectly, their patients from health-care-associated VPDs. Published evidence indicates significant immunity gaps for VPDs of HCPs globally. Deficits in knowledge and false perceptions about VPDs and vaccines are the most common barriers for vaccine uptake and may also influence communication about vaccines between HCPs and their patients. Most countries have immunization recommendations for HCPs; however, there are no universal policies and significant heterogeneity exists between countries in terms of vaccines, schedules, frame of implementation (recommendation or mandatory), and target categories of HCPs. Mandatory influenza immunization policies for HCPs have been implemented with high vaccine uptake rates. Stronger recommendations for HCP immunization and commitment at the level of the health-care facility are critical in order to achieve high vaccine coverage rates. Given the importance to health, mandatory immunization policies for VPDs that can cause serious morbidity and mortality to vulnerable patients should be considered.
doi:10.3390/healthcare4030047
PMCID: PMC5041048  PMID: 27490580
vaccine-preventable diseases; immunization; vaccination; health-care providers; health-care workers; health-care associated; nosocomial; outbreak; occupational risk; policies; mandatory
12.  Statistical Modeling Using Early Markers of Innate Immunity to Explain Variation in Humoral Responses to Influenza Vaccine in Older Adults 
Vaccine  2015;33(31):3682-3688.
Greater understanding of the factors associated with a protective response to influenza vaccine in older adults could have tremendous public health benefits. We studied 158 participants age 50–74 years vaccinated with 2010–2011 inactivated influenza vaccine and performed innate immunity and humoral immunity assays directed against influenza A/California/2009 (H1N1) as measured through hemagglutination inhibition (HAI), microneutralization, and B cell ELISPOT at days 0, 3, and 28 postvaccination. We report the results of statistical modeling using Day 3 cytokines, chemokines, and innate cell populations to model Day 0 to Day 28 HAI seroconversion, viral neutralization seroconversion, and B cell ELISPOT results.
doi:10.1016/j.vaccine.2015.06.031
PMCID: PMC4626876  PMID: 26087295
Influenza Vaccines; Immunity; Humoral; Models; Statistical; Aged; Adult; Age Factors
13.  Adversomics: a new paradigm for vaccine safety and design 
Expert review of vaccines  2015;14(7):935-947.
Summary
Despite the enormous population benefits of routine vaccination, vaccine adverse events and reactions, whether real or perceived, have posed one of the greatest barriers to vaccine acceptance—and thus to infectious disease prevention—worldwide. A truly integrated clinical, translational, and basic science approach is required to understand the mechanisms behind vaccine adverse events, predict them, and then apply this knowledge to new vaccine design approaches that decrease, or avoid, these events. The term “adversomics” was first introduced in 2009 and refers to the study of vaccine adverse reactions using immunogenomics and systems biology approaches. In this review, we present the current state of adversomics research, review known associations and mechanisms of vaccine adverse events/reactions, and outline a plan for the further development of this emerging research field.
doi:10.1586/14760584.2015.1038249
PMCID: PMC4630804  PMID: 25937189
Vaccines; Viral Vaccines; Immunogenetics; Genetic Association Studies; Systems Biology; Individualized Medicine; Vaccination; Genomics; Drug-Related Side Effects and Adverse Reactions; Polymorphism; Single Nucleotide
14.  Rubella 
Lancet (London, England)  2015;385(9984):2297-2307.
Rubella remains an important pathogen globally with approximately 100,000 cases of congenital rubella syndrome estimated to occur each year. Rubella vaccine is highly effective and safe when used across a population and, as a result, endemic rubella transmission has been interrupted in the Americas since 2009. Incomplete rubella vaccination programs result in continued disease transmission as evidenced by recent large outbreaks in Japan and elsewhere. Herein, we provide current results regarding rubella control, elimination and eradication policies, and a brief review of new laboratory diagnostics. In addition, we provide novel information regarding rubella vaccine immunogenetics and review the emerging evidence of inter-individual variability in humoral and cell-mediated innate and adaptive immune responses to rubella vaccine and their association with HLA alleles, haplotypes, and single nucleotide polymorphisms across the human genome. Finally, we conclude with a call for further research in rubella vaccine immunogenetics and its ability to inform a vaccinomics-level approach to novel vaccine candidate development and the need for a next generation vaccine that is affordable, easy to administer, and does not require a cold chain for optimal immunogenicity.
doi:10.1016/S0140-6736(14)60539-0
PMCID: PMC4514442  PMID: 25576992
15.  Recursive Indirect-Paths Modularity (RIP-M) for Detecting Community Structure in RNA-Seq Co-expression Networks 
Clusters of genes in co-expression networks are commonly used as functional units for gene set enrichment detection and increasingly as features (attribute construction) for statistical inference and sample classification. One of the practical challenges of clustering for these purposes is to identify an optimal partition of the network where the individual clusters are neither too large, prohibiting interpretation, nor too small, precluding general inference. Newman Modularity is a spectral clustering algorithm that automatically finds the number of clusters, but for many biological networks the cluster sizes are suboptimal. In this work, we generalize Newman Modularity to incorporate information from indirect paths in RNA-Seq co-expression networks. We implement a merge-and-split algorithm that allows the user to constrain the range of cluster sizes: large enough to capture genes in relevant pathways, yet small enough to resolve distinct functions. We investigate the properties of our recursive indirect-pathways modularity (RIP-M) and compare it with other clustering methods using simulated co-expression networks and RNA-seq data from an influenza vaccine response study. RIP-M had higher cluster assignment accuracy than Newman Modularity for finding clusters in simulated co-expression networks for all scenarios, and RIP-M had comparable accuracy to Weighted Gene Correlation Network Analysis (WGCNA). RIP-M was more accurate than WGCNA for modest hard thresholds and comparable for high, while WGCNA was slightly more accurate for soft thresholds. In the vaccine study data, RIP-M and WGCNA enriched for a comparable number of immunologically relevant pathways.
doi:10.3389/fgene.2016.00080
PMCID: PMC4861003  PMID: 27242890
sequence analysis; RNA; gene expression profiling; newman modularity; weighted gene correlation network analysis; WGCNA; algorithms
16.  Gene signatures related to HAI response following influenza A/H1N1 vaccine in older individuals 
Heliyon  2016;2(5):e00098.
To assess gene signatures related to humoral response among healthy older subjects following seasonal influenza vaccination, we studied 94 healthy adults (50–74 years old) who received one documented dose of licensed trivalent influenza vaccine containing the A/California/7/2009 (H1N1)-like virus strain. Influenza-specific antibody (HAI) titer in serum samples and next-generation sequencing on PBMCs were performed using blood samples collected prior to (Day 0) and at two timepoints after (Days 3 and 28) vaccination. We identified a number of uncharacterized genes (ZNF300, NUP1333, KLK1 and others) and confirmed previous studies demonstrating specific genes/genesets that are important mediators of host immune responses and that displayed associations with antibody response to influenza A/H1N1 vaccine. These included interferon-regulatory transcription factors (IRF1/IRF2/IRF6/IRF7/IRF9), chemokine/chemokine receptors (CCR5/CCR9/CCL5), cytokine/cytokine receptors (IFNG/IL10RA/TNFRSF1A), protein kinases (MAP2K4/MAPK3), growth factor receptor (TGFBR1). The identification of gene signatures associated with antibody response represents an early stage in the science for which further research is needed. Such research may assist in the design of better vaccines to facilitate improved defenses against new influenza virus strains, as well as better understanding the genetic drivers of immune responses.
doi:10.1016/j.heliyon.2016.e00098
PMCID: PMC4946173  PMID: 27441275
Genetics; Immunology
17.  Profiles of influenza A/H1N1 vaccine response using hemagglutination-inhibition titers  
To identify distinct antibody profiles among adults 50-to-74 years old using influenza A/H1N1 HI titers up to 75 days after vaccination. Healthy subjects 50 to 74 years old received the 2010-2011 trivalent inactivated influenza vaccine. We measured venous samples from Days 0, 28, and 75 for HI and VNA and B-cell ELISPOTs. Of 106 subjects, HI titers demonstrated a ceiling effect for 11 or 10% for those with a pre-vaccination HI titer of 1:640 where no subject post-vaccination had an increase in titer. Of the remaining 95 subjects, only 37 or 35% overall had at least a 4-fold increase by Day 28. Of these 37, 3 waned at least 4-fold, and 13 others 2-fold. Thus 15% of the subjects showed waning antibody titers by Day 75. More than half failed to respond at all. The profiles populated by these subjects as defined by HI did not vary with age or gender. The VNA results mimicked the HI profiles, but the profiles for B-cell ELISPOT did not. HI titers at Days 0, 28, and 75 populate 4 biologically plausible profiles. Limitations include lack of consensus for operationally defining waning as well as for the apparent ceiling. Furthermore, though well accepted as a marker for vaccine response, assigning thresholds with HI has limitations. However, VNA closely matches HI in populating these profiles. Thus, we hold that these profiles, having face- and content-validity, may provide a basis for understanding variation in genomic and transcriptomic response to influenza vaccination in this age group.
doi:10.1080/21645515.2015.1011990
PMCID: PMC4514374  PMID: 25835513
aging; antibodies; hemagglutinin glycoproteins; hemagglutination inhibition tests; H1N1 subtype; influenza vaccines; influenza a virus; influenza virus; viral
18.  System-Wide Associations between DNA-Methylation, Gene Expression, and Humoral Immune Response to Influenza Vaccination 
PLoS ONE  2016;11(3):e0152034.
Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50–74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant’s propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.
doi:10.1371/journal.pone.0152034
PMCID: PMC4816338  PMID: 27031986
19.  Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination 
The Journal of Infectious Diseases  2014;211(6):898-905.
Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work.
doi:10.1093/infdis/jiu553
PMCID: PMC4351364  PMID: 25293367
genome-wide association study; polymorphism; genetic; humoral; neutralizing antibody; immunity; measles-mumps-rubella vaccine
20.  Immunosenescence-Related Transcriptomic and Immunologic Changes in Older Individuals Following Influenza Vaccination 
The goal of annual influenza vaccination is to reduce mortality and morbidity associated with this disease through the generation of protective immune responses. The objective of the current study was to examine markers of immunosenescence and identify immunosenescence-related differences in gene expression, gene regulation, cytokine secretion, and immunologic changes in an older study population receiving seasonal influenza A/H1N1 vaccination. Surprisingly, prior studies in this cohort revealed weak correlations between immunosenescence markers and humoral immune response to vaccination. In this report, we further examined the relationship of each immunosenescence marker (age, T cell receptor excision circle frequency, telomerase expression, percentage of CD28− CD4+ T cells, percentage of CD28− CD8+ T cells, and the CD4/CD8 T cell ratio) with additional markers of immune response (serum cytokine and chemokine expression) and measures of gene expression and/or regulation. Many of the immunosenescence markers indeed correlated with distinct sets of individual DNA methylation sites, miRNA expression levels, mRNA expression levels, serum cytokines, and leukocyte subsets. However, when the individual immunosenescence markers were grouped by pathways or functional terms, several shared biological functions were identified: antigen processing and presentation pathways, MAPK, mTOR, TCR, BCR, and calcium signaling pathways, as well as key cellular metabolic, proliferation and survival activities. Furthermore, the percent of CD4+ and/or CD8+ T cells lacking CD28 expression also correlated with miRNAs regulating clusters of genes known to be involved in viral infection. Integrated (DNA methylation, mRNA, miRNA, and protein levels) network biology analysis of immunosenescence-related pathways and genesets identified both known pathways (e.g., chemokine signaling, CTL, and NK cell activity), as well as a gene expression module not previously annotated with a known function. These results may improve our ability to predict immune responses to influenza and aid in new vaccine development, and highlight the need for additional studies to better define and characterize immunosenescence.
doi:10.3389/fimmu.2016.00450
PMCID: PMC5089977  PMID: 27853459
aging; DNA methylation; gene expression profiling; immunity; influenza A/H1N1 virus; influenza vaccines; miRNA
21.  Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines 
Immunogenetics  2014;66(11):663-669.
Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.
doi:10.1007/s00251-014-0796-z
PMCID: PMC4198472  PMID: 25139337
SNPs; Polymorphisms; Rubella vaccine; Measles vaccine; Neutralizing antibodies; Cytokines
22.  Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination 
Human genetics  2014;133(11):1407-1417.
Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.
doi:10.1007/s00439-014-1471-z
PMCID: PMC4249927  PMID: 25098560
Polymorphism; Genetic; Polymorphism; Single Nucleotide; Cytokines; Receptor; Cytokine; Immunity; Cellular; Measles-Mumps-Rubella Vaccine; MMR
23.  Asthma Status and Waning of Measles Antibody Concentrations after Measles Immunization 
Background
Asthmatics have increased risks of common and serious microbial infections including vaccine preventable diseases. Little is known about whether asthma influences waning of humoral immunity. We assessed whether asthma status influences waning of anti-measles virus antibody concentrations over time.
Methods
The study utilized a cross-sectional study cohort of healthy children who had been immunized with one-dose of MMR-II at age approximately 15 months. Between 5 and 12 years of age, measles vaccine virus-specific antibody (IgG) values were measured by EIA and considered seropositive if the EIA index unit was ≥ 1. The medical records were reviewed to determine asthma status during the first 18 years of life by applying predetermined criteria for asthma. A least squares regression model was used to evaluate the effect of asthma status on the relationship between measles antibody titer and time elapsed between the initial measles vaccination and measurement of measles antibody concentrations.
Results
Of the 838 eligible children, 281 (34%) met criteria for asthma. Measles antibody waned over time (r=-0.19, p<0.001), specifically more rapidly in asthmatics (r=-0.30, p<0.001, a decrease of -0.114 unit per year) than non-asthmatics (r=-0.13, p=0.002, a decrease of -0.046 unit per year) (p-value for interaction=0.010). This differential waning rate resulted in a lower mean (SD) measles antibody concentration [1.42 (0.67) vs. 1.67 (0.69), p=0.008] and lower seropositivity rate (73% vs. 84%, p=0.038) in asthmatics than non-asthmatics starting around 9.3 years after the initial measles vaccination.
Conclusion
Asthma status is associated with waning kinetics of measles antibody among children.
doi:10.1097/INF.0000000000000375
PMCID: PMC4216609  PMID: 24830696
Asthma; epidemiology; humoral immunity; waning; measles
24.  HLA Alleles Associated with the Adaptive Immune Response to Smallpox Vaccine: A Replication Study 
Human genetics  2014;133(9):1083-1092.
Background
We previously reported HLA allelic associations with vaccinia virus (VACV)-induced adaptive immune responses in a cohort of healthy individuals (n= 1,071 subjects) after a single dose of the licensed smallpox (Dryvax) vaccine. This study demonstrated that specific HLA alleles were significantly associated with VACV-induced neutralizing antibody (NA) titers and cytokine immune responses, including HLA-B (*13:02, *38:02, *44:03, *48:01), HLA-DQB1 (*03:02, *06:04) and HLA-DRB1 (*01:03, *03:01, *10:01, *13:01, *15:01), respectively.
Methods
We undertook an independent study of 1,053 healthy individuals and examined associations between HLA alleles and measures of adaptive immunity after a single dose of Dryvax-derived ACAM2000 vaccine in order to evaluate previously discovered HLA allelic associations from the Dryvax study and determine if these associations are replicated with ACAM2000.
Results
Females had significantly higher NA titers than male subjects in both study cohorts (median ID50 discovery cohort 159 [93, 256] vs. 125 [75, 186], p<0.001; replication cohort 144 [82, 204] vs. 110 [61, 189], p=0.024). The association between the DQB1*03:02 allele (median ID50 discovery cohort 152, p=0.015; replication cohort 134, p=0.010) and higher NA titers was replicated. Two HLA associations of comparable magnitudes were consistently found between DRB1*04:03 and DRB1*08:01 alleles and IFN-γ ELISPOT responses. The association between the DRB1*15:01 allele with IFN-γ secretion was also replicated (median pg/mL discovery cohort 182, p=0.052; replication cohort 203, p=0.014).
Conclusions
Our results suggest that smallpox vaccine-induced adaptive immune responses are significantly influenced by HLA gene polymorphisms. These data provide information for functional studies and design of novel candidate smallpox vaccines.
doi:10.1007/s00439-014-1449-x
PMCID: PMC4127812  PMID: 24880604
Smallpox vaccine; Vaccinia virus; HLA alleles; Neutralizing antibody titer; ELISPOT; cytokines; Human Leukocyte Antigen; Polymorphism, Smallpox Vaccine; Vaccinia Virus; Genetic Predisposition to Disease; Interferon-gamma; Viral Vaccines; Genetic Variation; Enzyme-Linked Immunospot Assay; European Continental Ancestry Group; African-Americans
25.  Genome-wide SNP Associations with Rubella-Specific Cytokine Responses in Measles-Mumps-Rubella Vaccine Recipients 
Immunogenetics  2014;66(0):493-499.
Genetic polymorphisms are known to affect responses to both viral infection and vaccination. Our previous work has described genetic polymorphisms significantly associated with variations in immune response to rubella vaccine from multiple gene families with known immune function, including: HLA, cytokine and cytokine receptor genes, and in genes controlling innate and adaptive immunity. In this study, we assessed cellular immune responses (IFNγ and IL-6) in a cohort of healthy younger individuals and performed genome wide SNP analysis on these same individuals. Here, we report the first genome-wide association study focused on immune responses following rubella vaccination. Our results indicate that rs16928280 in PTPRD (protein tyrosine phosphatase delta) and a collection of SNPs in ACO1 (encoding an iron regulatory protein) are associated with inter-individual variations in IFNγ response to rubella virus stimulation. In contrast, we did not identify any significant genetic associations with rubella-specific IL-6 response. These genetic regions may influence rubella vaccine-induced IFNγ responses and warrant further studies in additional cohorts in order to confirm these findings.
doi:10.1007/s00251-014-0776-3
PMCID: PMC4096048  PMID: 24811271
Genome-Wide Association Study; Polymorphism; Genetic; Cytokines; Receptor; Cytokine; Immunity; Cellular; Measles-Mumps-Rubella Vaccine; MMR

Results 1-25 (144)