PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (72)
 

Clipboard (0)
None

Select a Filter Below

Year of Publication
more »
1.  Leptin and Leptin-Related Gene Polymorphisms, Obesity, and Influenza A/H1N1 Vaccine–Induced Immune Responses in Older Individuals 
Vaccine  2013;32(7):881-887.
Obesity is a risk factor for complicated influenza A/H1N1 disease and poor vaccine immunogenicity. Leptin, an adipocyte-derived hormone/cytokine, has many immune regulatory functions and therefore could explain susceptibility to infections and poor vaccine outcomes. We recruited 159 healthy adults (5074 years old) who were immunized with inactivated TIV influenza vacci–ne that contained A/California/7/2009/H1N1 virus. We found a strong correlation between leptin concentration and BMI (r=0.55, p<0.0001), but no association with hemagglutination antibody inhibition (HAI), B-cell, or granzyme B responses. We found a slight correlation between leptin concentration and an immunosenescence marker (TREC: T-cell receptor excision circles) level (r=0.23, p=0.01). We found eight SNPs in the LEP/LEPR/GHRL genes that were associated with leptin levels and four SNPs in the PTPN1/LEPR/STAT3 genes associated with peripheral blood TREC levels (p<0.05). Heterozygosity of the synonymous variant rs2230604 in the PTPN1 gene was associated with a significantly lower (531 vs. 259, p = 0.005) TREC level, as compared to the homozygous major variant. We also found eight SNPs in the LEP/PPARG/CRP genes associated with variations in influenza-specific HAI and B-cell responses (p<0.05). Our results suggest that specific allelic variations in the leptin-related genes may influence adaptive immune responses to influenza vaccine.
doi:10.1016/j.vaccine.2013.12.009
PMCID: PMC3922536  PMID: 24360890
Influenza Vaccines; Influenza A Virus; H1N1 Subtype; Immunity; Polymorphism; Single Nucleotide; Receptors; Leptin; Obesity; Adipose Tissue; Overweight; Aging; Adult; Adipocytes; A/H1N1 virus; immune response; SNPs; obese; immunosenescence; BMI
2.  Granzyme B ELISPOT assay to measure influenza-specific cellular immunity 
Journal of immunological methods  2013;0:10.1016/j.jim.2013.09.007.
The immunogenicity and efficacy of influenza vaccination is markedly lower in the elderly. Granzyme B (GrzB), quantified in fresh cell lysates, has been suggested to be a marker of cytotoxic T lymphocyte (CTL) response and a predictor of influenza illness among vaccinated older individuals. We have developed an influenza-specific GrzB ELISPOT assay using cryopreserved PBMCs. This method was tested on 106 healthy older subjects (age 50-74) at baseline (Day 0) and three additional time points post-vaccination (Day 3, Day 28, Day 75) with influenza A/H1N1-containing vaccine. No significant difference was seen in GrzB response between any of the time points, although influenza-specific GrzB response appears to be elevated at all post-vaccination time points. There was no correlation between GrzB response and hemagglutination inhibition (HAI) titers, indicating no relationship between the cytolytic activity and humoral antibody levels in this cohort. Additionally, a significant negative correlation between GrzB response and age was observed. These results reveal a reduction in influenza-specific GrzB response as one ages. In conclusion, we have developed and optimized an influenza-specific ELISPOT assay for use with frozen cells to quantify the CTL-specific serine protease GrzB, as a measure of cellular immunity after influenza vaccination.
doi:10.1016/j.jim.2013.09.007
PMCID: PMC3840047  PMID: 24055591
Granzyme B; cytotoxic T lymphocytes (CTL); ELISPOT; influenza virus; cellular immunity; Granzymes; Killer Cells; Natural; Perforin; T-Lymphocytes; Cytotoxic; Enzyme-Linked Immunospot Assay; Influenza; Human; Viruses; Immunuity; Cellular
3.  Genetic Variation in IL18R1 and IL18 Genes and Inteferon γ ELISPOT Response to Smallpox Vaccination: An Unexpected Relationship 
The Journal of Infectious Diseases  2013;208(9):1422-1430.
Background. Genetic association studies demonstrated a role for cytokine proteins and cytokine or cytokine receptor gene polymorphisms in smallpox vaccine–induced adaptive immunity.
Methods. We examined the association of genetic polymorphisms with cellular (interferon [IFN] γ enzyme-linked immunospot assay [ELISPOT]) immune response to smallpox vaccine in 1076 immunized individuals.
Results. The majority of significant associations were discovered between single-nucleotide polymorphisms/haplotypes in IL18R1 and IL18 genes, in which we previously reported an association with vaccinia virus–induced neutralizing antibody titers in this study cohort. A functional coding IL18R1 polymorphism (rs1035130/Phe251Phe; P = .01) was significantly associated with an allele dose-related increase in IFN-γ production and was also associated with vaccinia-specific neutralizing antibody titers. Significant associations were also found between IL18R1 haplotypes and variations in IFN-γ ELISPOT responses (global P < .0001).
Conclusions. Our data suggest the importance of variants in the IL18R1 and IL18 genetic loci for broad-based smallpox vaccine–induced adaptive immunity.
doi:10.1093/infdis/jit341
PMCID: PMC3789570  PMID: 23901078
Polymorphism; single nucleotide; smallpox vaccine; vaccinia virus; interleukin-18; interleukin-18 receptor alpha subunit; haplotypes; genetic predisposition to disease; interferon-gamma; viral vaccines; genetic variation; enzyme-linked immunospot assay; european continental ancestry group; African-Americans
4.  Race and Sex-Based Differences in Cytokine Immune Responses to Smallpox Vaccine in Healthy Individuals 
Human immunology  2013;74(10):1263-1266.
We assessed the effects of sex, race and ethnicity on smallpox vaccine-induced immune responses in 1,071 armed forces members after primary Dryvax® smallpox vaccination, including 790 males and 281 females; 580 Caucasians, 217 African-Americans, and 217 Hispanics. Analysis of vaccinia-specific cytokine responses revealed that Caucasians had higher total IFNγ ELISPOT responses (median 57 spot-forming units/SFUs per 200,000 cells, p=0.01) and CD8+IFNγ ELISPOT responses (12 SFUs, p<0.001) than African-Americans (51 and 4 SFUs, respectively) and Hispanics (47 and 8 SFUs, respectively). Similarly, Caucasians secreted higher levels of vaccinia-specific IL-2 (p=0.003) and IFNα (p<0.001) compared to other racial/ethnic groups. Males had higher total IFNγ ELISPOT responses (median 55 SFUs) compared to females (41 SFUs, p<0.001). We observed statistically significant sex-related differences in the secretion of IL-2 (p<0.001), IL-1β (p<0.001) and IL-10 (p=0.017). These data suggest that vaccinia-specific cytokine responses following primary smallpox vaccination are significantly influenced by race and sex of vaccinees.
doi:10.1016/j.humimm.2013.06.031
PMCID: PMC4170575  PMID: 23806267
Smallpox Vaccine; Cytokine; Cellular Immunity; Race; Sex; Smallpox Vaccine; Cytokines; Immunity, Cellular; Sex; Hispanics; African Americans; Whites
5.  Genome-Wide Analysis of Polymorphisms Associated with Cytokine Responses in Smallpox Vaccine Recipients 
Human genetics  2012;131(9):1403-1421.
The role that genetics plays in response to infection or disease is becoming increasingly clear as we learn more about immunogenetics and host-pathogen interactions. Here we report a genome-wide analysis of the effects of host genetic variation on cytokine responses to vaccinia virus stimulation in smallpox vaccine recipients. Our data show that vaccinia stimulation of immune individuals results in secretion of inflammatory and Th1 cytokines. We identified multiple SNPs significantly associated with variations in cytokine secretion. These SNPs are found in genes with known immune function, as well as in genes encoding for proteins involved in signal transduction, cytoskeleton, membrane channels and ion transport, as well as others with no previously identified connection to immune responses. The large number of significant SNP associations implies that cytokine secretion in response to vaccinia virus is a complex process controlled by multiple genes and gene families. Follow-up studies to replicate these findings and then pursue mechanistic studies will provide a greater understanding of how genetic variation influences vaccine responses.
doi:10.1007/s00439-012-1174-2
PMCID: PMC4170585  PMID: 22610502
smallpox vaccine; vaccinia; GWAS; genome-wide association; SNP; immune response; cytokines
6.  Genome-Wide Genetic Associations with IFNγ Response to Smallpox Vaccine 
Human genetics  2012;131(9):1433-1451.
Smallpox is a deadly and debilitating disease that killed hundreds of millions of people in the past century alone. The use of vaccinia-virus based smallpox vaccines led to the eradication of smallpox. These vaccines are remarkably effective, inducing the characteristic pustule or “take” at the vaccine site in > 97% of recipients, and inducing a wide spectrum of long-lasting humoral and cellular immune responses. The mechanisms behind inter-individual vaccine response variability are likely to involve host genetic variation, but have not been fully characterized. We report here the first smallpox vaccine-response genome-wide association study of over 1,000 recent recipients of Dryvax®. The data presented here focus on cellular immune responses as measured by both production of secreted IFNγ and quantitation of IFNγ secreting cells by ELISPOT assay. We identified multiple significant SNP associations in genes (RASA1, ADRA1D, TCF7L1, FAS) that are critical components of signaling pathways that directly control lymphocyte IFNγ production or cytotoxic T cell function. Similarly, we found many associations with SNPs located in genes integral to nerve cell function; findings that, given the complex interplay between the nervous and immune systems, deserve closer examination in follow-up studies.
doi:10.1007/s00439-012-1179-x
PMCID: PMC4170655  PMID: 22661280
smallpox vaccine; vaccinia virus; genome-wide association study; single nucleotide polymorphism; interferon-gamma
7.  Associations between Single Nucleotide Polymorphisms in Cellular Viral Receptors and Attachment Factor-Related Genes and Humoral Immunity to Rubella Vaccination 
PLoS ONE  2014;9(6):e99997.
Background
Viral attachment and cell entry host factors are important for viral replication, pathogenesis, and the generation and sustenance of immune responses after infection and/or vaccination, and are plausible genetic regulators of vaccine-induced immunity.
Methods
Using a tag-SNP approach in candidate gene study, we assessed the role of selected cell surface receptor genes, attachment factor-related genes, along with other immune genes in the genetic control of immune response variations after live rubella vaccination in two independent study cohorts.
Results
Our analysis revealed evidence for multiple associations between genetic variants in the PVR, PVRL2, CD209/DC-SIGN, RARB, MOG, IL6 and other immune function-related genes and rubella-specific neutralizing antibodies after vaccination (meta p-value <0.05).
Conclusion
Our results indicate that multiple SNPs from genes involved in cell adhesion, viral attachment, and viral entry, as well as others in genes involved in signaling and/or immune response regulation, play a role in modulating humoral immune responses following live rubella vaccination.
doi:10.1371/journal.pone.0099997
PMCID: PMC4063777  PMID: 24945853
8.  Vaccinomics, adversomics, and the immune response network theory: Individualized vaccinology in the 21st century 
Seminars in immunology  2013;25(2):89-103.
Vaccines, like drugs and medical procedures, are increasingly amenable to individualization or personalization, often based on novel data resulting from high throughput “omics” technologies. As a result of these technologies, 21st century vaccinology will increasingly see the abandonment of a “one size fits all” approach to vaccine dosing and delivery, as well as the abandonment of the empiric “isolate–inactivate–inject” paradigm for vaccine development. In this review, we discuss the immune response network theory and its application to the new field of vaccinomics and adversomics, and illustrate how vaccinomics can lead to new vaccine candidates, new understandings of how vaccines stimulate immune responses, new biomarkers for vaccine response, and facilitate the understanding of what genetic and other factors might be responsible for rare side effects due to vaccines. Perhaps most exciting will be the ability, at a systems biology level, to integrate increasingly complex high throughput data into descriptive and predictive equations for immune responses to vaccines. Herein, we discuss the above with a view toward the future of vaccinology.
doi:10.1016/j.smim.2013.04.007
PMCID: PMC3752773  PMID: 23755893
Adaptive immunity; Biotechnology; Computational biology; Genomics; Immunogenetics; Individualized medicine; Proteomics; Systems biology; Vaccination; Vaccines; Modeling; Vaccinomics; Adversomics; Predictive equation; Immune response network theory; Individualized vaccinology
9.  Associations between Polymorphisms in the Antiviral TRIM Genes and Measles Vaccine Immunity 
Human immunology  2013;74(6):768-774.
The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×105 PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r2≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic −2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses.
Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.
doi:10.1016/j.humimm.2013.01.031
PMCID: PMC3644318  PMID: 23416095
Single-nucleotide polymorphisms; measles virus; measles vaccine immunity; TRIM genes; antiviral; innate; antibody; cytokines; Elispot; Caucasians; African-Americans
10.  Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine 
Vaccine  2011;29(48):8988-8997.
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans.
Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20.
In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.
doi:10.1016/j.vaccine.2011.09.043
PMCID: PMC3941984  PMID: 21939710
Single Nucleotide Polymorphisms; Haplotypes; Antiviral genes; Measles vaccine; Immunity
11.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response
12.  Differential Cellular Immune Responses to Wild-Type and Attenuated Edmonston Tag Measles Virus Strains Are Primarily Defined by the Viral Phosphoprotein Gene 
Journal of medical virology  2010;82(11):1966-1975.
The measles virus phosphoprotein (P) gene encodes the P, V, and C proteins, which have multiple functions including type I interferon (IFN) inhibition. With a focus on viral immune modulation, we conducted a study on healthy vaccinees (n = 179) to compare cytokine secretion patterns/cell frequencies and gene expression after in vitro encounter with a highly attenuated strain of measles virus (MVEdmtag), wild-type MV (MVwt) or recombinant MVEdmtag expressing the wild-type P gene (MVwtP). Cytokines were quantified by ELISA and Elispot. Gene expression profiling was performed using real-time PCR. We found differential MV-specific cytokine responses to all detected cytokines characterized by significantly higher cytokine levels (P <0.001) and higher frequencies (P <0.0001) of cytokine-producing cells after stimulation with the highly attenuated MVEdm-tag strain in comparison with MVwt or MVwtP. Furthermore, gene expression profiling revealed significant cytokine suppression at the transcriptional level for viruses encoding the functional wt P gene, compared to attenuated MVEdmtag (P <0.05). Using lentivirus-mediated stable expression of P gene-encoded proteins in human cell lines, we demonstrated that the expression of the functional wt V protein significantly down-modulated the induction of IFNs type I, II, and III in lymphocytes and monocytes. Taken together our results indicate that Th1, Th2, and innate/inflammatory cytokine responses in vaccinees are suppressed both at the protein and transcriptional level by viruses expressing the functional wt P gene products. The functional P gene-encoded viral proteins (particularly V proteins) emerge as crucial immune evasion factors for modulating and shaping the measles virus-specific cytokine responses in humans.
doi:10.1002/jmv.21899
PMCID: PMC3924428  PMID: 20872725
measles virus; P gene; MMR vaccine; cellular immunity; cytokines; gene expression
13.  Human Leukocyte Antigens and Cellular Immune Responses to Anthrax Vaccine Adsorbed 
Infection and Immunity  2013;81(7):2584-2591.
Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a “heterozygote advantage.” Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.
doi:10.1128/IAI.00269-13
PMCID: PMC3697592  PMID: 23649091
14.  Transcriptomic Profiles of High and Low Antibody Responders to Smallpox Vaccine 
Genes and immunity  2013;14(5):277-285.
Despite its eradication over 30 years ago, smallpox (as well as other orthopoxviruses) remains a pathogen of interest both in terms of biodefense and for its use as a vector for vaccines and immunotherapies. Here we describe the application of mRNA-Seq transcriptome profiling to understanding immune responses in smallpox vaccine recipients. Contrary to other studies examining gene expression in virally infected cell lines, we utilized a mixed population of PBMCs in order to capture the essential intercellular interactions that occur in vivo and would otherwise be lost using single cell lines or isolated primary cell subsets. In this mixed cell population we were able to detect expression of all annotated vaccinia genes. On the host side, a number of genes encoding cytokines, chemokines, complement factors, and intracellular signaling molecules were downregulated upon viral infection, while genes encoding histone proteins and the interferon response were upregulated. We also identified a small number of genes that exhibited significantly different expression profiles in subjects with robust humoral immunity compared to those with weaker humoral responses. Our results provide evidence that differential gene regulation patterns may be at work in individuals with robust humoral immunity compared to those with weaker humoral immune responses.
doi:10.1038/gene.2013.14
PMCID: PMC3723701  PMID: 23594957
Next Generation Sequencing; mRNA-Seq; Vaccinia virus; Smallpox vaccine; High-Throughput Nucleotide Sequencing; Genome, Human; Gene Expression Profiling; Sequence Analysis, RNA; Transcriptome
15.  Impact of Cytokine and Cytokine Receptor Gene Polymorphisms on Cellular Immunity after Smallpox Vaccination 
Gene  2012;510(1):59-65.
We explored associations between SNPs in cytokine/cytokine receptor genes and cellular immunity in subjects following primary smallpox vaccination. We also analyzed the genotype-phenotype associations discovered in the Caucasian subjects among a cohort of African-Americans. In Caucasians we found 277 associations (p<0.05) between gene SNPs and inter-individual variations in IFN-α, IL-12p40, IL-1β, IL-2, and TNF-α secretion levels. A collection of SNPs in the IL1RN, IL2RB, IL4R, IL6, IL10RB, IL12A, and IL12RB2 genes had consistent associations among both Caucasians and African-Americans. A regulatory SNP (rs452204) in the IL1RN gene was significantly associated with higher levels of IL-2 secretion in an allele dose-dependent manner in both race groups (p=0.05 for Caucasians and p=0.002 for African-Americans). IL12RB2 polymorphism rs3790567 was associated with a dose-related decrease in IL-1β secretion (p=0.009 for Caucasians and p=0.01 for African-Americans). Our results demonstrate that variations in smallpox vaccine-induced cytokine responses are modulated by genetic polymorphisms in cytokine and cytokine receptor genes.
doi:10.1016/j.gene.2012.08.021
PMCID: PMC3463724  PMID: 23009887
Immunogenetics; SNPs; Smallpox Vaccine; Cytokine; Cytokine Receptor; Cellular Immunity; Caucasians; African-Americans
16.  High-Dimensional Gene Expression Profiling Studies in High and Low Responders to Primary Smallpox Vaccination 
The Journal of Infectious Diseases  2012;206(10):1512-1520.
Background. The mechanisms underlying smallpox vaccine-induced variations in immune responses are not well understood, but are of considerable interest to a deeper understanding of poxvirus immunity and correlates of protection.
Methods. We assessed transcriptional messenger RNA expression changes in 197 recipients of primary smallpox vaccination representing the extremes of humoral and cellular immune responses.
Results. The 20 most significant differentially expressed genes include a tumor necrosis factor–receptor superfamily member, an interferon (IFN) gene, a chemokine gene, zinc finger protein genes, nuclear factors, and histones (P ≤ 1.06E−20, q ≤ 2.64E−17). A pathway analysis identified 4 enriched pathways with cytokine production by the T-helper 17 subset of CD4+ T cells being the most significant pathway (P = 3.42E−05). Two pathways (antiviral actions of IFNs, P = 8.95E−05; and IFN-α/β signaling pathway, P = 2.92E−04), integral to innate immunity, were enriched when comparing high with low antibody responders (false discovery rate, < 0.05). Genes related to immune function and transcription (TLR8, P = .0002; DAPP1, P = .0003; LAMP3, P = 9.96E−05; NR4A2, P ≤ .0002; EGR3, P = 4.52E−05), and other genes with a possible impact on immunity (LNPEP, P = 3.72E−05; CAPRIN1, P = .0001; XRN1, P = .0001), were found to be expressed differentially in high versus low antibody responders.
Conclusion. We identified novel and known immunity-related genes and pathways that may account for differences in immune response to smallpox vaccination.
doi:10.1093/infdis/jis546
PMCID: PMC3475634  PMID: 22949304
17.  The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches 
Expert review of vaccines  2013;12(1):57-70.
The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of ‘vaccinomics’ for novel vaccine development.
doi:10.1586/erv.12.134
PMCID: PMC3570049  PMID: 23256739
adaptive immunity; genetic association studies; human leukocyte antigens; immunogenetics; measles vaccine; single nucleotide polymorphisms
18.  Response surface methodology to determine optimal measles-specific cytokine responses in human peripheral blood mononuclear cells 
Journal of Immunological Methods  2012;382(1-2):220-223.
Limitations of assay variability, labor costs, and availability of cells can affect the conduct of large population-based studies. The ability to determine optimal conditions for laboratory assessment of immune outcomes, including measurement of cytokines, can reduce the number of peripheral blood mononuclear cells (PBMCs) needed, reduce the labor costs involved, and the variability in secreted cytokine response by pooling cytokines from the same cell culture supernatant. Previously, we used response surface methodology to predict optimal conditions for vaccinia virus-stimulated cytokine responses in recipients of smallpox vaccine. Here we apply the same approach for a measles vaccine study.
PBMCs were collected from vaccinated subjects, and seven cytokines (IFN-γ, IL-2, TNF-α, IL-10, IFN-α, IFN-λ1, and IL-6) involved in measles virus-specific cytokine immune responses were examined. PBMCs were stimulated with differing multiplicity of infection (MOI) and days in culture (incubation time). Response surface methodology was used to select the optimal MOI and incubation time for each secreted cytokine.
Our results demonstrate that each cytokine’s optimal conditions (MOI and incubation time) differ for each virus (measles vs. vaccinia) and each cytokine’s optimal conditions for each virus can be predicted using response surface methodology. These conditions allow for cytokines with overlapping optimal conditions to be pooled from the same supernatant in culture to reduce the number of PBMCs used, the costs involved, and assay variability. Therefore, response surface methodology is an effective technique that can be used to optimize antigen-specific secreted cytokines prior to population-based studies.
doi:10.1016/j.jim.2012.06.004
PMCID: PMC3399242  PMID: 22705088
Response surface methodology; measles virus; vaccinia virus; cytokine; ELISA
19.  Genome-Wide Association Study of Antibody Response to Smallpox Vaccine 
Vaccine  2012;30(28):4182-4189.
We performed a genome-wide association study (GWAS) of antibody levels in a multi-ethnic group of 1,071 healthy smallpox vaccine recipients. In Caucasians, the most prominent association was found with promoter SNP rs10489759 in the LOC647132 pseudogene on chromosome 1 (p=7.77 × 10-8). In African-Americans, we identified eight genetic loci at p< 5 × 10-7. The SNP association with the lowest p-value (rs10508727, p=1.05 × 10-10) was in the Mohawk homeobox (MKX) gene on chromosome 10. Other candidate genes included LOC388460, GPR158, ZHX2, SPIRE1, GREM2, CSMD1, and RUNX1. In Hispanics, the top six associations between genetic variants and antibody levels had p-values less than 5 × 10-7, with p=1.78 × 10-10 for the strongest statistical association (promoter SNP rs12256830 in the PCDH15 gene). In addition, SNP rs4748153 in the immune response gene PRKCQ (protein kinase C, theta) was significantly associated with neutralizing antibody levels (p=2.51 × 10-8). Additional SNP associations in Hispanics (p ≤3.40 × 10-7) were mapped to the KIF6/LOC100131899, CYP2C9, and ANKLE2/GOLGA3 genes. This study has identified candidate SNPs that may be important in regulating humoral immunity to smallpox vaccination. Replication studies, as well as studies elucidating the functional consequences of contributing genes and polymorphisms, are underway.
doi:10.1016/j.vaccine.2012.04.055
PMCID: PMC3367131  PMID: 22542470
GWAS; Smallpox Vaccine; Vaccinia Virus; Humoral Immunity; Immunogenetics; SNPs
20.  Replication of Associations between Cytokine and Cytokine Receptor Single Nucleotide Polymorphisms and Measles-Specific Adaptive Immunophenotypic Extremes 
Human Immunology  2012;73(6):636-640.
Our objective was to replicate previously reported associations between cytokine and cytokine receptor SNPs and humoral and CMI (cell-mediated immune) responses to measles vaccine. All subjects (n=758) received two doses of MMR (measles/mumps/rubella) vaccine. From these subjects, candidate cytokine and cytokine receptor SNPs were genotyped and analyzed in 29–30 subjects falling into one of four “extreme” humoral (Abhigh/low) and CMI (CMIhigh/low) response quadrants. Associations between seven SNPs (out of 11 in the discovery study) and measles-specific neutralizing antibody levels and IFN-γ ELISPOT responses were evaluated using chi-square tests. We found one replicated association for SNP rs372889 in the IL12RB1 gene (P=0.03 for AbhighCMIhigh versus AblowCMIlow). Our findings demonstrate the importance of replicating genotypic-phenotypic associations, which can be achieved using immunophenotypic extremes and smaller sample sizes. We speculate that IL12RB1 polymorphisms may affect IL-12 and IL-23 binding and downstream effects, which are critical cytokines in the CMI response to measles vaccine.
doi:10.1016/j.humimm.2012.03.015
PMCID: PMC3368081  PMID: 22504412
Measles immunity; SNP; Cytokine Receptor; IL12RB1; Replication Study
21.  Understanding the immune response to seasonal influenza vaccination in older adults: a systems biology approach 
Expert review of vaccines  2012;11(8):985-994.
Annual vaccination against seasonal influenza is recommended to decrease disease-related mortality and morbidity. However, one population that responds suboptimally to influenza vaccine is adults over the age of 65 years. The natural aging process is associated with a complex deterioration of multiple components of the host immune system. Research into this phenomenon, known as immunosenescence, has shown that aging alters both the innate and adaptive branches of the immune system. The intricate mechanisms involved in immune response to influenza vaccine, and how these responses are altered with age, have led us to adopt a more encompassing systems biology approach to understand exactly why the response to vaccination diminishes with age. Here, the authors review what changes occur with immunosenescence, and some immunogenetic factors that influence response, and outline the systems biology approach to understand the immune response to seasonal influenza vaccination in older adults.
doi:10.1586/erv.12.61
PMCID: PMC3514506  PMID: 23002979
bioinformatics; immunogenetics; immunosenescence; influenza; seasonal influenza vaccine; systems biology; vaccinomics; vaccine-induced immunity
22.  Independence of Measles-Specific Humoral and Cellular Immune Responses to Vaccination 
Human Immunology  2012;73(5):474-479.
With a larger, independent cohort and more sophisticated measures, we sought to confirm our work that indicated independence of humoral and cellular immunity following measles vaccination. We recruited an age-stratified random cohort of 764 healthy subjects from all socio-economic strata, all with medical-record documentation of two age-appropriate doses of measles-containing vaccine. We quantified measles-specific neutralizing antibody levels and assayed the IFN-γ ELISPOT response to measles virus. We also measured secreted cytokines from the PBMCs in response to measles virus by performing enzyme-linked immunosorbent assays as secondary measures of cellular immune status. The median antibody level and median IFN-γ ELISPOT response were 844 mIU/mL (IQR: 418 to 1,752) and 36 (IQR: 13.00 to 69.00) spot-forming cells (per 2×105 PBMCs), respectively. We found only a very weak and negative correlation [Spearman’s rs or rho of −0.090 (95 percent confidence interval −0.162 to −0.018)]. We found a similar lack of quantitatively important correlations between the neutralizing antibody level and any of the secondary measures. Our data confirm the independence of humoral and cellular immune responses after the second dose of measles vaccination. As researchers pursue novel measles vaccine and measles vaccine delivery systems, they must not infer that humoral responses predict cellular responses.
doi:10.1016/j.humimm.2012.02.016
PMCID: PMC3338862  PMID: 22406060
Measles Vaccine; Immunity, Humoral; Immunity, Cellular; Antibody Formation; Cytokines
23.  Multigenic Control of Measles Vaccine Immunity Mediated by Polymorphisms in Measles Receptor, Innate Pathway, and Cytokine Genes 
Vaccine  2012;30(12):2159-2167.
Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5,7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.
doi:10.1016/j.vaccine.2012.01.025
PMCID: PMC3288471  PMID: 22265947
measles vaccine; immunogenetics; vaccine response; multigenic SNP association; interferon response; cytokines; Toll-like receptors
24.  Consistency of HLA Associations between Two Independent Measles Vaccine Cohorts: A Replication Study 
Vaccine  2012;30(12):2146-2152.
Associations between HLA genotypes and measles vaccine humoral and cellular immune responses were examined to better understand immunogenetic drivers of vaccine response. Two independent study cohorts of healthy schoolchildren were examined: cohort one, 346 children between 12–18 years of age; and cohort two, 388 children between 11–19 years of age. All received two age-appropriate doses of measles-containing vaccine. The purpose of this study was to identify and replicate associations between HLA genes and immune responses following measles vaccination found in our first cohort. Associations of comparable magnitudes and with similar p-values were observed between B*3503 (1st cohort p=0.01; 2nd cohort p=0.07), DQA1*0201 (1st cohort p=0.03; 2nd cohort p=0.03), DQB1*0303 (1st cohort p=0.10; 2nd cohort p=0.02), DQB1*0602 (1st cohort p=0.07; 2nd cohort p=0.10), and DRB1*0701 (1st cohort p=0.03; 2nd cohort p=0.07) alleles and measles-specific antibody levels. Suggestive, yet consistent, associations were observed between the B7(1 st cohort p=0.01; 2nd cohort p=0.08) supertype and higher measles antibody levels in both cohorts. Also, in both cohorts, the B*0801 and DRB1*0301 alleles, C*0802 and DPA1*0202 alleles, and DRB1*1303 alleles displayed consistent associations with variations in IFN-γ, IL-2 and IL-10 secretion, respectively. This study emphasizes the importance of replicating HLA associations with measles vaccine-induced humoral and cellular immune responses and increases confidence in the results. These data will inform strategies for functional studies and novel vaccine development, including epitope-based measles vaccines. This is the first HLA association replication study with measles vaccine-specific immune responses to date.
doi:10.1016/j.vaccine.2012.01.038
PMCID: PMC3288791  PMID: 22285888
Measles vaccine; HLA genotypes; Haplotypes; Antibodies; Cytokines; Replication study
25.  Associations Between Demographic Variables and Multiple Measles-Specific Innate and Cell-Mediated Immune Responses After Measles Vaccination 
Viral Immunology  2012;25(1):29-36.
Abstract
Measles remains a public health concern due to a lack of vaccine use and vaccine failure. A better understanding of the factors that influence variations in immune responses, including innate/inflammatory and adaptive cellular immune responses, following measles-mumps-rubella (MMR) vaccination could increase our knowledge of measles vaccine-induced immunity and potentially lead to better vaccines. Measles-specific innate/inflammatory and adaptive cell-mediated immune (CMI) responses were characterized using enzyme-linked immunosorbent assays to quantify the levels of secreted IL-2, IL-6, IL-10, IFN-α, IFN-γ, IFN-λ1, and TNF-α in PBMC cultures following in vitro stimulation with measles virus (MV) in a cohort of 764 school-aged children. IFN-γ ELISPOT assays were performed to ascertain the number of measles-specific IFN-γ-secreting cells. Cytokine responses were then tested for associations with self-declared demographic data, including gender, race, and ethnicity. Females secreted significantly more TNF-α, IL-6, and IFN-α (p<0.001, p<0.002, p<0.04, respectively) compared to males. Caucasians secreted significantly more IFN-λ1, IL-10, IL-2, TNF-α, IL-6, and IFN-α (p<0.001, p<0.001, p<0.001, p<0.003, p<0.01, and p<0.02, respectively) compared to the other racial groups combined. Additionally, Caucasians had a greater number of IFN-γ-secreting cells compared to other racial groups (p<0.001). Ethnicity was not significantly correlated with variations in measles-specific CMI measures. Our data suggest that innate/inflammatory and CMI cytokine responses to measles vaccine vary significantly by gender and race. These data further advance our understanding regarding inter-individual and subgroup variations in immune responses to measles vaccination.
doi:10.1089/vim.2011.0051
PMCID: PMC3271368  PMID: 22239234

Results 1-25 (72)