PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (110)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
more »
1.  Leptin and Leptin-Related Gene Polymorphisms, Obesity, and Influenza A/H1N1 Vaccine–Induced Immune Responses in Older Individuals 
Vaccine  2013;32(7):881-887.
Obesity is a risk factor for complicated influenza A/H1N1 disease and poor vaccine immunogenicity. Leptin, an adipocyte-derived hormone/cytokine, has many immune regulatory functions and therefore could explain susceptibility to infections and poor vaccine outcomes. We recruited 159 healthy adults (5074 years old) who were immunized with inactivated TIV influenza vacci–ne that contained A/California/7/2009/H1N1 virus. We found a strong correlation between leptin concentration and BMI (r=0.55, p<0.0001), but no association with hemagglutination antibody inhibition (HAI), B-cell, or granzyme B responses. We found a slight correlation between leptin concentration and an immunosenescence marker (TREC: T-cell receptor excision circles) level (r=0.23, p=0.01). We found eight SNPs in the LEP/LEPR/GHRL genes that were associated with leptin levels and four SNPs in the PTPN1/LEPR/STAT3 genes associated with peripheral blood TREC levels (p<0.05). Heterozygosity of the synonymous variant rs2230604 in the PTPN1 gene was associated with a significantly lower (531 vs. 259, p = 0.005) TREC level, as compared to the homozygous major variant. We also found eight SNPs in the LEP/PPARG/CRP genes associated with variations in influenza-specific HAI and B-cell responses (p<0.05). Our results suggest that specific allelic variations in the leptin-related genes may influence adaptive immune responses to influenza vaccine.
doi:10.1016/j.vaccine.2013.12.009
PMCID: PMC3922536  PMID: 24360890
Influenza Vaccines; Influenza A Virus; H1N1 Subtype; Immunity; Polymorphism; Single Nucleotide; Receptors; Leptin; Obesity; Adipose Tissue; Overweight; Aging; Adult; Adipocytes; A/H1N1 virus; immune response; SNPs; obese; immunosenescence; BMI
2.  Characterization of Humoral and Cellular Immunity to Rubella Vaccine in Four Distinct Cohorts 
Immunologic research  2014;58(1):1-8.
Although vaccination campaigns have significantly reduced the global burden of rubella disease, there are still regional outbreaks and cases of congenital rubella syndrome (CRS). Rubella vaccination elicits a strong humoral, as well as cellular, response. The relationship between these two measures in response to rubella vaccine is poorly understood. We have previously reported no correlation between rubella virus-specific cytokine secretion and IgG antibody levels after rubella vaccination. In the current study, we extend our previous work to report correlations between secreted cytokines and functional neutralizing antibodies after rubella vaccination in four distinct cohorts. There was evidence of significant differences (p <0.05) in rubella virus-specific humoral and cellular responses between cohorts. When investigating relationships between rubella vaccine-specific humoral and cellular immunity, we observed a significant correlation between neutralizing antibodies and IFN-γ (rs = 0.21, p = 0.0004). We also observed correlations in subjects with extreme humoral immune phenotypes and IFN-γ levels in two of the four cohorts (rs = 0.32, p = 0.01; rs = 0.36, p = 0.01, respectively). These findings indicate that there is a high level of heterogeneity in rubella-specific immune responses between study populations. We believe that the novel correlation discovered between IFN-γ and neutralizing antibody titers will give future insight into the functional mechanisms of immunity induced by rubella virus and other live viral vaccines.
doi:10.1007/s12026-013-8475-y
PMCID: PMC4212652  PMID: 24375276
Cytokines; Antibodies; MMR; Immunity; Humoral; Cellular; Polymorphism, Single Nucleotide; Cytokines; Receptors, Cytokine; Antibodies; Measles-Mumps-Rubella Vaccine; Immunity; Immunity, Humoral; Immunity, Cellular
3.  Granzyme B ELISPOT assay to measure influenza-specific cellular immunity 
Journal of immunological methods  2013;0:10.1016/j.jim.2013.09.007.
The immunogenicity and efficacy of influenza vaccination is markedly lower in the elderly. Granzyme B (GrzB), quantified in fresh cell lysates, has been suggested to be a marker of cytotoxic T lymphocyte (CTL) response and a predictor of influenza illness among vaccinated older individuals. We have developed an influenza-specific GrzB ELISPOT assay using cryopreserved PBMCs. This method was tested on 106 healthy older subjects (age 50-74) at baseline (Day 0) and three additional time points post-vaccination (Day 3, Day 28, Day 75) with influenza A/H1N1-containing vaccine. No significant difference was seen in GrzB response between any of the time points, although influenza-specific GrzB response appears to be elevated at all post-vaccination time points. There was no correlation between GrzB response and hemagglutination inhibition (HAI) titers, indicating no relationship between the cytolytic activity and humoral antibody levels in this cohort. Additionally, a significant negative correlation between GrzB response and age was observed. These results reveal a reduction in influenza-specific GrzB response as one ages. In conclusion, we have developed and optimized an influenza-specific ELISPOT assay for use with frozen cells to quantify the CTL-specific serine protease GrzB, as a measure of cellular immunity after influenza vaccination.
doi:10.1016/j.jim.2013.09.007
PMCID: PMC3840047  PMID: 24055591
Granzyme B; cytotoxic T lymphocytes (CTL); ELISPOT; influenza virus; cellular immunity; Granzymes; Killer Cells; Natural; Perforin; T-Lymphocytes; Cytotoxic; Enzyme-Linked Immunospot Assay; Influenza; Human; Viruses; Immunuity; Cellular
4.  Genetic Variation in IL18R1 and IL18 Genes and Inteferon γ ELISPOT Response to Smallpox Vaccination: An Unexpected Relationship 
The Journal of Infectious Diseases  2013;208(9):1422-1430.
Background. Genetic association studies demonstrated a role for cytokine proteins and cytokine or cytokine receptor gene polymorphisms in smallpox vaccine–induced adaptive immunity.
Methods. We examined the association of genetic polymorphisms with cellular (interferon [IFN] γ enzyme-linked immunospot assay [ELISPOT]) immune response to smallpox vaccine in 1076 immunized individuals.
Results. The majority of significant associations were discovered between single-nucleotide polymorphisms/haplotypes in IL18R1 and IL18 genes, in which we previously reported an association with vaccinia virus–induced neutralizing antibody titers in this study cohort. A functional coding IL18R1 polymorphism (rs1035130/Phe251Phe; P = .01) was significantly associated with an allele dose-related increase in IFN-γ production and was also associated with vaccinia-specific neutralizing antibody titers. Significant associations were also found between IL18R1 haplotypes and variations in IFN-γ ELISPOT responses (global P < .0001).
Conclusions. Our data suggest the importance of variants in the IL18R1 and IL18 genetic loci for broad-based smallpox vaccine–induced adaptive immunity.
doi:10.1093/infdis/jit341
PMCID: PMC3789570  PMID: 23901078
Polymorphism; single nucleotide; smallpox vaccine; vaccinia virus; interleukin-18; interleukin-18 receptor alpha subunit; haplotypes; genetic predisposition to disease; interferon-gamma; viral vaccines; genetic variation; enzyme-linked immunospot assay; european continental ancestry group; African-Americans
5.  Race and Sex-Based Differences in Cytokine Immune Responses to Smallpox Vaccine in Healthy Individuals 
Human immunology  2013;74(10):1263-1266.
We assessed the effects of sex, race and ethnicity on smallpox vaccine-induced immune responses in 1,071 armed forces members after primary Dryvax® smallpox vaccination, including 790 males and 281 females; 580 Caucasians, 217 African-Americans, and 217 Hispanics. Analysis of vaccinia-specific cytokine responses revealed that Caucasians had higher total IFNγ ELISPOT responses (median 57 spot-forming units/SFUs per 200,000 cells, p=0.01) and CD8+IFNγ ELISPOT responses (12 SFUs, p<0.001) than African-Americans (51 and 4 SFUs, respectively) and Hispanics (47 and 8 SFUs, respectively). Similarly, Caucasians secreted higher levels of vaccinia-specific IL-2 (p=0.003) and IFNα (p<0.001) compared to other racial/ethnic groups. Males had higher total IFNγ ELISPOT responses (median 55 SFUs) compared to females (41 SFUs, p<0.001). We observed statistically significant sex-related differences in the secretion of IL-2 (p<0.001), IL-1β (p<0.001) and IL-10 (p=0.017). These data suggest that vaccinia-specific cytokine responses following primary smallpox vaccination are significantly influenced by race and sex of vaccinees.
doi:10.1016/j.humimm.2013.06.031
PMCID: PMC4170575  PMID: 23806267
Smallpox Vaccine; Cytokine; Cellular Immunity; Race; Sex; Smallpox Vaccine; Cytokines; Immunity, Cellular; Sex; Hispanics; African Americans; Whites
6.  Genome-Wide Analysis of Polymorphisms Associated with Cytokine Responses in Smallpox Vaccine Recipients 
Human genetics  2012;131(9):1403-1421.
The role that genetics plays in response to infection or disease is becoming increasingly clear as we learn more about immunogenetics and host-pathogen interactions. Here we report a genome-wide analysis of the effects of host genetic variation on cytokine responses to vaccinia virus stimulation in smallpox vaccine recipients. Our data show that vaccinia stimulation of immune individuals results in secretion of inflammatory and Th1 cytokines. We identified multiple SNPs significantly associated with variations in cytokine secretion. These SNPs are found in genes with known immune function, as well as in genes encoding for proteins involved in signal transduction, cytoskeleton, membrane channels and ion transport, as well as others with no previously identified connection to immune responses. The large number of significant SNP associations implies that cytokine secretion in response to vaccinia virus is a complex process controlled by multiple genes and gene families. Follow-up studies to replicate these findings and then pursue mechanistic studies will provide a greater understanding of how genetic variation influences vaccine responses.
doi:10.1007/s00439-012-1174-2
PMCID: PMC4170585  PMID: 22610502
smallpox vaccine; vaccinia; GWAS; genome-wide association; SNP; immune response; cytokines
7.  Genome-Wide Genetic Associations with IFNγ Response to Smallpox Vaccine 
Human genetics  2012;131(9):1433-1451.
Smallpox is a deadly and debilitating disease that killed hundreds of millions of people in the past century alone. The use of vaccinia-virus based smallpox vaccines led to the eradication of smallpox. These vaccines are remarkably effective, inducing the characteristic pustule or “take” at the vaccine site in > 97% of recipients, and inducing a wide spectrum of long-lasting humoral and cellular immune responses. The mechanisms behind inter-individual vaccine response variability are likely to involve host genetic variation, but have not been fully characterized. We report here the first smallpox vaccine-response genome-wide association study of over 1,000 recent recipients of Dryvax®. The data presented here focus on cellular immune responses as measured by both production of secreted IFNγ and quantitation of IFNγ secreting cells by ELISPOT assay. We identified multiple significant SNP associations in genes (RASA1, ADRA1D, TCF7L1, FAS) that are critical components of signaling pathways that directly control lymphocyte IFNγ production or cytotoxic T cell function. Similarly, we found many associations with SNPs located in genes integral to nerve cell function; findings that, given the complex interplay between the nervous and immune systems, deserve closer examination in follow-up studies.
doi:10.1007/s00439-012-1179-x
PMCID: PMC4170655  PMID: 22661280
smallpox vaccine; vaccinia virus; genome-wide association study; single nucleotide polymorphism; interferon-gamma
8.  Asthma and the immune response to MMR vaccine viruses in Somali immigrant children: a cross-sectional retrospective cohort study 
Background
According to the `hygiene hypothesis', an increase in microbial exposure in childhood leads to a T-helper cell 1 (Th1) predominant immune response and protection against asthma and atopic conditions.
Aims
To assess the prevalence of asthma and other atopic conditions in Somali immigrants and to determine the humoral immune response to the measles, mumps, and rubella (MMR) vaccine viruses in Somali immigrants with asthma.
Methods
A retrospective cohort study was conducted in Olmsted County, Minnesota. Study subjects were Somali immigrants who were born and lived in Africa during childhood and immigrated to the USA. The subjects had participated in a previous MMR vaccine study. Asthma was ascertained using predetermined asthma criteria after a thorough medical record review. An atopic condition was determined from physician-diagnosed ICD codes. Virus-specific IgG levels in response to the MMR vaccine viruses were determined using an enzyme immunoassay.
Results
Of the 62 eligible subjects, 33 (53%) were female and 29 (47%) were male; 10 (16%) had asthma and 22 (35%) had other atopic conditions. There was no difference in the rubella (p=0.150) and measles (p=0.715) virus-specific IgG levels between the subjects with and without asthma. Mumps virus-specific IgG antibody levels were lower in those with asthma than in those without asthma (mean±SE 2.08±0.28 vs. 3.06±0.14, p=0.005).
Conclusions
Our study results may not support the hygiene hypothesis. In addition, the previously reported abnormal T-cell development in Caucasian children with atopy can be considered even in Somali immigrants.
doi:10.4104/pcrj.2013.00039
PMCID: PMC3914143  PMID: 23636585
asthma; hygiene hypothesis; immunity; measles; mumps; rubella
9.  High-Throughput Assay Optimization and Statistical Interpolation of Rubella-Specific Neutralizing Antibody Titers 
Rubella remains a social and economic burden due to the high incidence of congenital rubella syndrome (CRS) in some countries. For this reason, an accurate and efficient high-throughput measure of antibody response to vaccination is an important tool. In order to measure rubella-specific neutralizing antibodies in a large cohort of vaccinated individuals, a high-throughput immunocolorimetric system was developed. Statistical interpolation models were applied to the resulting titers to refine quantitative estimates of neutralizing antibody titers relative to the assayed neutralizing antibody dilutions. This assay, including the statistical methods developed, can be used to assess the neutralizing humoral immune response to rubella virus and may be adaptable for assessing the response to other viral vaccines and infectious agents.
doi:10.1128/CVI.00681-13
PMCID: PMC3957678  PMID: 24391140
10.  Associations between Single Nucleotide Polymorphisms in Cellular Viral Receptors and Attachment Factor-Related Genes and Humoral Immunity to Rubella Vaccination 
PLoS ONE  2014;9(6):e99997.
Background
Viral attachment and cell entry host factors are important for viral replication, pathogenesis, and the generation and sustenance of immune responses after infection and/or vaccination, and are plausible genetic regulators of vaccine-induced immunity.
Methods
Using a tag-SNP approach in candidate gene study, we assessed the role of selected cell surface receptor genes, attachment factor-related genes, along with other immune genes in the genetic control of immune response variations after live rubella vaccination in two independent study cohorts.
Results
Our analysis revealed evidence for multiple associations between genetic variants in the PVR, PVRL2, CD209/DC-SIGN, RARB, MOG, IL6 and other immune function-related genes and rubella-specific neutralizing antibodies after vaccination (meta p-value <0.05).
Conclusion
Our results indicate that multiple SNPs from genes involved in cell adhesion, viral attachment, and viral entry, as well as others in genes involved in signaling and/or immune response regulation, play a role in modulating humoral immune responses following live rubella vaccination.
doi:10.1371/journal.pone.0099997
PMCID: PMC4063777  PMID: 24945853
11.  Vaccinomics, adversomics, and the immune response network theory: Individualized vaccinology in the 21st century 
Seminars in immunology  2013;25(2):89-103.
Vaccines, like drugs and medical procedures, are increasingly amenable to individualization or personalization, often based on novel data resulting from high throughput “omics” technologies. As a result of these technologies, 21st century vaccinology will increasingly see the abandonment of a “one size fits all” approach to vaccine dosing and delivery, as well as the abandonment of the empiric “isolate–inactivate–inject” paradigm for vaccine development. In this review, we discuss the immune response network theory and its application to the new field of vaccinomics and adversomics, and illustrate how vaccinomics can lead to new vaccine candidates, new understandings of how vaccines stimulate immune responses, new biomarkers for vaccine response, and facilitate the understanding of what genetic and other factors might be responsible for rare side effects due to vaccines. Perhaps most exciting will be the ability, at a systems biology level, to integrate increasingly complex high throughput data into descriptive and predictive equations for immune responses to vaccines. Herein, we discuss the above with a view toward the future of vaccinology.
doi:10.1016/j.smim.2013.04.007
PMCID: PMC3752773  PMID: 23755893
Adaptive immunity; Biotechnology; Computational biology; Genomics; Immunogenetics; Individualized medicine; Proteomics; Systems biology; Vaccination; Vaccines; Modeling; Vaccinomics; Adversomics; Predictive equation; Immune response network theory; Individualized vaccinology
12.  Associations between Polymorphisms in the Antiviral TRIM Genes and Measles Vaccine Immunity 
Human immunology  2013;74(6):768-774.
The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×105 PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r2≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic −2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses.
Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.
doi:10.1016/j.humimm.2013.01.031
PMCID: PMC3644318  PMID: 23416095
Single-nucleotide polymorphisms; measles virus; measles vaccine immunity; TRIM genes; antiviral; innate; antibody; cytokines; Elispot; Caucasians; African-Americans
13.  Leptin-based Adjuvants: An Innovative Approach to Improve Vaccine Response 
Vaccine  2013;31(13):1666-1672.
Leptin is a pleiotropic hormone with multiple direct and regulatory immune functions. Leptin deficiency or resistance hinders the immunologic, metabolic, and neuroendocrinologic processes necessary to thwart infections and their associated complications, and to possibly protect against infectious diseases following vaccination. Circulating leptin levels are proportional to body fat mass. High circulating leptin concentrations, as observed in obesity, are indicative of the development of leptin transport saturation/signaling desensitization. Leptin bridges nutritional status and immunity. Although its role in vaccine response is currently unknown, over-nutrition has been shown to suppress vaccine-induced immune responses. For instance, obesity (BMI ≥ 30 kg/m2) is associated with lower antigen-specific antibody titers following influenza, hepatitis B, and tetanus vaccinations. This suggests that obesity, and possibly saturable leptin levels, are contributing factors to poor vaccine immunogenicity. While leptin-based therapies have not been investigated as vaccine adjuvants thus far, leptin’s role in immunity suggests that application of these therapies is promising and worth investigation to enhance vaccine response in people with leptin signaling impairments. This review will examine the possibility of using leptin as a vaccine adjuvant by: briefly reviewing the distribution and signal transduction of leptin and its receptors; discussing the physiology of leptin with emphasis on its immune functions; reviewing the causes of attenuation of leptin signaling; and finally, providing plausible inferences for the innovative use of leptin-based pharmacotherapies as vaccine adjuvants.
doi:10.1016/j.vaccine.2013.01.032
PMCID: PMC3596421  PMID: 23370154
Adipokines; Leptin; Adjuvant; Receptors, Leptin; Vaccines; Obesity; Infectious Diseases; Communicable Diseases
14.  Assessment of humoral and cell-mediated immune response to measles–mumps–rubella vaccine viruses among patients with asthma 
Little is known about the influence of asthma status on humoral and cell-mediated immune responses to measles–mumps–rubella (MMR) vaccine viruses. We compared the virus-specific IgG levels and lymphoproliferative response of peripheral blood mononuclear cells to MMR vaccine viruses between asthmatic and nonasthmatic patients. The study subjects included 342 healthy children aged 12–18 years who had received two doses of the MMR vaccine. We ascertained asthma status by applying predetermined criteria. Of the 342 subjects, 230 were available for this study of whom 25 were definite asthmatic patients (10.9%) and the rest of subjects were nonasthmatic patients. The mean of the log-transformed lymphoproliferative responses between definite asthma and nonasthma who had a family history of asthma were for measles, 0.92 ± 0.31 versus 1.54 ± 0.17 (p = 0.125); for mumps, 0.98 ± 0.64 versus 2.20 ± 0.21 (p = 0.035); and for rubella, 0.12 ± 0.37 versus 0.97 ± 0.16 (p = 0.008), respectively, adjusting for the duration between the first MMR vaccination and determination of the immune responses. There were no such differences among children without a family history of asthma. MMR virus–specific IgG levels were not different between study subjects with or without asthma. The study findings suggest asthmatic patients may have a suboptimal cell-mediated immune response to MMR vaccine viruses and a family history of asthma modifies this effect.
doi:10.2500/aap.2010.31.3399
PMCID: PMC3941466  PMID: 21708062
15.  Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine 
Vaccine  2011;29(48):8988-8997.
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans.
Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20.
In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.
doi:10.1016/j.vaccine.2011.09.043
PMCID: PMC3941984  PMID: 21939710
Single Nucleotide Polymorphisms; Haplotypes; Antiviral genes; Measles vaccine; Immunity
16.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response
17.  Differential Cellular Immune Responses to Wild-Type and Attenuated Edmonston Tag Measles Virus Strains Are Primarily Defined by the Viral Phosphoprotein Gene 
Journal of medical virology  2010;82(11):1966-1975.
The measles virus phosphoprotein (P) gene encodes the P, V, and C proteins, which have multiple functions including type I interferon (IFN) inhibition. With a focus on viral immune modulation, we conducted a study on healthy vaccinees (n = 179) to compare cytokine secretion patterns/cell frequencies and gene expression after in vitro encounter with a highly attenuated strain of measles virus (MVEdmtag), wild-type MV (MVwt) or recombinant MVEdmtag expressing the wild-type P gene (MVwtP). Cytokines were quantified by ELISA and Elispot. Gene expression profiling was performed using real-time PCR. We found differential MV-specific cytokine responses to all detected cytokines characterized by significantly higher cytokine levels (P <0.001) and higher frequencies (P <0.0001) of cytokine-producing cells after stimulation with the highly attenuated MVEdm-tag strain in comparison with MVwt or MVwtP. Furthermore, gene expression profiling revealed significant cytokine suppression at the transcriptional level for viruses encoding the functional wt P gene, compared to attenuated MVEdmtag (P <0.05). Using lentivirus-mediated stable expression of P gene-encoded proteins in human cell lines, we demonstrated that the expression of the functional wt V protein significantly down-modulated the induction of IFNs type I, II, and III in lymphocytes and monocytes. Taken together our results indicate that Th1, Th2, and innate/inflammatory cytokine responses in vaccinees are suppressed both at the protein and transcriptional level by viruses expressing the functional wt P gene products. The functional P gene-encoded viral proteins (particularly V proteins) emerge as crucial immune evasion factors for modulating and shaping the measles virus-specific cytokine responses in humans.
doi:10.1002/jmv.21899
PMCID: PMC3924428  PMID: 20872725
measles virus; P gene; MMR vaccine; cellular immunity; cytokines; gene expression
19.  Human Leukocyte Antigens and Cellular Immune Responses to Anthrax Vaccine Adsorbed 
Infection and Immunity  2013;81(7):2584-2591.
Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a “heterozygote advantage.” Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.
doi:10.1128/IAI.00269-13
PMCID: PMC3697592  PMID: 23649091
20.  Transcriptomic Profiles of High and Low Antibody Responders to Smallpox Vaccine 
Genes and immunity  2013;14(5):277-285.
Despite its eradication over 30 years ago, smallpox (as well as other orthopoxviruses) remains a pathogen of interest both in terms of biodefense and for its use as a vector for vaccines and immunotherapies. Here we describe the application of mRNA-Seq transcriptome profiling to understanding immune responses in smallpox vaccine recipients. Contrary to other studies examining gene expression in virally infected cell lines, we utilized a mixed population of PBMCs in order to capture the essential intercellular interactions that occur in vivo and would otherwise be lost using single cell lines or isolated primary cell subsets. In this mixed cell population we were able to detect expression of all annotated vaccinia genes. On the host side, a number of genes encoding cytokines, chemokines, complement factors, and intracellular signaling molecules were downregulated upon viral infection, while genes encoding histone proteins and the interferon response were upregulated. We also identified a small number of genes that exhibited significantly different expression profiles in subjects with robust humoral immunity compared to those with weaker humoral responses. Our results provide evidence that differential gene regulation patterns may be at work in individuals with robust humoral immunity compared to those with weaker humoral immune responses.
doi:10.1038/gene.2013.14
PMCID: PMC3723701  PMID: 23594957
Next Generation Sequencing; mRNA-Seq; Vaccinia virus; Smallpox vaccine; High-Throughput Nucleotide Sequencing; Genome, Human; Gene Expression Profiling; Sequence Analysis, RNA; Transcriptome
21.  ReliefSeq: A Gene-Wise Adaptive-K Nearest-Neighbor Feature Selection Tool for Finding Gene-Gene Interactions and Main Effects in mRNA-Seq Gene Expression Data 
PLoS ONE  2013;8(12):e81527.
Relief-F is a nonparametric, nearest-neighbor machine learning method that has been successfully used to identify relevant variables that may interact in complex multivariate models to explain phenotypic variation. While several tools have been developed for assessing differential expression in sequence-based transcriptomics, the detection of statistical interactions between transcripts has received less attention in the area of RNA-seq analysis. We describe a new extension and assessment of Relief-F for feature selection in RNA-seq data. The ReliefSeq implementation adapts the number of nearest neighbors (k) for each gene to optimize the Relief-F test statistics (importance scores) for finding both main effects and interactions. We compare this gene-wise adaptive-k (gwak) Relief-F method with standard RNA-seq feature selection tools, such as DESeq and edgeR, and with the popular machine learning method Random Forests. We demonstrate performance on a panel of simulated data that have a range of distributional properties reflected in real mRNA-seq data including multiple transcripts with varying sizes of main effects and interaction effects. For simulated main effects, gwak-Relief-F feature selection performs comparably to standard tools DESeq and edgeR for ranking relevant transcripts. For gene-gene interactions, gwak-Relief-F outperforms all comparison methods at ranking relevant genes in all but the highest fold change/highest signal situations where it performs similarly. The gwak-Relief-F algorithm outperforms Random Forests for detecting relevant genes in all simulation experiments. In addition, Relief-F is comparable to the other methods based on computational time. We also apply ReliefSeq to an RNA-Seq study of smallpox vaccine to identify gene expression changes between vaccinia virus-stimulated and unstimulated samples. ReliefSeq is an attractive tool for inclusion in the suite of tools used for analysis of mRNA-Seq data; it has power to detect both main effects and interaction effects. Software Availability: http://insilico.utulsa.edu/ReliefSeq.php.
doi:10.1371/journal.pone.0081527
PMCID: PMC3858248  PMID: 24339943
22.  Calculating Sample Size Estimates for RNA Sequencing Data 
Journal of Computational Biology  2013;20(12):970-978.
Abstract
Background
Given the high technical reproducibility and orders of magnitude greater resolution than microarrays, next-generation sequencing of mRNA (RNA-Seq) is quickly becoming the de facto standard for measuring levels of gene expression in biological experiments. Two important questions must be taken into consideration when designing a particular experiment, namely, 1) how deep does one need to sequence? and, 2) how many biological replicates are necessary to observe a significant change in expression?
Results
Based on the gene expression distributions from 127 RNA-Seq experiments, we find evidence that 91% ± 4% of all annotated genes are sequenced at a frequency of 0.1 times per million bases mapped, regardless of sample source. Based on this observation, and combining this information with other parameters such as biological variation and technical variation that we empirically estimate from our large datasets, we developed a model to estimate the statistical power needed to identify differentially expressed genes from RNA-Seq experiments.
Conclusions
Our results provide a needed reference for ensuring RNA-Seq gene expression studies are conducted with the optimally sample size, power, and sequencing depth. We also make available both R code and an Excel worksheet for investigators to calculate for their own experiments.
doi:10.1089/cmb.2012.0283
PMCID: PMC3842884  PMID: 23961961
23.  Impact of Cytokine and Cytokine Receptor Gene Polymorphisms on Cellular Immunity after Smallpox Vaccination 
Gene  2012;510(1):59-65.
We explored associations between SNPs in cytokine/cytokine receptor genes and cellular immunity in subjects following primary smallpox vaccination. We also analyzed the genotype-phenotype associations discovered in the Caucasian subjects among a cohort of African-Americans. In Caucasians we found 277 associations (p<0.05) between gene SNPs and inter-individual variations in IFN-α, IL-12p40, IL-1β, IL-2, and TNF-α secretion levels. A collection of SNPs in the IL1RN, IL2RB, IL4R, IL6, IL10RB, IL12A, and IL12RB2 genes had consistent associations among both Caucasians and African-Americans. A regulatory SNP (rs452204) in the IL1RN gene was significantly associated with higher levels of IL-2 secretion in an allele dose-dependent manner in both race groups (p=0.05 for Caucasians and p=0.002 for African-Americans). IL12RB2 polymorphism rs3790567 was associated with a dose-related decrease in IL-1β secretion (p=0.009 for Caucasians and p=0.01 for African-Americans). Our results demonstrate that variations in smallpox vaccine-induced cytokine responses are modulated by genetic polymorphisms in cytokine and cytokine receptor genes.
doi:10.1016/j.gene.2012.08.021
PMCID: PMC3463724  PMID: 23009887
Immunogenetics; SNPs; Smallpox Vaccine; Cytokine; Cytokine Receptor; Cellular Immunity; Caucasians; African-Americans
24.  High-Dimensional Gene Expression Profiling Studies in High and Low Responders to Primary Smallpox Vaccination 
The Journal of Infectious Diseases  2012;206(10):1512-1520.
Background. The mechanisms underlying smallpox vaccine-induced variations in immune responses are not well understood, but are of considerable interest to a deeper understanding of poxvirus immunity and correlates of protection.
Methods. We assessed transcriptional messenger RNA expression changes in 197 recipients of primary smallpox vaccination representing the extremes of humoral and cellular immune responses.
Results. The 20 most significant differentially expressed genes include a tumor necrosis factor–receptor superfamily member, an interferon (IFN) gene, a chemokine gene, zinc finger protein genes, nuclear factors, and histones (P ≤ 1.06E−20, q ≤ 2.64E−17). A pathway analysis identified 4 enriched pathways with cytokine production by the T-helper 17 subset of CD4+ T cells being the most significant pathway (P = 3.42E−05). Two pathways (antiviral actions of IFNs, P = 8.95E−05; and IFN-α/β signaling pathway, P = 2.92E−04), integral to innate immunity, were enriched when comparing high with low antibody responders (false discovery rate, < 0.05). Genes related to immune function and transcription (TLR8, P = .0002; DAPP1, P = .0003; LAMP3, P = 9.96E−05; NR4A2, P ≤ .0002; EGR3, P = 4.52E−05), and other genes with a possible impact on immunity (LNPEP, P = 3.72E−05; CAPRIN1, P = .0001; XRN1, P = .0001), were found to be expressed differentially in high versus low antibody responders.
Conclusion. We identified novel and known immunity-related genes and pathways that may account for differences in immune response to smallpox vaccination.
doi:10.1093/infdis/jis546
PMCID: PMC3475634  PMID: 22949304
25.  The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches 
Expert review of vaccines  2013;12(1):57-70.
The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of ‘vaccinomics’ for novel vaccine development.
doi:10.1586/erv.12.134
PMCID: PMC3570049  PMID: 23256739
adaptive immunity; genetic association studies; human leukocyte antigens; immunogenetics; measles vaccine; single nucleotide polymorphisms

Results 1-25 (110)