PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (63)
 

Clipboard (0)
None

Select a Filter Below

Year of Publication
1.  Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine 
Vaccine  2011;29(48):8988-8997.
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans.
Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20.
In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.
doi:10.1016/j.vaccine.2011.09.043
PMCID: PMC3941984  PMID: 21939710
Single Nucleotide Polymorphisms; Haplotypes; Antiviral genes; Measles vaccine; Immunity
2.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response
3.  Differential Cellular Immune Responses to Wild-Type and Attenuated Edmonston Tag Measles Virus Strains Are Primarily Defined by the Viral Phosphoprotein Gene 
Journal of medical virology  2010;82(11):1966-1975.
The measles virus phosphoprotein (P) gene encodes the P, V, and C proteins, which have multiple functions including type I interferon (IFN) inhibition. With a focus on viral immune modulation, we conducted a study on healthy vaccinees (n = 179) to compare cytokine secretion patterns/cell frequencies and gene expression after in vitro encounter with a highly attenuated strain of measles virus (MVEdmtag), wild-type MV (MVwt) or recombinant MVEdmtag expressing the wild-type P gene (MVwtP). Cytokines were quantified by ELISA and Elispot. Gene expression profiling was performed using real-time PCR. We found differential MV-specific cytokine responses to all detected cytokines characterized by significantly higher cytokine levels (P <0.001) and higher frequencies (P <0.0001) of cytokine-producing cells after stimulation with the highly attenuated MVEdm-tag strain in comparison with MVwt or MVwtP. Furthermore, gene expression profiling revealed significant cytokine suppression at the transcriptional level for viruses encoding the functional wt P gene, compared to attenuated MVEdmtag (P <0.05). Using lentivirus-mediated stable expression of P gene-encoded proteins in human cell lines, we demonstrated that the expression of the functional wt V protein significantly down-modulated the induction of IFNs type I, II, and III in lymphocytes and monocytes. Taken together our results indicate that Th1, Th2, and innate/inflammatory cytokine responses in vaccinees are suppressed both at the protein and transcriptional level by viruses expressing the functional wt P gene products. The functional P gene-encoded viral proteins (particularly V proteins) emerge as crucial immune evasion factors for modulating and shaping the measles virus-specific cytokine responses in humans.
doi:10.1002/jmv.21899
PMCID: PMC3924428  PMID: 20872725
measles virus; P gene; MMR vaccine; cellular immunity; cytokines; gene expression
4.  Human Leukocyte Antigens and Cellular Immune Responses to Anthrax Vaccine Adsorbed 
Infection and Immunity  2013;81(7):2584-2591.
Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a “heterozygote advantage.” Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.
doi:10.1128/IAI.00269-13
PMCID: PMC3697592  PMID: 23649091
5.  Transcriptomic Profiles of High and Low Antibody Responders to Smallpox Vaccine 
Genes and immunity  2013;14(5):277-285.
Despite its eradication over 30 years ago, smallpox (as well as other orthopoxviruses) remains a pathogen of interest both in terms of biodefense and for its use as a vector for vaccines and immunotherapies. Here we describe the application of mRNA-Seq transcriptome profiling to understanding immune responses in smallpox vaccine recipients. Contrary to other studies examining gene expression in virally infected cell lines, we utilized a mixed population of PBMCs in order to capture the essential intercellular interactions that occur in vivo and would otherwise be lost using single cell lines or isolated primary cell subsets. In this mixed cell population we were able to detect expression of all annotated vaccinia genes. On the host side, a number of genes encoding cytokines, chemokines, complement factors, and intracellular signaling molecules were downregulated upon viral infection, while genes encoding histone proteins and the interferon response were upregulated. We also identified a small number of genes that exhibited significantly different expression profiles in subjects with robust humoral immunity compared to those with weaker humoral responses. Our results provide evidence that differential gene regulation patterns may be at work in individuals with robust humoral immunity compared to those with weaker humoral immune responses.
doi:10.1038/gene.2013.14
PMCID: PMC3723701  PMID: 23594957
Next Generation Sequencing; mRNA-Seq; Vaccinia virus; Smallpox vaccine; High-Throughput Nucleotide Sequencing; Genome, Human; Gene Expression Profiling; Sequence Analysis, RNA; Transcriptome
6.  Impact of Cytokine and Cytokine Receptor Gene Polymorphisms on Cellular Immunity after Smallpox Vaccination 
Gene  2012;510(1):59-65.
We explored associations between SNPs in cytokine/cytokine receptor genes and cellular immunity in subjects following primary smallpox vaccination. We also analyzed the genotype-phenotype associations discovered in the Caucasian subjects among a cohort of African-Americans. In Caucasians we found 277 associations (p<0.05) between gene SNPs and inter-individual variations in IFN-α, IL-12p40, IL-1β, IL-2, and TNF-α secretion levels. A collection of SNPs in the IL1RN, IL2RB, IL4R, IL6, IL10RB, IL12A, and IL12RB2 genes had consistent associations among both Caucasians and African-Americans. A regulatory SNP (rs452204) in the IL1RN gene was significantly associated with higher levels of IL-2 secretion in an allele dose-dependent manner in both race groups (p=0.05 for Caucasians and p=0.002 for African-Americans). IL12RB2 polymorphism rs3790567 was associated with a dose-related decrease in IL-1β secretion (p=0.009 for Caucasians and p=0.01 for African-Americans). Our results demonstrate that variations in smallpox vaccine-induced cytokine responses are modulated by genetic polymorphisms in cytokine and cytokine receptor genes.
doi:10.1016/j.gene.2012.08.021
PMCID: PMC3463724  PMID: 23009887
Immunogenetics; SNPs; Smallpox Vaccine; Cytokine; Cytokine Receptor; Cellular Immunity; Caucasians; African-Americans
7.  High-Dimensional Gene Expression Profiling Studies in High and Low Responders to Primary Smallpox Vaccination 
The Journal of Infectious Diseases  2012;206(10):1512-1520.
Background. The mechanisms underlying smallpox vaccine-induced variations in immune responses are not well understood, but are of considerable interest to a deeper understanding of poxvirus immunity and correlates of protection.
Methods. We assessed transcriptional messenger RNA expression changes in 197 recipients of primary smallpox vaccination representing the extremes of humoral and cellular immune responses.
Results. The 20 most significant differentially expressed genes include a tumor necrosis factor–receptor superfamily member, an interferon (IFN) gene, a chemokine gene, zinc finger protein genes, nuclear factors, and histones (P ≤ 1.06E−20, q ≤ 2.64E−17). A pathway analysis identified 4 enriched pathways with cytokine production by the T-helper 17 subset of CD4+ T cells being the most significant pathway (P = 3.42E−05). Two pathways (antiviral actions of IFNs, P = 8.95E−05; and IFN-α/β signaling pathway, P = 2.92E−04), integral to innate immunity, were enriched when comparing high with low antibody responders (false discovery rate, < 0.05). Genes related to immune function and transcription (TLR8, P = .0002; DAPP1, P = .0003; LAMP3, P = 9.96E−05; NR4A2, P ≤ .0002; EGR3, P = 4.52E−05), and other genes with a possible impact on immunity (LNPEP, P = 3.72E−05; CAPRIN1, P = .0001; XRN1, P = .0001), were found to be expressed differentially in high versus low antibody responders.
Conclusion. We identified novel and known immunity-related genes and pathways that may account for differences in immune response to smallpox vaccination.
doi:10.1093/infdis/jis546
PMCID: PMC3475634  PMID: 22949304
8.  The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches 
Expert review of vaccines  2013;12(1):57-70.
The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of ‘vaccinomics’ for novel vaccine development.
doi:10.1586/erv.12.134
PMCID: PMC3570049  PMID: 23256739
adaptive immunity; genetic association studies; human leukocyte antigens; immunogenetics; measles vaccine; single nucleotide polymorphisms
9.  Response surface methodology to determine optimal measles-specific cytokine responses in human peripheral blood mononuclear cells 
Journal of Immunological Methods  2012;382(1-2):220-223.
Limitations of assay variability, labor costs, and availability of cells can affect the conduct of large population-based studies. The ability to determine optimal conditions for laboratory assessment of immune outcomes, including measurement of cytokines, can reduce the number of peripheral blood mononuclear cells (PBMCs) needed, reduce the labor costs involved, and the variability in secreted cytokine response by pooling cytokines from the same cell culture supernatant. Previously, we used response surface methodology to predict optimal conditions for vaccinia virus-stimulated cytokine responses in recipients of smallpox vaccine. Here we apply the same approach for a measles vaccine study.
PBMCs were collected from vaccinated subjects, and seven cytokines (IFN-γ, IL-2, TNF-α, IL-10, IFN-α, IFN-λ1, and IL-6) involved in measles virus-specific cytokine immune responses were examined. PBMCs were stimulated with differing multiplicity of infection (MOI) and days in culture (incubation time). Response surface methodology was used to select the optimal MOI and incubation time for each secreted cytokine.
Our results demonstrate that each cytokine’s optimal conditions (MOI and incubation time) differ for each virus (measles vs. vaccinia) and each cytokine’s optimal conditions for each virus can be predicted using response surface methodology. These conditions allow for cytokines with overlapping optimal conditions to be pooled from the same supernatant in culture to reduce the number of PBMCs used, the costs involved, and assay variability. Therefore, response surface methodology is an effective technique that can be used to optimize antigen-specific secreted cytokines prior to population-based studies.
doi:10.1016/j.jim.2012.06.004
PMCID: PMC3399242  PMID: 22705088
Response surface methodology; measles virus; vaccinia virus; cytokine; ELISA
10.  Genome-Wide Association Study of Antibody Response to Smallpox Vaccine 
Vaccine  2012;30(28):4182-4189.
We performed a genome-wide association study (GWAS) of antibody levels in a multi-ethnic group of 1,071 healthy smallpox vaccine recipients. In Caucasians, the most prominent association was found with promoter SNP rs10489759 in the LOC647132 pseudogene on chromosome 1 (p=7.77 × 10-8). In African-Americans, we identified eight genetic loci at p< 5 × 10-7. The SNP association with the lowest p-value (rs10508727, p=1.05 × 10-10) was in the Mohawk homeobox (MKX) gene on chromosome 10. Other candidate genes included LOC388460, GPR158, ZHX2, SPIRE1, GREM2, CSMD1, and RUNX1. In Hispanics, the top six associations between genetic variants and antibody levels had p-values less than 5 × 10-7, with p=1.78 × 10-10 for the strongest statistical association (promoter SNP rs12256830 in the PCDH15 gene). In addition, SNP rs4748153 in the immune response gene PRKCQ (protein kinase C, theta) was significantly associated with neutralizing antibody levels (p=2.51 × 10-8). Additional SNP associations in Hispanics (p ≤3.40 × 10-7) were mapped to the KIF6/LOC100131899, CYP2C9, and ANKLE2/GOLGA3 genes. This study has identified candidate SNPs that may be important in regulating humoral immunity to smallpox vaccination. Replication studies, as well as studies elucidating the functional consequences of contributing genes and polymorphisms, are underway.
doi:10.1016/j.vaccine.2012.04.055
PMCID: PMC3367131  PMID: 22542470
GWAS; Smallpox Vaccine; Vaccinia Virus; Humoral Immunity; Immunogenetics; SNPs
11.  Replication of Associations between Cytokine and Cytokine Receptor Single Nucleotide Polymorphisms and Measles-Specific Adaptive Immunophenotypic Extremes 
Human Immunology  2012;73(6):636-640.
Our objective was to replicate previously reported associations between cytokine and cytokine receptor SNPs and humoral and CMI (cell-mediated immune) responses to measles vaccine. All subjects (n=758) received two doses of MMR (measles/mumps/rubella) vaccine. From these subjects, candidate cytokine and cytokine receptor SNPs were genotyped and analyzed in 29–30 subjects falling into one of four “extreme” humoral (Abhigh/low) and CMI (CMIhigh/low) response quadrants. Associations between seven SNPs (out of 11 in the discovery study) and measles-specific neutralizing antibody levels and IFN-γ ELISPOT responses were evaluated using chi-square tests. We found one replicated association for SNP rs372889 in the IL12RB1 gene (P=0.03 for AbhighCMIhigh versus AblowCMIlow). Our findings demonstrate the importance of replicating genotypic-phenotypic associations, which can be achieved using immunophenotypic extremes and smaller sample sizes. We speculate that IL12RB1 polymorphisms may affect IL-12 and IL-23 binding and downstream effects, which are critical cytokines in the CMI response to measles vaccine.
doi:10.1016/j.humimm.2012.03.015
PMCID: PMC3368081  PMID: 22504412
Measles immunity; SNP; Cytokine Receptor; IL12RB1; Replication Study
12.  Understanding the immune response to seasonal influenza vaccination in older adults: a systems biology approach 
Expert review of vaccines  2012;11(8):985-994.
Annual vaccination against seasonal influenza is recommended to decrease disease-related mortality and morbidity. However, one population that responds suboptimally to influenza vaccine is adults over the age of 65 years. The natural aging process is associated with a complex deterioration of multiple components of the host immune system. Research into this phenomenon, known as immunosenescence, has shown that aging alters both the innate and adaptive branches of the immune system. The intricate mechanisms involved in immune response to influenza vaccine, and how these responses are altered with age, have led us to adopt a more encompassing systems biology approach to understand exactly why the response to vaccination diminishes with age. Here, the authors review what changes occur with immunosenescence, and some immunogenetic factors that influence response, and outline the systems biology approach to understand the immune response to seasonal influenza vaccination in older adults.
doi:10.1586/erv.12.61
PMCID: PMC3514506  PMID: 23002979
bioinformatics; immunogenetics; immunosenescence; influenza; seasonal influenza vaccine; systems biology; vaccinomics; vaccine-induced immunity
13.  Independence of Measles-Specific Humoral and Cellular Immune Responses to Vaccination 
Human Immunology  2012;73(5):474-479.
With a larger, independent cohort and more sophisticated measures, we sought to confirm our work that indicated independence of humoral and cellular immunity following measles vaccination. We recruited an age-stratified random cohort of 764 healthy subjects from all socio-economic strata, all with medical-record documentation of two age-appropriate doses of measles-containing vaccine. We quantified measles-specific neutralizing antibody levels and assayed the IFN-γ ELISPOT response to measles virus. We also measured secreted cytokines from the PBMCs in response to measles virus by performing enzyme-linked immunosorbent assays as secondary measures of cellular immune status. The median antibody level and median IFN-γ ELISPOT response were 844 mIU/mL (IQR: 418 to 1,752) and 36 (IQR: 13.00 to 69.00) spot-forming cells (per 2×105 PBMCs), respectively. We found only a very weak and negative correlation [Spearman’s rs or rho of −0.090 (95 percent confidence interval −0.162 to −0.018)]. We found a similar lack of quantitatively important correlations between the neutralizing antibody level and any of the secondary measures. Our data confirm the independence of humoral and cellular immune responses after the second dose of measles vaccination. As researchers pursue novel measles vaccine and measles vaccine delivery systems, they must not infer that humoral responses predict cellular responses.
doi:10.1016/j.humimm.2012.02.016
PMCID: PMC3338862  PMID: 22406060
Measles Vaccine; Immunity, Humoral; Immunity, Cellular; Antibody Formation; Cytokines
14.  Multigenic Control of Measles Vaccine Immunity Mediated by Polymorphisms in Measles Receptor, Innate Pathway, and Cytokine Genes 
Vaccine  2012;30(12):2159-2167.
Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5,7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.
doi:10.1016/j.vaccine.2012.01.025
PMCID: PMC3288471  PMID: 22265947
measles vaccine; immunogenetics; vaccine response; multigenic SNP association; interferon response; cytokines; Toll-like receptors
15.  Consistency of HLA Associations between Two Independent Measles Vaccine Cohorts: A Replication Study 
Vaccine  2012;30(12):2146-2152.
Associations between HLA genotypes and measles vaccine humoral and cellular immune responses were examined to better understand immunogenetic drivers of vaccine response. Two independent study cohorts of healthy schoolchildren were examined: cohort one, 346 children between 12–18 years of age; and cohort two, 388 children between 11–19 years of age. All received two age-appropriate doses of measles-containing vaccine. The purpose of this study was to identify and replicate associations between HLA genes and immune responses following measles vaccination found in our first cohort. Associations of comparable magnitudes and with similar p-values were observed between B*3503 (1st cohort p=0.01; 2nd cohort p=0.07), DQA1*0201 (1st cohort p=0.03; 2nd cohort p=0.03), DQB1*0303 (1st cohort p=0.10; 2nd cohort p=0.02), DQB1*0602 (1st cohort p=0.07; 2nd cohort p=0.10), and DRB1*0701 (1st cohort p=0.03; 2nd cohort p=0.07) alleles and measles-specific antibody levels. Suggestive, yet consistent, associations were observed between the B7(1 st cohort p=0.01; 2nd cohort p=0.08) supertype and higher measles antibody levels in both cohorts. Also, in both cohorts, the B*0801 and DRB1*0301 alleles, C*0802 and DPA1*0202 alleles, and DRB1*1303 alleles displayed consistent associations with variations in IFN-γ, IL-2 and IL-10 secretion, respectively. This study emphasizes the importance of replicating HLA associations with measles vaccine-induced humoral and cellular immune responses and increases confidence in the results. These data will inform strategies for functional studies and novel vaccine development, including epitope-based measles vaccines. This is the first HLA association replication study with measles vaccine-specific immune responses to date.
doi:10.1016/j.vaccine.2012.01.038
PMCID: PMC3288791  PMID: 22285888
Measles vaccine; HLA genotypes; Haplotypes; Antibodies; Cytokines; Replication study
16.  Associations Between Demographic Variables and Multiple Measles-Specific Innate and Cell-Mediated Immune Responses After Measles Vaccination 
Viral Immunology  2012;25(1):29-36.
Abstract
Measles remains a public health concern due to a lack of vaccine use and vaccine failure. A better understanding of the factors that influence variations in immune responses, including innate/inflammatory and adaptive cellular immune responses, following measles-mumps-rubella (MMR) vaccination could increase our knowledge of measles vaccine-induced immunity and potentially lead to better vaccines. Measles-specific innate/inflammatory and adaptive cell-mediated immune (CMI) responses were characterized using enzyme-linked immunosorbent assays to quantify the levels of secreted IL-2, IL-6, IL-10, IFN-α, IFN-γ, IFN-λ1, and TNF-α in PBMC cultures following in vitro stimulation with measles virus (MV) in a cohort of 764 school-aged children. IFN-γ ELISPOT assays were performed to ascertain the number of measles-specific IFN-γ-secreting cells. Cytokine responses were then tested for associations with self-declared demographic data, including gender, race, and ethnicity. Females secreted significantly more TNF-α, IL-6, and IFN-α (p<0.001, p<0.002, p<0.04, respectively) compared to males. Caucasians secreted significantly more IFN-λ1, IL-10, IL-2, TNF-α, IL-6, and IFN-α (p<0.001, p<0.001, p<0.001, p<0.003, p<0.01, and p<0.02, respectively) compared to the other racial groups combined. Additionally, Caucasians had a greater number of IFN-γ-secreting cells compared to other racial groups (p<0.001). Ethnicity was not significantly correlated with variations in measles-specific CMI measures. Our data suggest that innate/inflammatory and CMI cytokine responses to measles vaccine vary significantly by gender and race. These data further advance our understanding regarding inter-individual and subgroup variations in immune responses to measles vaccination.
doi:10.1089/vim.2011.0051
PMCID: PMC3271368  PMID: 22239234
17.  Effects of Vitamin A and D Receptor Gene Polymorphisms/Haplotypes on Immune Responses to Measles Vaccine 
Pharmacogenetics and genomics  2012;22(1):20-31.
OBJECTIVE
Vitamin A and D, and their receptors, are important regulators of the immune system, including vaccine immune response. We assessed the association between polymorphisms in the vitamin A (RARA, RARB and RARG) and vitamin D receptor (VDR)/RXRA genes and inter-individual variations in immune responses after two doses of measles vaccine in 745 subjects.
METHODS
Using a tagSNP approach, we genotyped 745 healthy children for the 391 polymorphisms in vitamin A and D receptor genes.
RESULTS
The RARB haplotype (rs6800566/rs6550976/rs9834818) was significantly associated with variations in both measles antibody (global p=0.013) and cytokine secretion levels, such as IL-10 (global p=0.006), IFN-α (global p=0.008), and TNF-α (global p=0.039) in the Caucasian subgroup. Specifically, the RARB haplotype AAC was associated with higher (t-statistic 3.27, p=0.001) measles antibody levels. At the other end of the spectrum, haplotype GG for rs6550978/rs6777544 was associated with lower antibody levels (t-statistic −2.32, p=0.020) in the Caucasian subgroup. In a sensitivity analysis, the RARB haplotype CTGGGCAA remained marginally significant (p<0.02) when the single SNP rs12630816 was included in the model for IL-10 secretion levels. A significant association was found between lower measles-specific IFN-γ Elispot responses and haplotypes rs11102986/rs11103473/rs11103482/rs10776909/rs12004589/rs35780541/rs2266677/rs875444 (global p=0.004) and rs6537944/rs3118571 (global p<0.001) in the RXRA gene for Caucasians. We also found associations between multiple RARB, VDR and RXRA SNPs/haplotypes and measles-specific IL-2, IL-6, IL-10, IFN-α, IFN-γ, IFNλ-1, and TNF-α cytokine secretion.
CONCLUSION
Our results suggest that specific allelic variations and haplotypes in the vitamin A and D receptor genes may influence adaptive immune responses to measles vaccine.
doi:10.1097/FPC.0b013e32834df186
PMCID: PMC3237827  PMID: 22082653
Single Nucleotide Polymorphisms; Measles Vaccine Immunity; Vitamin A Receptor; Vitamin D Receptor; Genes; Immunogenetics
18.  The Association of CD46, SLAM and CD209 Cellular Receptor Gene SNPs with Variations in Measles Vaccine-Induced Immune Responses: A Replication Study and Examination of Novel Polymorphisms 
Human Heredity  2011;72(3):206-223.
Background
The measles virus (MV) interacts with two known cellular receptors: CD46 and SLAM. The transmembrane receptor CD209 interacts with MV and augments dendritic cell infection.
Methods
764 subjects previously immunized with measles-mumps-rubella vaccine were genotyped for 66 candidate SNPs in the CD46, SLAM and CD209 genes as part of a larger study.
Results
A previously detected association of the CD46 SNP rs2724384 with measles-specific antibodies was successfully replicated in this study. Increased representation of the minor allele G for an intronic CD46 SNP was associated with an allele dose-related decrease (978 vs. 522 mIU/ml, p = 0.0007) in antibody levels. This polymorphism rs2724384 also demonstrated associations with IL-6 (p = 0.02), IFN-α (p = 0.007) and TNF-α (p = 0.0007) responses. Two polymorphisms (coding rs164288 and intronic rs11265452) in the SLAM gene that were associated with measles antibody levels in our previous study were associated with IFN-γ Elispot (p = 0.04) and IL-10 responses (p = 0.0008), respectively, in this study. We found associations between haplotypes, AACGGAATGGAAAG (p = 0.009) and GGCCGAGAGGAGAG (p < 0.001), in the CD46 gene and TNF-α secretion.
Conclusion
Understanding the functional and mechanistic consequences of these genetic polymorphisms on immune response variations could assist in directing new measles and potentially other viral vaccine design, and in better understanding measles immunogenetics.
doi:10.1159/000331585
PMCID: PMC3242703  PMID: 22086389
Measles virus receptors; Single nucleotide polymorphisms; Measles vaccine immunity; SNP; CD46; SLAM; CD209; Replication study
19.  Human Leukocyte Antigen Associations with Humoral and Cellular Immunity Following a Second Dose of Measles-Containing Vaccine: Persistence, Dampening, and Extinction of Associations Found After a First Dose 
Vaccine  2011;29(45):7982-7991.
Previously we found Human Leukocyte Antigen (HLA) associations with humoral immunity following a single dose of measles-containing vaccine. In this study, we sought to determine if HLA associations exist with humoral and cellular immunity following a second dose of measles-containing vaccine and if the associations we found with humoral immunity after the first dose persist following a second dose.
We recruited a population-based sample of 346 schoolchildren, all who previously received two doses of a measles-containing vaccine. Molecular HLA class I and II typing as well as humoral and cellular immune assays (measles-specific IgG antibody levels and lymphoproliferative response) were performed in these subjects.
We found significant associations with class I HLA-B (p=0.05) as well as class II HLA-DPB1 (p=0.01) and -DPA1 (p=0.03) genes for measles vaccine-induced antibody levels after the second dose. Similarly, we found significant associations with class II HLA-DQB1 (p=0.05) and -DRB1 (p=0.01) genes for measles-specific lymphoproliferation after the second dose.
While we found HLA associations after the second dose that we previously found after the first dose of measles containing vaccine, fewer alleles had statistically significant associations, suggesting that the second dose had a dampening or extinguishing effect on the HLA associations. It appears that the second dose overcomes HLA restriction through an as yet unknown mechanism. Future studies of HLA associations should consider both the effect of dose and the role that subsequent doses might play on genetic associations found with the response to a first dose.
doi:10.1016/j.vaccine.2011.08.060
PMCID: PMC3319093  PMID: 21872631
Antibody Formation; Histocompatibility Antigens Class I; Histocompatibility Antigens Class II; Immunogenetics; Lymphocyte Activation; Measles Antibody; Measles Vaccine; Measles-Mumps-Rubella Vaccine
20.  Associations between Single Nucleotide Polymorphisms and Haplotypes in Cytokine and Cytokine Receptor Genes and Immunity to Measles Vaccination 
Vaccine  2011;29(45):7883-7895.
Identification of host genetic determinants of measles vaccine-induced immunity can be used to design better vaccines and ultimately predict immune responses to vaccination. We performed a comprehensive candidate gene association study across 801 genetic markers in 56 cytokine/cytokine receptor genes, in a racially diverse cohort of 745 schoolchildren after two doses of MMR vaccine. Using linear regression methodologies we examined associations between SNPs/haplotypes and measles virus-specific immunity.
Forty-eight significant SNP associations with variations in neutralizing antibodies and measles-specific IFNγ Elispot responses were identified (p<0.05). Our study replicated an important previously found association of a functional IL12B genetic variant rs3212227 with variations in measles-specific humoral immunity (p=0.037). Similarly, two previously reported promoter IL10 and IL2 polymorphisms (rs1800890 and rs2069762) demonstrated associations with measles-specific cellular immunity in Caucasians (p≤0.034). Multiple IL7R polymorphisms, including a non-synonymous functional SNP (rs6897932/Thr244Ile), were associated with humoral (p≤0.024) and/or cellular (IFNγ Elispot, p≤0.023) measles-specific immune responses in Caucasians, but not African-Americans. Haplotype level analysis confirmed the association of IL7R genetic variants with measles vaccine-induced immunity in the Caucasian group (global p-value=0.003). Our results validate previous findings and identify new plausible genetic determinants, including IL7R polymorphisms, regulating measles vaccine-induced immunity in a race-specific manner.
doi:10.1016/j.vaccine.2011.08.083
PMCID: PMC3191314  PMID: 21875636
Measles vaccine; Immunity; Single Nucleotide Polymorphisms; Haplotypes; Cytokine; Cytokine receptor
21.  Correlations Between Vaccinia-Specific Immune Responses Within a Cohort of Armed Forces Members 
Viral Immunology  2011;24(5):415-420.
Abstract
Widespread vaccination with vaccinia virus (VACV) resulted in the eradication of smallpox; however, the licensed VACV-containing vaccines are associated with adverse events (AEs), making them unsuitable for certain high-risk populations. A better understanding of the host immune response following smallpox vaccination could result in vaccines with similar immunogenicity profiles to pre-eradication vaccines with a lower incidence of AEs. To study the immune response to VACV, we recruited 1,076 armed forces members who had been vaccinated with one dose of Dryvax®. We measured multiple VACV-specific immune responses: neutralizing antibody titer, the level of 12 secreted cytokines in peripheral blood mononuclear cell (PBMC) cultures (IL-1β, IL-2, IL-4, IL-6, IL-10, IL-12p40, IL-12p70, TNF-α, IFN-γ, IFN-α, IFN-β, and IL-18), and the number of IFN-γ- and CD8+ IFN-γ-secreting cells. We analyzed these data to determine correlations between immune response measures. We detected a strong proinflammatory response in concert with a Th-1-like cytokine response pattern at a median time point of 15.3 mo following primary vaccination. We also detected correlations between neutralizing antibody titer and secreted IL-2, as well as secreted IFN-γ (p=0.009 and p=0.0007, respectively). We also detected strong correlations between the proinflammatory cytokines IL-1β, TNF-α, IL-6, and IL-12p40 (p<0.0001). These results further advance our knowledge of vaccinia-specific cellular immune responses. Notably, vaccine-induced proinflammatory responses were not correlated with neutralizing antibody titers, suggesting that further attenuation to reduce inflammatory immune responses may result in decreased AEs without sacrificing VACV immunogenicity and population seropositivity.
doi:10.1089/vim.2011.0029
PMCID: PMC3236101  PMID: 21958369
22.  Vaccinomics and a New Paradigm for the Development of Preventive Vaccines Against Viral Infections 
Abstract
In this article we define vaccinomics as the integration of immunogenetics and immunogenomics with systems biology and immune profiling. Vaccinomics is based on the use of cutting edge, high-dimensional (so called “omics”) assays and novel bioinformatics approaches to the development of next-generation vaccines and the expansion of our capabilities in individualized medicine. Vaccinomics will allow us to move beyond the empiric “isolate, inactivate, and inject” approach characterizing past vaccine development efforts, and toward a more detailed molecular and systemic understanding of the carefully choreographed series of biological processes involved in developing viral vaccine-induced “immunity.” This enhanced understanding will then be applied to overcome the obstacles to the creation of effective vaccines to protect against pathogens, particularly hypervariable viruses, with the greatest current impact on public health. Here we provide an overview of how vaccinomics will inform vaccine science, the development of new vaccines and/or clinically relevant biomarkers or surrogates of protection, vaccine response heterogeneity, and our understanding of immunosenescence.
doi:10.1089/omi.2011.0032
PMCID: PMC3166201  PMID: 21732819
23.  Common SNPs/Haplotypes in IL18R1 and IL18 Genes Are Associated With Variations in Humoral Immunity to Smallpox Vaccination in Caucasians and African Americans 
The Journal of Infectious Diseases  2011;204(3):433-441.
Background. Identifying genetic factors that influence poxvirus immunity across races may assist in the development of better vaccines and approaches for vaccine development.
Methods. We performed an extensive candidate-gene genetic screen (across 32 cytokine and cytokine receptor genes) in a racially diverse cohort of 1056 healthy adults after a single dose of smallpox vaccine. Associations between single-nucleotide polymorphisms (SNPs)/haplotypes and vaccinia virus–specific neutralizing antibodies were assessed using linear regression methodologies.
Results. The combined analysis identified 63 associations between candidate SNPs and antibody levels after smallpox vaccination with P < .05. Thirty-one of these were within the IL18R1 and IL18 genes. Five IL18R1 SNPs, including a coding synonymous polymorphism rs1035130 (Phe251Phe) and 2 promoter SNPs (rs6710885, rs2287037), all in linkage disequilibrium, were associated with significant variations in antibody levels in both Caucasians (P ≤ .016) and African Americans (P ≤ .025). Similarly, associations with 2 intronic IL18 SNPs (rs2043055 and rs5744280) were consistent in the Caucasian (P ≤ .023) and African American samples (P ≤ .014). Haplotype analysis revealed highly significant associations between IL18R1 haplotypes and vaccinia virus–specific antibody levels (P < .001, by combined analysis) that were consistent across races.
Conclusions. Our study provides evidence for IL18 and IL18R1 genes as plausible genes regulating the humoral immune response to smallpox vaccine in both Caucasians and African Americans.
doi:10.1093/infdis/jir268
PMCID: PMC3132141  PMID: 21742843
24.  A large observational study to concurrently assess persistence of measles specific B-cell and T-cell immunity in individuals following two doses of MMR vaccine 
Vaccine  2011;29(27):4485-4491.
The measurement of measles-specific neutralizing antibodies, directed against the surface measles virus hemagglutinin and fusion proteins, is considered the gold standard in measles serology. We assessed functional measles-specific neutralizing antibody levels in a racially diverse cohort of 763 young healthy adolescents after receipt of two doses of measles-mumps-rubella vaccine, by the use of an automated plaque reduction microneutralization (PRMN) assay, and evaluated their relevance to protective antibody levels, as well as their associations with demographic and clinical variables. We also concurrently assessed measles-specific IFNγ Elispot responses and their relation to the observed antibody concentrations.
The geometric mean titer for our cohort was 832 mIU/mL (95% CIs: 776; 891). Sixty-eight subjects (8.9%) had antibody concentrations of less than the protective threshold of 210 mIU/mL (corresponding to PRMN titer of 120; suggesting protection against symptomatic disease), and 177 subjects (23.2%) demonstrated persisting antibody concentrations above 1,841 mIU/mL (corresponding to PRMN titer of 1,052; suggesting total protection against viral infection), 7.4 years after vaccination, in the absence of wild-type virus boosting. The mean measles-specific IFNγ Elispot response for our cohort was 46 (95% CIs: 43; 49) IFNγ-positive spots per 200,000 cells with no relation of cellular immunity measures to the observed antibody concentrations. No significant associations between antibody titers and demographic and clinical variables, including gender and race, were observed in our study.
In conclusion, in a large observational study of measles immunity, we used an automated high-throughput measles virus-specific neutralization assay to measure humoral immunity, and concurrently determined measles-specific cellular immunity to aid the assessment of potential susceptibility to measles in vaccinated populations.
doi:10.1016/j.vaccine.2011.04.037
PMCID: PMC3117252  PMID: 21539880
measles; vaccine; neutralizing antibodies; cellular immunity; plaque reduction microneutralization
25.  Vaccinomics: Current Findings, Challenges and Novel Approaches for Vaccine Development 
The AAPS Journal  2011;13(3):438-444.
Recent years have witnessed a growing interest in a field of vaccinology that we have named vaccinomics. The overall idea behind vaccinomics is to identify genetic and other mechanisms and pathways that determine immune responses, and thereby provide new candidate vaccine approaches. Considerable data show that host genetic polymorphisms act as important determinants of innate and adaptive immunity to vaccines. This review highlights examples of the role of immunogenetics and immunogenomics in understanding immune responses to vaccination, which are highly variable across the population. The influence of HLA genes, non-HLA, and innate genes in inter-individual variations in immune responses to viral vaccines are examined using population-based gene/SNP association studies. The ability to understand relationships between immune response gene variants and vaccine-specific immunity may assist in designing new vaccines. At the same time, application of state-of-the-art next-generation sequencing technology (and bioinformatics) is desired to provide new genetic information and its relationship to the immune response.
doi:10.1208/s12248-011-9281-x
PMCID: PMC3160164  PMID: 21671143
genetic association; HLA; immunogenetics; polymorphisms; SNPs; vaccines; vaccinomics

Results 1-25 (63)