PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (68)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
1.  Assessment of humoral and cell-mediated immune response to measles–mumps–rubella vaccine viruses among patients with asthma 
Little is known about the influence of asthma status on humoral and cell-mediated immune responses to measles–mumps–rubella (MMR) vaccine viruses. We compared the virus-specific IgG levels and lymphoproliferative response of peripheral blood mononuclear cells to MMR vaccine viruses between asthmatic and nonasthmatic patients. The study subjects included 342 healthy children aged 12–18 years who had received two doses of the MMR vaccine. We ascertained asthma status by applying predetermined criteria. Of the 342 subjects, 230 were available for this study of whom 25 were definite asthmatic patients (10.9%) and the rest of subjects were nonasthmatic patients. The mean of the log-transformed lymphoproliferative responses between definite asthma and nonasthma who had a family history of asthma were for measles, 0.92 ± 0.31 versus 1.54 ± 0.17 (p = 0.125); for mumps, 0.98 ± 0.64 versus 2.20 ± 0.21 (p = 0.035); and for rubella, 0.12 ± 0.37 versus 0.97 ± 0.16 (p = 0.008), respectively, adjusting for the duration between the first MMR vaccination and determination of the immune responses. There were no such differences among children without a family history of asthma. MMR virus–specific IgG levels were not different between study subjects with or without asthma. The study findings suggest asthmatic patients may have a suboptimal cell-mediated immune response to MMR vaccine viruses and a family history of asthma modifies this effect.
doi:10.2500/aap.2010.31.3399
PMCID: PMC3941466  PMID: 21708062
2.  Impact of delay in asthma diagnosis on health care service use 
Delays in diagnosing asthma in children are common and are known to delay asthma-specific treatment. Few studies have investigated whether a delay in asthma diagnosis impacts the use of health care services. This study was designed to assess whether a delay in diagnosis of asthma influences the use of health care services. This was a retrospective cohort study with subjects elicited from a convenience sample of 839 healthy children. The criteria for asthma was met in 276 (33%) subjects; of these subjects 179 (65%) had a delay in the diagnosis of asthma and 97 (35%) had a timely diagnosis. Data on health care services (e.g., flu shot, availability of a peak flow meter, hospitalizations, and urgent care or emergency department visits) and the frequency of systemic steroid treatments were collected from medical records during the first 18 years of life. The frequencies of health service and use of systemic steroids were compared using Poisson and logistic regression models in asthmatic children with and without a delay in asthma diagnosis. Children with a delay in asthma diagnosis were more likely to visit urgent care centers at least once (40.8% versus 21.6%; p < 0.001), compared with those with a timely diagnosis. There were no significant differences in other health care service or systemic steroid use. A delay in the diagnosis of asthma was associated with an increase in urgent care visits suggesting suboptimal care. Clinicians should be aware that a delay in the diagnosis of asthma in children may result in the use of suboptimal health care services.
doi:10.2500/aap.2010.31.3358
PMCID: PMC3920287  PMID: 20819315
Accessibility; adolescent; asthma; child; control; delivery of health care; diagnosis; health services; treatment; urgent care
3.  Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine 
Vaccine  2011;29(48):8988-8997.
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans.
Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20.
In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.
doi:10.1016/j.vaccine.2011.09.043
PMCID: PMC3941984  PMID: 21939710
Single Nucleotide Polymorphisms; Haplotypes; Antiviral genes; Measles vaccine; Immunity
4.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response
5.  Differential Cellular Immune Responses to Wild-Type and Attenuated Edmonston Tag Measles Virus Strains Are Primarily Defined by the Viral Phosphoprotein Gene 
Journal of medical virology  2010;82(11):1966-1975.
The measles virus phosphoprotein (P) gene encodes the P, V, and C proteins, which have multiple functions including type I interferon (IFN) inhibition. With a focus on viral immune modulation, we conducted a study on healthy vaccinees (n = 179) to compare cytokine secretion patterns/cell frequencies and gene expression after in vitro encounter with a highly attenuated strain of measles virus (MVEdmtag), wild-type MV (MVwt) or recombinant MVEdmtag expressing the wild-type P gene (MVwtP). Cytokines were quantified by ELISA and Elispot. Gene expression profiling was performed using real-time PCR. We found differential MV-specific cytokine responses to all detected cytokines characterized by significantly higher cytokine levels (P <0.001) and higher frequencies (P <0.0001) of cytokine-producing cells after stimulation with the highly attenuated MVEdm-tag strain in comparison with MVwt or MVwtP. Furthermore, gene expression profiling revealed significant cytokine suppression at the transcriptional level for viruses encoding the functional wt P gene, compared to attenuated MVEdmtag (P <0.05). Using lentivirus-mediated stable expression of P gene-encoded proteins in human cell lines, we demonstrated that the expression of the functional wt V protein significantly down-modulated the induction of IFNs type I, II, and III in lymphocytes and monocytes. Taken together our results indicate that Th1, Th2, and innate/inflammatory cytokine responses in vaccinees are suppressed both at the protein and transcriptional level by viruses expressing the functional wt P gene products. The functional P gene-encoded viral proteins (particularly V proteins) emerge as crucial immune evasion factors for modulating and shaping the measles virus-specific cytokine responses in humans.
doi:10.1002/jmv.21899
PMCID: PMC3924428  PMID: 20872725
measles virus; P gene; MMR vaccine; cellular immunity; cytokines; gene expression
7.  Human Leukocyte Antigens and Cellular Immune Responses to Anthrax Vaccine Adsorbed 
Infection and Immunity  2013;81(7):2584-2591.
Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a “heterozygote advantage.” Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.
doi:10.1128/IAI.00269-13
PMCID: PMC3697592  PMID: 23649091
8.  Sedation levels during propofol administration for outpatient colonoscopies 
The levels of sedation required for patients to comfortably undergo colonoscopy with propofol were examined. One hundred patients undergoing colonoscopy with propofol were enrolled. In addition to standard-of-care monitoring, sedation level was monitored with the Patient State Index (PSI) obtained from a brain function monitor, transcutaneous carbon dioxide (tcpCO2) was monitored with the TCM TOSCA monitor, and end-tidal carbon dioxide was monitored via nasal cannula. The Ramsay Sedation Score (RSS) was also assessed and recorded. After baseline data were obtained from the first 40 consecutive patients enrolled in the study, the remaining 60 patients were randomized into two groups. In one group the PSI value was blinded from the anesthesiologist and in the second group the PSI was visible and the impact of this information on the management of the sedation was analyzed. Overall 96% of patients reached levels of deep sedation and 89% reached levels of general anesthesia. When comparing the blinded to PSI versus unblinded groups, the blinded group had a significantly lower PSI and higher RSS and tcpCO2, indicating the blinded group was maintained at a deeper sedation level with more respiratory compromise than the unblinded group. Patients undergoing colonoscopy under propofol sedation delivered by a bolus technique are frequently taken to levels of general anesthesia and are at risk for respiratory depression, airway obstruction, and hemodynamic compromise.
PMCID: PMC3862122  PMID: 24381393
9.  Characteristics of Children with Asthma Who Achieved Remission of Asthma 
Objective
To characterize two groups of asthmatics who had achieved remission and those who had not achieved remission of asthma.
Methods
The study was a retrospective cohort study based on 117 asthmatic children who participated in a previous study. We categorized the children into two groups: asthmatics with remission versus asthmatics without remission. We defined remission of asthma as lack of symptoms/signs of asthma or asthma-related medications or health care services for at least three consecutive years. Long-term remission was defined by no relapse of asthma after achieving remission. We characterized these groups.
Results
Of the 117 subjects, 70 (60%) were male, 91 (78%) were Caucasians, and the mean age at index date of asthma was 8.1 years. A total of 59 asthmatic children (50%) achieved remission and 28 asthmatics (24%) achieved long-term remission. Asthmatics with remission were more likely to be Caucasian (87%) compared to those without (69%) (p = .039) There were no differences in the frequency of visits for viral (0.3 vs. 0.4 per person-years, p = .29) or bacterial infections (0.7 vs. 0.5 per person-years, p = .49) between asthmatics with and without remission. Gender, socioeconomic status, smoking exposure, family history of asthma or atopy, breastfeeding history, peak flow meter availability, asthma action plan, and influenza vaccinations were not associated with remission.
Conclusions
Only half of asthmatic children accomplished remission of asthma ever and 24% of asthmatic children had long-term remission. Ethnicity may affect remission of asthma but microbial infections may not influence the likelihood of remission of asthma and vice versa.
doi:10.3109/02770903.2013.787625
PMCID: PMC3761883  PMID: 23514196
asthma; childhood; epidemiology; microbial infection; remission; risk
10.  Impact of Cytokine and Cytokine Receptor Gene Polymorphisms on Cellular Immunity after Smallpox Vaccination 
Gene  2012;510(1):59-65.
We explored associations between SNPs in cytokine/cytokine receptor genes and cellular immunity in subjects following primary smallpox vaccination. We also analyzed the genotype-phenotype associations discovered in the Caucasian subjects among a cohort of African-Americans. In Caucasians we found 277 associations (p<0.05) between gene SNPs and inter-individual variations in IFN-α, IL-12p40, IL-1β, IL-2, and TNF-α secretion levels. A collection of SNPs in the IL1RN, IL2RB, IL4R, IL6, IL10RB, IL12A, and IL12RB2 genes had consistent associations among both Caucasians and African-Americans. A regulatory SNP (rs452204) in the IL1RN gene was significantly associated with higher levels of IL-2 secretion in an allele dose-dependent manner in both race groups (p=0.05 for Caucasians and p=0.002 for African-Americans). IL12RB2 polymorphism rs3790567 was associated with a dose-related decrease in IL-1β secretion (p=0.009 for Caucasians and p=0.01 for African-Americans). Our results demonstrate that variations in smallpox vaccine-induced cytokine responses are modulated by genetic polymorphisms in cytokine and cytokine receptor genes.
doi:10.1016/j.gene.2012.08.021
PMCID: PMC3463724  PMID: 23009887
Immunogenetics; SNPs; Smallpox Vaccine; Cytokine; Cytokine Receptor; Cellular Immunity; Caucasians; African-Americans
11.  High-Dimensional Gene Expression Profiling Studies in High and Low Responders to Primary Smallpox Vaccination 
The Journal of Infectious Diseases  2012;206(10):1512-1520.
Background. The mechanisms underlying smallpox vaccine-induced variations in immune responses are not well understood, but are of considerable interest to a deeper understanding of poxvirus immunity and correlates of protection.
Methods. We assessed transcriptional messenger RNA expression changes in 197 recipients of primary smallpox vaccination representing the extremes of humoral and cellular immune responses.
Results. The 20 most significant differentially expressed genes include a tumor necrosis factor–receptor superfamily member, an interferon (IFN) gene, a chemokine gene, zinc finger protein genes, nuclear factors, and histones (P ≤ 1.06E−20, q ≤ 2.64E−17). A pathway analysis identified 4 enriched pathways with cytokine production by the T-helper 17 subset of CD4+ T cells being the most significant pathway (P = 3.42E−05). Two pathways (antiviral actions of IFNs, P = 8.95E−05; and IFN-α/β signaling pathway, P = 2.92E−04), integral to innate immunity, were enriched when comparing high with low antibody responders (false discovery rate, < 0.05). Genes related to immune function and transcription (TLR8, P = .0002; DAPP1, P = .0003; LAMP3, P = 9.96E−05; NR4A2, P ≤ .0002; EGR3, P = 4.52E−05), and other genes with a possible impact on immunity (LNPEP, P = 3.72E−05; CAPRIN1, P = .0001; XRN1, P = .0001), were found to be expressed differentially in high versus low antibody responders.
Conclusion. We identified novel and known immunity-related genes and pathways that may account for differences in immune response to smallpox vaccination.
doi:10.1093/infdis/jis546
PMCID: PMC3475634  PMID: 22949304
12.  Independence of Measles-Specific Humoral and Cellular Immune Responses to Vaccination 
Human Immunology  2012;73(5):474-479.
With a larger, independent cohort and more sophisticated measures, we sought to confirm our work that indicated independence of humoral and cellular immunity following measles vaccination. We recruited an age-stratified random cohort of 764 healthy subjects from all socio-economic strata, all with medical-record documentation of two age-appropriate doses of measles-containing vaccine. We quantified measles-specific neutralizing antibody levels and assayed the IFN-γ ELISPOT response to measles virus. We also measured secreted cytokines from the PBMCs in response to measles virus by performing enzyme-linked immunosorbent assays as secondary measures of cellular immune status. The median antibody level and median IFN-γ ELISPOT response were 844 mIU/mL (IQR: 418 to 1,752) and 36 (IQR: 13.00 to 69.00) spot-forming cells (per 2×105 PBMCs), respectively. We found only a very weak and negative correlation [Spearman’s rs or rho of −0.090 (95 percent confidence interval −0.162 to −0.018)]. We found a similar lack of quantitatively important correlations between the neutralizing antibody level and any of the secondary measures. Our data confirm the independence of humoral and cellular immune responses after the second dose of measles vaccination. As researchers pursue novel measles vaccine and measles vaccine delivery systems, they must not infer that humoral responses predict cellular responses.
doi:10.1016/j.humimm.2012.02.016
PMCID: PMC3338862  PMID: 22406060
Measles Vaccine; Immunity, Humoral; Immunity, Cellular; Antibody Formation; Cytokines
13.  The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches 
Expert review of vaccines  2013;12(1):57-70.
The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of ‘vaccinomics’ for novel vaccine development.
doi:10.1586/erv.12.134
PMCID: PMC3570049  PMID: 23256739
adaptive immunity; genetic association studies; human leukocyte antigens; immunogenetics; measles vaccine; single nucleotide polymorphisms
14.  Measles, Mumps, and Rubella 
Measles, mumps, and rubella are viral diseases that may adversely affect non-immune pregnant women and their fetuses/neonates. Prevention of these diseases and their complications can be achieved through measles-mumps-rubella (MMR) vaccination prior to pregnancy. The vaccine is contraindicated during pregnancy because it contains live, attenuated viruses that pose a theoretical risk to the fetus. However, accidental receipt of MMR vaccination is not known to cause maternal/fetal complications. MMR immunization is recommended to non-immune obstetric patients upon completion or termination of pregnancy.
doi:10.1097/GRF.0b013e31824df256
PMCID: PMC3334858  PMID: 22510638
Measles-Mumps-Rubella Vaccine; Measles; Mumps; Rubella; Congenital Rubella Syndrome; Obstetrics
15.  Genome-Wide Association Study of Antibody Response to Smallpox Vaccine 
Vaccine  2012;30(28):4182-4189.
We performed a genome-wide association study (GWAS) of antibody levels in a multi-ethnic group of 1,071 healthy smallpox vaccine recipients. In Caucasians, the most prominent association was found with promoter SNP rs10489759 in the LOC647132 pseudogene on chromosome 1 (p=7.77 × 10-8). In African-Americans, we identified eight genetic loci at p< 5 × 10-7. The SNP association with the lowest p-value (rs10508727, p=1.05 × 10-10) was in the Mohawk homeobox (MKX) gene on chromosome 10. Other candidate genes included LOC388460, GPR158, ZHX2, SPIRE1, GREM2, CSMD1, and RUNX1. In Hispanics, the top six associations between genetic variants and antibody levels had p-values less than 5 × 10-7, with p=1.78 × 10-10 for the strongest statistical association (promoter SNP rs12256830 in the PCDH15 gene). In addition, SNP rs4748153 in the immune response gene PRKCQ (protein kinase C, theta) was significantly associated with neutralizing antibody levels (p=2.51 × 10-8). Additional SNP associations in Hispanics (p ≤3.40 × 10-7) were mapped to the KIF6/LOC100131899, CYP2C9, and ANKLE2/GOLGA3 genes. This study has identified candidate SNPs that may be important in regulating humoral immunity to smallpox vaccination. Replication studies, as well as studies elucidating the functional consequences of contributing genes and polymorphisms, are underway.
doi:10.1016/j.vaccine.2012.04.055
PMCID: PMC3367131  PMID: 22542470
GWAS; Smallpox Vaccine; Vaccinia Virus; Humoral Immunity; Immunogenetics; SNPs
16.  Understanding the immune response to seasonal influenza vaccination in older adults: a systems biology approach 
Expert review of vaccines  2012;11(8):985-994.
Annual vaccination against seasonal influenza is recommended to decrease disease-related mortality and morbidity. However, one population that responds suboptimally to influenza vaccine is adults over the age of 65 years. The natural aging process is associated with a complex deterioration of multiple components of the host immune system. Research into this phenomenon, known as immunosenescence, has shown that aging alters both the innate and adaptive branches of the immune system. The intricate mechanisms involved in immune response to influenza vaccine, and how these responses are altered with age, have led us to adopt a more encompassing systems biology approach to understand exactly why the response to vaccination diminishes with age. Here, the authors review what changes occur with immunosenescence, and some immunogenetic factors that influence response, and outline the systems biology approach to understand the immune response to seasonal influenza vaccination in older adults.
doi:10.1586/erv.12.61
PMCID: PMC3514506  PMID: 23002979
bioinformatics; immunogenetics; immunosenescence; influenza; seasonal influenza vaccine; systems biology; vaccinomics; vaccine-induced immunity
17.  Impact of Delay in Asthma Diagnosis on Chest X-ray and Antibiotic Utilization by Clinicians 
Objective
To evaluate the effect of the timeliness of asthma diagnosis on chest X-ray (CXR) and antibiotic utilization in children.
Patients and methods
This was a retrospective cohort study of 276 asthmatic children aged 5–12 years from Rochester, Minnesota. From the time when children met our predetermined asthma criteria, the frequency of CXR and antibiotic utilizations for respiratory illnesses were collected from medical records until age 18 years. Using a Poisson regression model, the frequency of CXR and antibiotic utilizations were compared in children with timely, delayed, or no clinician diagnosis of asthma.
Results
Of the 276 asthmatic patients, 97 (35%) had a timely diagnosis, 122 (44%) had a delayed diagnosis, while 57 patients (21%) had no clinician diagnosis of asthma. There was no significant difference in CXR or antibiotic utilization for respiratory illness between these groups. In addition, this was true for the comparison between the timely diagnosed group and the delayed diagnosed group combining both the group with a delay in asthma diagnosis and the group who never had asthma diagnosis.
Conclusions
A delay in the diagnosis of asthma in children is common and overall it may not influence antibiotic and CXR utilization for respiratory symptoms by clinicians. However, its impact on access to asthma-related therapies and other healthcare utilizations could be possible and was not assessed in this study. Given the limitations of our study, a larger prospective study needs to be considered.
doi:10.3109/02770903.2011.637596
PMCID: PMC3433831  PMID: 22149172
adolescent; antibacterial agents; child; health services; radiography; therapeutics; thoracic
18.  Multigenic Control of Measles Vaccine Immunity Mediated by Polymorphisms in Measles Receptor, Innate Pathway, and Cytokine Genes 
Vaccine  2012;30(12):2159-2167.
Measles infection and vaccine response are complex biological processes that involve both viral and host genetic factors. We have previously investigated the influence of genetic polymorphisms on vaccine immune response, including measles vaccines, and have shown that polymorphisms in HLA, cytokine, cytokine receptor, and innate immune response genes are associated with variation in vaccine response but do not account for all of the inter-individual variance seen in vaccinated populations. In the current study we report the findings of a multigenic analysis of measles vaccine immunity, indicating a role for the measles virus receptor CD46, innate pattern-recognition receptors (DDX58, TLR2, 4, 5,7 and 8) and intracellular signaling intermediates (MAP3K7, NFKBIA), and key antiviral molecules (VISA, OAS2, MX1, PKR) as well as cytokines (IFNA1, IL4, IL6, IL8, IL12B) and cytokine receptor genes (IL2RB, IL6R, IL8RA) in the genetic control of both humoral and cellular immune responses. This multivariate approach provided additional insights into the genetic control of measles vaccine responses over and above the information gained by our previous univariate SNP association analyses.
doi:10.1016/j.vaccine.2012.01.025
PMCID: PMC3288471  PMID: 22265947
measles vaccine; immunogenetics; vaccine response; multigenic SNP association; interferon response; cytokines; Toll-like receptors
19.  Consistency of HLA Associations between Two Independent Measles Vaccine Cohorts: A Replication Study 
Vaccine  2012;30(12):2146-2152.
Associations between HLA genotypes and measles vaccine humoral and cellular immune responses were examined to better understand immunogenetic drivers of vaccine response. Two independent study cohorts of healthy schoolchildren were examined: cohort one, 346 children between 12–18 years of age; and cohort two, 388 children between 11–19 years of age. All received two age-appropriate doses of measles-containing vaccine. The purpose of this study was to identify and replicate associations between HLA genes and immune responses following measles vaccination found in our first cohort. Associations of comparable magnitudes and with similar p-values were observed between B*3503 (1st cohort p=0.01; 2nd cohort p=0.07), DQA1*0201 (1st cohort p=0.03; 2nd cohort p=0.03), DQB1*0303 (1st cohort p=0.10; 2nd cohort p=0.02), DQB1*0602 (1st cohort p=0.07; 2nd cohort p=0.10), and DRB1*0701 (1st cohort p=0.03; 2nd cohort p=0.07) alleles and measles-specific antibody levels. Suggestive, yet consistent, associations were observed between the B7(1 st cohort p=0.01; 2nd cohort p=0.08) supertype and higher measles antibody levels in both cohorts. Also, in both cohorts, the B*0801 and DRB1*0301 alleles, C*0802 and DPA1*0202 alleles, and DRB1*1303 alleles displayed consistent associations with variations in IFN-γ, IL-2 and IL-10 secretion, respectively. This study emphasizes the importance of replicating HLA associations with measles vaccine-induced humoral and cellular immune responses and increases confidence in the results. These data will inform strategies for functional studies and novel vaccine development, including epitope-based measles vaccines. This is the first HLA association replication study with measles vaccine-specific immune responses to date.
doi:10.1016/j.vaccine.2012.01.038
PMCID: PMC3288791  PMID: 22285888
Measles vaccine; HLA genotypes; Haplotypes; Antibodies; Cytokines; Replication study
20.  Associations Between Demographic Variables and Multiple Measles-Specific Innate and Cell-Mediated Immune Responses After Measles Vaccination 
Viral Immunology  2012;25(1):29-36.
Abstract
Measles remains a public health concern due to a lack of vaccine use and vaccine failure. A better understanding of the factors that influence variations in immune responses, including innate/inflammatory and adaptive cellular immune responses, following measles-mumps-rubella (MMR) vaccination could increase our knowledge of measles vaccine-induced immunity and potentially lead to better vaccines. Measles-specific innate/inflammatory and adaptive cell-mediated immune (CMI) responses were characterized using enzyme-linked immunosorbent assays to quantify the levels of secreted IL-2, IL-6, IL-10, IFN-α, IFN-γ, IFN-λ1, and TNF-α in PBMC cultures following in vitro stimulation with measles virus (MV) in a cohort of 764 school-aged children. IFN-γ ELISPOT assays were performed to ascertain the number of measles-specific IFN-γ-secreting cells. Cytokine responses were then tested for associations with self-declared demographic data, including gender, race, and ethnicity. Females secreted significantly more TNF-α, IL-6, and IFN-α (p<0.001, p<0.002, p<0.04, respectively) compared to males. Caucasians secreted significantly more IFN-λ1, IL-10, IL-2, TNF-α, IL-6, and IFN-α (p<0.001, p<0.001, p<0.001, p<0.003, p<0.01, and p<0.02, respectively) compared to the other racial groups combined. Additionally, Caucasians had a greater number of IFN-γ-secreting cells compared to other racial groups (p<0.001). Ethnicity was not significantly correlated with variations in measles-specific CMI measures. Our data suggest that innate/inflammatory and CMI cytokine responses to measles vaccine vary significantly by gender and race. These data further advance our understanding regarding inter-individual and subgroup variations in immune responses to measles vaccination.
doi:10.1089/vim.2011.0051
PMCID: PMC3271368  PMID: 22239234
21.  Effects of Vitamin A and D Receptor Gene Polymorphisms/Haplotypes on Immune Responses to Measles Vaccine 
Pharmacogenetics and genomics  2012;22(1):20-31.
OBJECTIVE
Vitamin A and D, and their receptors, are important regulators of the immune system, including vaccine immune response. We assessed the association between polymorphisms in the vitamin A (RARA, RARB and RARG) and vitamin D receptor (VDR)/RXRA genes and inter-individual variations in immune responses after two doses of measles vaccine in 745 subjects.
METHODS
Using a tagSNP approach, we genotyped 745 healthy children for the 391 polymorphisms in vitamin A and D receptor genes.
RESULTS
The RARB haplotype (rs6800566/rs6550976/rs9834818) was significantly associated with variations in both measles antibody (global p=0.013) and cytokine secretion levels, such as IL-10 (global p=0.006), IFN-α (global p=0.008), and TNF-α (global p=0.039) in the Caucasian subgroup. Specifically, the RARB haplotype AAC was associated with higher (t-statistic 3.27, p=0.001) measles antibody levels. At the other end of the spectrum, haplotype GG for rs6550978/rs6777544 was associated with lower antibody levels (t-statistic −2.32, p=0.020) in the Caucasian subgroup. In a sensitivity analysis, the RARB haplotype CTGGGCAA remained marginally significant (p<0.02) when the single SNP rs12630816 was included in the model for IL-10 secretion levels. A significant association was found between lower measles-specific IFN-γ Elispot responses and haplotypes rs11102986/rs11103473/rs11103482/rs10776909/rs12004589/rs35780541/rs2266677/rs875444 (global p=0.004) and rs6537944/rs3118571 (global p<0.001) in the RXRA gene for Caucasians. We also found associations between multiple RARB, VDR and RXRA SNPs/haplotypes and measles-specific IL-2, IL-6, IL-10, IFN-α, IFN-γ, IFNλ-1, and TNF-α cytokine secretion.
CONCLUSION
Our results suggest that specific allelic variations and haplotypes in the vitamin A and D receptor genes may influence adaptive immune responses to measles vaccine.
doi:10.1097/FPC.0b013e32834df186
PMCID: PMC3237827  PMID: 22082653
Single Nucleotide Polymorphisms; Measles Vaccine Immunity; Vitamin A Receptor; Vitamin D Receptor; Genes; Immunogenetics
22.  Assessment of the association between atopic conditions and tympanostomy tube placement in children 
Allergy and Asthma Proceedings  2012;33(3):289-296.
This study assesses the relationship between otitis media and atopic conditions in children by comparing the incidence of tympanostomy tube placement between children with and without atopic conditions: asthma, allergic rhinitis, and atopic dermatitis. Study subjects were a cohort of 323 healthy children who participated in a study of vaccine response. All episodes of tympanostomy tube placement and physician diagnoses of allergic rhinitis and atopic dermatitis were collected through comprehensive medical record review. Asthma status was ascertained through application of established criteria. We compared incidence rates of tympanostomy tube placement between children with and without atopic conditions. We fitted data to a Poisson regression model to calculate relative risk ratios (RRs) and their corresponding 95% confidence intervals (95% CI). Three subjects were excluded who did not have parental authorization for using records for research. Of the remaining 320 subjects, 170 (53%) were male subjects, 268 (94%) were white, 124 (39%) were asthmatic patients, and 20 (6%) had tympanostomy tube placement. Children with asthma before the index date of tympanostomy tube placement were more likely to have tympanostomy tube placement compared with those without asthma (RR, 19.33; 95% CI, 11.41; 32.75; p < 0.001). We found a similar association between asthma ever (before or after index date) and the incidence of tympanostomy tube placement (RR, 1.53; 95% CI, 0.93–2.53; p = 0.095). This was true for children with allergic rhinitis compared with those without allergic rhinitis (RR, 1.70; 95% CI, 1.01–2.86; p = 0.007). Atopic dermatitis was not associated with the incidence of tympanostomy tube placement. Asthma or allergic rhinitis may be unrecognized risk factors for recurrent or persistent otitis media. However, given the small sample size of the study, a cohort study with a larger sample size is necessary.
doi:10.2500/aap.2012.33.3529
PMCID: PMC3490504  PMID: 22584196
Allergic rhinitis; asthma; atopic dermatitis; atopy; child; infection; otitis media; pediatrics; tympanostomy tube
23.  The Association of CD46, SLAM and CD209 Cellular Receptor Gene SNPs with Variations in Measles Vaccine-Induced Immune Responses: A Replication Study and Examination of Novel Polymorphisms 
Human Heredity  2011;72(3):206-223.
Background
The measles virus (MV) interacts with two known cellular receptors: CD46 and SLAM. The transmembrane receptor CD209 interacts with MV and augments dendritic cell infection.
Methods
764 subjects previously immunized with measles-mumps-rubella vaccine were genotyped for 66 candidate SNPs in the CD46, SLAM and CD209 genes as part of a larger study.
Results
A previously detected association of the CD46 SNP rs2724384 with measles-specific antibodies was successfully replicated in this study. Increased representation of the minor allele G for an intronic CD46 SNP was associated with an allele dose-related decrease (978 vs. 522 mIU/ml, p = 0.0007) in antibody levels. This polymorphism rs2724384 also demonstrated associations with IL-6 (p = 0.02), IFN-α (p = 0.007) and TNF-α (p = 0.0007) responses. Two polymorphisms (coding rs164288 and intronic rs11265452) in the SLAM gene that were associated with measles antibody levels in our previous study were associated with IFN-γ Elispot (p = 0.04) and IL-10 responses (p = 0.0008), respectively, in this study. We found associations between haplotypes, AACGGAATGGAAAG (p = 0.009) and GGCCGAGAGGAGAG (p < 0.001), in the CD46 gene and TNF-α secretion.
Conclusion
Understanding the functional and mechanistic consequences of these genetic polymorphisms on immune response variations could assist in directing new measles and potentially other viral vaccine design, and in better understanding measles immunogenetics.
doi:10.1159/000331585
PMCID: PMC3242703  PMID: 22086389
Measles virus receptors; Single nucleotide polymorphisms; Measles vaccine immunity; SNP; CD46; SLAM; CD209; Replication study
24.  Human Leukocyte Antigen Associations with Humoral and Cellular Immunity Following a Second Dose of Measles-Containing Vaccine: Persistence, Dampening, and Extinction of Associations Found After a First Dose 
Vaccine  2011;29(45):7982-7991.
Previously we found Human Leukocyte Antigen (HLA) associations with humoral immunity following a single dose of measles-containing vaccine. In this study, we sought to determine if HLA associations exist with humoral and cellular immunity following a second dose of measles-containing vaccine and if the associations we found with humoral immunity after the first dose persist following a second dose.
We recruited a population-based sample of 346 schoolchildren, all who previously received two doses of a measles-containing vaccine. Molecular HLA class I and II typing as well as humoral and cellular immune assays (measles-specific IgG antibody levels and lymphoproliferative response) were performed in these subjects.
We found significant associations with class I HLA-B (p=0.05) as well as class II HLA-DPB1 (p=0.01) and -DPA1 (p=0.03) genes for measles vaccine-induced antibody levels after the second dose. Similarly, we found significant associations with class II HLA-DQB1 (p=0.05) and -DRB1 (p=0.01) genes for measles-specific lymphoproliferation after the second dose.
While we found HLA associations after the second dose that we previously found after the first dose of measles containing vaccine, fewer alleles had statistically significant associations, suggesting that the second dose had a dampening or extinguishing effect on the HLA associations. It appears that the second dose overcomes HLA restriction through an as yet unknown mechanism. Future studies of HLA associations should consider both the effect of dose and the role that subsequent doses might play on genetic associations found with the response to a first dose.
doi:10.1016/j.vaccine.2011.08.060
PMCID: PMC3319093  PMID: 21872631
Antibody Formation; Histocompatibility Antigens Class I; Histocompatibility Antigens Class II; Immunogenetics; Lymphocyte Activation; Measles Antibody; Measles Vaccine; Measles-Mumps-Rubella Vaccine
25.  Associations between Single Nucleotide Polymorphisms and Haplotypes in Cytokine and Cytokine Receptor Genes and Immunity to Measles Vaccination 
Vaccine  2011;29(45):7883-7895.
Identification of host genetic determinants of measles vaccine-induced immunity can be used to design better vaccines and ultimately predict immune responses to vaccination. We performed a comprehensive candidate gene association study across 801 genetic markers in 56 cytokine/cytokine receptor genes, in a racially diverse cohort of 745 schoolchildren after two doses of MMR vaccine. Using linear regression methodologies we examined associations between SNPs/haplotypes and measles virus-specific immunity.
Forty-eight significant SNP associations with variations in neutralizing antibodies and measles-specific IFNγ Elispot responses were identified (p<0.05). Our study replicated an important previously found association of a functional IL12B genetic variant rs3212227 with variations in measles-specific humoral immunity (p=0.037). Similarly, two previously reported promoter IL10 and IL2 polymorphisms (rs1800890 and rs2069762) demonstrated associations with measles-specific cellular immunity in Caucasians (p≤0.034). Multiple IL7R polymorphisms, including a non-synonymous functional SNP (rs6897932/Thr244Ile), were associated with humoral (p≤0.024) and/or cellular (IFNγ Elispot, p≤0.023) measles-specific immune responses in Caucasians, but not African-Americans. Haplotype level analysis confirmed the association of IL7R genetic variants with measles vaccine-induced immunity in the Caucasian group (global p-value=0.003). Our results validate previous findings and identify new plausible genetic determinants, including IL7R polymorphisms, regulating measles vaccine-induced immunity in a race-specific manner.
doi:10.1016/j.vaccine.2011.08.083
PMCID: PMC3191314  PMID: 21875636
Measles vaccine; Immunity; Single Nucleotide Polymorphisms; Haplotypes; Cytokine; Cytokine receptor

Results 1-25 (68)