PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (85)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
more »
1.  Humoral and Cell-Mediated Immune Responses to Alternate Booster Schedules of Anthrax Vaccine Adsorbed in Humans 
Protective antigen (PA)-specific antibody and cell-mediated immune (CMI) responses to annual and alternate booster schedules of anthrax vaccine adsorbed (AVA; BioThrax) were characterized in humans over 43 months. Study participants received 1 of 6 vaccination schedules: a 3-dose intramuscular (IM) priming series (0, 1, and 6 months) with a single booster at 42 months (4-IM); 3-dose IM priming with boosters at 18 and 42 months (5-IM); 3-dose IM priming with boosters at 12, 18, 30, and 42 months (7-IM); the 1970 licensed priming series of 6 doses (0, 0.5, 1, 6, 12, and 18 months) and two annual boosters (30 and 42 months) administered either subcutaneously (SQ) (8-SQ) or IM (8-IM); or saline placebo control at all eight time points. Antibody response profiles included serum anti-PA IgG levels, subclass distributions, avidity, and lethal toxin neutralization activity (TNA). CMI profiles included frequencies of gamma interferon (IFN-γ)- and interleukin 4 (IL-4)-secreting cells and memory B cells (MBCs), lymphocyte stimulation indices (SI), and induction of IFN-γ, IL-2, IL-4, IL-6, IL-1β, and tumor necrosis factor alpha (TNF-α) mRNA. All active schedules elicited high-avidity PA-specific IgG, TNA, MBCs, and T cell responses with a mixed Th1-Th2 profile and Th2 dominance. Anti-PA IgG and TNA were highly correlated (e.g., month 7, r2 = 0.86, P < 0.0001, log10 transformed) and declined in the absence of boosters. Boosters administered IM generated the highest antibody responses. Increasing time intervals between boosters generated antibody responses that were faster than and superior to those obtained with the final month 42 vaccination. CMI responses to the 3-dose IM priming remained elevated up to 43 months. (This study has been registered at ClinicalTrials.gov under registration no. NCT00119067.)
doi:10.1128/CVI.00696-15
PMCID: PMC4820509  PMID: 26865594
2.  Health Care Utilization by Body Mass Index in a Pediatric Population 
Academic pediatrics  2015;15(6):644-650.
Objective
We tested the hypothesis that the frequency of emergency department (ED) visits, outpatient clinic visits, and hospitalizations were higher among children with higher body mass index (BMI) categories, even after controlling for demographics, socio-economic status (SES) and other chronic medical conditions.
Methods
We obtained electronic height, weight, and utilization data for all residents of Olmsted County, MN, aged 2 to 18 years on January 1, 2005 (n=34,335) and calculated baseline BMI (kg/m2). At least one BMI measurement and permission to use medical record information was available for 19,771 (58%) children; 19,528 with follow-up comprised the final cohort. BMIs were categorized into under/healthy weight (< 85th percentile), overweight (85-<95th percentile), and obese (≥95th percentile). Negative binomial models were used to compare the rate of utilization across BMI categories. Multivariable models were used to adjust for the effects of age, race, sex, SES, and chronic medical conditions.
Results
Compared to children with BMI < 85th percentile, overweight and obese status were associated with increased ED visits [adjusted incident rate ratio (IRR): 1.16, 95% confidence interval (CI): 1.10, 1.23 and IRR:1.27, 95% CI:, 1.19, 1.35, respectively (p for trend <0.0001)], and outpatient clinic visits [IRR: 1.05, 95% CI: 1.02, 1.08 and IRR: 1.07, 95% CI: 1.04-1.11, respectively (p for trend < 0.0001)]. No associations were observed between baseline BMI category and hospitalizations in the adjusted analyses.
Conclusions
Children who are overweight or obese utilize the ED and outpatient clinic visits, but not hospitalizations, more frequently than those who are under/healthy weight.
doi:10.1016/j.acap.2015.08.009
PMCID: PMC4760684  PMID: 26443036
Adolescent; Child; Emergency Service; Health Services/UT (Utilization); Hospital/UT (utilization); Pediatric Obesity; Obesity; Preschool
3.  Associations Between Anxiety Disorder Diagnoses and Body Mass Index Differ by Age, Sex and Race: A Population Based Study 
Background:
Few large studies have examined correlations between anxiety and body mass index (BMI) by gender or racial groups using clinical data.
Objective:
This study aimed to determine associations between diagnosed anxiety disorders and BMI, and evaluate whether observed associations varied by demographic characteristics.
Method:
Data from the Rochester Epidemiology Project (REP) data linkage system were analyzed to examine associations between anxiety disorders and BMI among adults ages 18-85 residing in Olmsted County, MN in 2009 (n=103,557). Height and weight data were available for 75,958 people (73%). The international classification of underweight, overweight, and obesity by BMI was used.
Results:
Population consisted of 56% females, 92.8% White individuals, with median age of 46 years. When adjusted for age, sex, and race, we observed a U-shaped association between anxiety and BMI group. Underweight and obese individuals were more likely to have an anxiety diagnosis compared to normal weight individuals. Stratification by sex yielded a U-shaped association between anxiety and BMI only in women. Stratification by race showed a U-shaped association between anxiety and BMI only in the White population. Anxiety was significantly associated only with obesity in the Black population. Anxiety was not associated with a BMI category in Asian or Hispanic groups. Among elderly group, there is inverse correlation between anxiety and obesity.
Conclusion:
Our results suggest that anxiety may have heterogeneous associations with BMI in the population. Further research on potential mechanisms contributing to these findings will help direct efforts in anxiety and obesity management across diverse population groups.
doi:10.2174/1745017901612010067
PMCID: PMC5090775  PMID: 27857777
Anxiety; Body mass index; Correlation; Gender; Population based; Race
4.  Awareness and knowledge of Human Papillomavirus (HPV), HPV‐related cancers, and HPV vaccines in an uninsured adult clinic population 
Cancer Medicine  2016;5(11):3346-3352.
Abstract
Human papillomavirus (HPV) vaccines offer primary prevention of cervical cancer and protection against other HPV‐associated cancers. HPV vaccine coverage in the United States (U.S.) remains low, particularly among older adolescents/young adults, and the uninsured. We assessed awareness and knowledge of HPV disease, HPV‐related cancers, and HPV vaccines among working, uninsured adults. Data from the 2014 Health Information National Trends Survey (HINTS 4, Cycle 4) were used as a benchmark. Patients were surveyed in late 2014 at the Volunteers in Medicine free clinic in Duval County, Florida. Surveys contained validated measures of HPV disease and vaccine knowledge; HPV‐related cancer knowledge was also assessed. Two‐hundred and ninety‐six surveys were analyzable with an 84% participation rate. Half (50.3%) of participants had heard of HPV, and 32.1% had heard of the HPV vaccine; in HINTS, these estimates were 63.6% and 62.7%, respectively (both P < 0.0001). In adjusted models, high HPV disease knowledge was associated with white race and increased education; high vaccine knowledge was associated with white race, increased education, and female sex. Recognition of HPV as a causative agent was 43.9% for cervical, 9.1% for anal, and 11.1% for throat cancers. For all HPV‐associated cancers, participants had lower knowledge/recognition relative to HINTS. The uninsured, socioeconomically disadvantaged adults we surveyed were unaware of a ubiquitous virus that can cause cancer and the existence of a vaccine to protect against it. These findings point to settings and populations in which initiatives to promote HPV vaccination as a cancer prevention tool remain critical.
doi:10.1002/cam4.933
PMCID: PMC5119989  PMID: 27748078
Adult; health care disparities; knowledge; oncogenic viruses; papillomavirus vaccines
5.  Profiles of influenza A/H1N1 vaccine response using hemagglutination-inhibition titers  
To identify distinct antibody profiles among adults 50-to-74 years old using influenza A/H1N1 HI titers up to 75 days after vaccination. Healthy subjects 50 to 74 years old received the 2010-2011 trivalent inactivated influenza vaccine. We measured venous samples from Days 0, 28, and 75 for HI and VNA and B-cell ELISPOTs. Of 106 subjects, HI titers demonstrated a ceiling effect for 11 or 10% for those with a pre-vaccination HI titer of 1:640 where no subject post-vaccination had an increase in titer. Of the remaining 95 subjects, only 37 or 35% overall had at least a 4-fold increase by Day 28. Of these 37, 3 waned at least 4-fold, and 13 others 2-fold. Thus 15% of the subjects showed waning antibody titers by Day 75. More than half failed to respond at all. The profiles populated by these subjects as defined by HI did not vary with age or gender. The VNA results mimicked the HI profiles, but the profiles for B-cell ELISPOT did not. HI titers at Days 0, 28, and 75 populate 4 biologically plausible profiles. Limitations include lack of consensus for operationally defining waning as well as for the apparent ceiling. Furthermore, though well accepted as a marker for vaccine response, assigning thresholds with HI has limitations. However, VNA closely matches HI in populating these profiles. Thus, we hold that these profiles, having face- and content-validity, may provide a basis for understanding variation in genomic and transcriptomic response to influenza vaccination in this age group.
doi:10.1080/21645515.2015.1011990
PMCID: PMC4514374  PMID: 25835513
aging; antibodies; hemagglutinin glycoproteins; hemagglutination inhibition tests; H1N1 subtype; influenza vaccines; influenza a virus; influenza virus; viral
6.  Predictors of Human Papillomavirus Awareness and Knowledge in 2013 
Background
Nearly 80 million people in the U.S. are currently infected with at least one of two strains of human papillomavirus (HPV), which is associated with 70% of cervical cancers. Greater cervical cancer mortality has been observed among women of lower SES and those living in rural, versus urban, areas. African American and Hispanic women are significantly more likely to die from cervical cancer than non-Hispanic white women.
Purpose
To assess current population awareness of and knowledge about HPV and the HPV vaccine, as well as the contribution of sociodemographic characteristics to disparities in HPV awareness and knowledge.
Methods
Cross-sectional data were obtained from the National Cancer Institute’s 2013 Health Information National Trends Survey (HINTS; N=3,185). Multivariable logistic regression was employed to identify gaps in awareness and knowledge by sex, education, income, race/ethnicity, geographic area, and other important sociodemographic characteristics. Analyses were conducted in 2014.
Results
Sixty-eight percent of Americans had heard of HPV and the HPV vaccine. Consistent with the Knowledge Gap Hypothesis, awareness and knowledge were patterned by sex, age, education, and other important sociodemographic factors. Those in rural areas were less likely than those in urban areas to know that HPV causes cervical cancer. Less than 5% of Americans were aware that HPV often clears on its own without treatment.
Conclusions
Although awareness and knowledge of HPV is increasing, there are opportunities to target communication with populations for whom knowledge gaps currently exist, in order to promote dialogue about the vaccine among patients and their providers.
doi:10.1016/j.amepre.2014.10.024
PMCID: PMC4380806  PMID: 25700651
7.  Impact of a physician recommendation 
Human Vaccines & Immunotherapeutics  2014;10(9):2632-2635.
HPV vaccination has failed to achieve uptake comparable to the other adolescent-specific vaccines. Gargano et al. conducted a survey of parents of adolescents in a single Georgia county and found uptake similar to national surveys. They also found among the most commonly cited reasons for receiving vaccines a recommendation from a health care provider and among the most commonly cited reasons for not getting any of the adolescent vaccines were concerns for adverse effects. Of note, they found that the recommendation for any one vaccine had a positive effect on the uptake of other vaccines. Their findings of the importance of provider recommendations matched findings from other studies of adolescent vaccines, infant vaccines, and adult vaccines. This is despite flaws in their study including a very poor response rate (effectively 4.5%) of those surveyed and in their reporting including a lack of details of survey methods. Local surveys of vaccination have much to offer the national and local discussion about immunization delivery and how delivery should be optimized, but such surveys should use standardized approaches as well as pursue more comprehensive investigations at the local level to address the nuances national complex-cluster surveys cannot.
doi:10.4161/hv.29020
PMCID: PMC4975061  PMID: 25483503
adolescent; preventive health services; vaccination; immunization; adolescent health services; vaccines; meningococcal vaccines; papillomavirus vaccines; tetanus toxoid; diphtheria-tetanus vaccine; attitude to health; patient acceptance of health care; treatment refusal
8.  Human Papillomavirus Vaccination: A Case Study in Translational Science 
Each year 610,000 cases of anogenital and oropharyngeal cancers caused by human papillomavirus (HPV) occur worldwide. HPV vaccination represents a promising opportunity to prevent cancer on a global scale. The vaccine’s story dates back to discoveries in chickens at the beginning of the 20th century with evidence that a cell-free filtrate could transmit the propensity to grow cancers. Later, studies with similarly derived filtrates from mammalian tumors showed that hosts could develop immunity to subsequent exposures. Epidemiologic studies linked cervical cancer to members of a family of viruses that cause papillomatosis and common warts. This led to work with DNA hybridization demonstrating a causal relationship. The formation of virus-like particles (VLPs) from viral capsid proteins led to the development of models for safe and effective vaccines. While much work remains with the acceptance of universal vaccination, the HPV vaccines Gardasil® and Cervarix® thus represent a century of successful translational research.
doi:10.1111/cts.12166
PMCID: PMC4213215  PMID: 24841923
Papillomavirus Vaccines; Vaccination; Vaccines; Virus-Like Particle; Papillomavirus Infections; Uterine Cervical Neoplasms; Uterine Cervical Neoplasms/pc [Prevention & Control]; Translational Medical Research; Adolescent
9.  Asthma Status and Waning of Measles Antibody Concentrations after Measles Immunization 
Background
Asthmatics have increased risks of common and serious microbial infections including vaccine preventable diseases. Little is known about whether asthma influences waning of humoral immunity. We assessed whether asthma status influences waning of anti-measles virus antibody concentrations over time.
Methods
The study utilized a cross-sectional study cohort of healthy children who had been immunized with one-dose of MMR-II at age approximately 15 months. Between 5 and 12 years of age, measles vaccine virus-specific antibody (IgG) values were measured by EIA and considered seropositive if the EIA index unit was ≥ 1. The medical records were reviewed to determine asthma status during the first 18 years of life by applying predetermined criteria for asthma. A least squares regression model was used to evaluate the effect of asthma status on the relationship between measles antibody titer and time elapsed between the initial measles vaccination and measurement of measles antibody concentrations.
Results
Of the 838 eligible children, 281 (34%) met criteria for asthma. Measles antibody waned over time (r=-0.19, p<0.001), specifically more rapidly in asthmatics (r=-0.30, p<0.001, a decrease of -0.114 unit per year) than non-asthmatics (r=-0.13, p=0.002, a decrease of -0.046 unit per year) (p-value for interaction=0.010). This differential waning rate resulted in a lower mean (SD) measles antibody concentration [1.42 (0.67) vs. 1.67 (0.69), p=0.008] and lower seropositivity rate (73% vs. 84%, p=0.038) in asthmatics than non-asthmatics starting around 9.3 years after the initial measles vaccination.
Conclusion
Asthma status is associated with waning kinetics of measles antibody among children.
doi:10.1097/INF.0000000000000375
PMCID: PMC4216609  PMID: 24830696
Asthma; epidemiology; humoral immunity; waning; measles
10.  HLA Genotypes and Rubella Vaccine Immune Response: Additional Evidence 
Vaccine  2014;32(33):4206-4213.
Recent population-based studies have demonstrated the genetic heritability of rubella vaccine response and assessed that the HLA system may explain about 20% of the inter-individual variance in humoral immune response to this vaccine. Our earlier studies compared HLA allelic associations with rubella vaccine-specific antibodies between two smaller cohorts of healthy Rochester, MN, children (346 and 396 subjects) after two doses of rubella-containing vaccine. This study found that specific HLA alleles were consistently associated with rubella-specific antibody titers (B*27:05, DPA1*02:01, and DPB1*04:01 alleles). The current study examined HLA associations in an independent larger cohort of 1,012 healthy San Diego, CA, subjects (age 19-40 years) after rubella vaccine in order to replicate our previous findings in the Rochester subjects. Two HLA associations of comparable magnitudes were consistently observed between B*27:05 (median NT50 Rochester cohort 48.9, p=0.067; San Diego cohort 54.8, p=0.047) and DPB1*04:01 (median NT50 Rochester cohort 61.6, p<0.001; San Diego cohort 70.8, p=0.084) alleles and rubella virus-neutralizing antibody titers. Additional HLA alleles resulted in consistent effects on IL-6 production in both cohorts, but did not meet criteria for statistical significance. Our data suggest these HLA alleles play a role in rubella vaccine-induced immunity and provide the basis for future studies that may explain the mechanism(s) by which these HLA polymorphisms affect immune responses to rubella vaccine.
doi:10.1016/j.vaccine.2014.04.091
PMCID: PMC4124933  PMID: 24837503
HLA antigens; alleles; rubella vaccine; vaccination; rubella; antibodies; neutralizing; cytokines
11.  Efficacy, Immunogenicity, and Safety of Two Doses of a Tetravalent Rotavirus Vaccine RRV-TV in Ghana With the First Dose Administered During the Neonatal Period 
The Journal of Infectious Diseases  2013;208(3):423-431.
Background. Oral rhesus/rhesus-human reassortant rotavirus tetravalent vaccine (RRV-TV) was licensed in 1998 but withdrawn in 1999 due to a rare association with intussusception, which occurred disproportionately in infants receiving their first dose at ≥90 days of age. This study examined RRV-TV for the prevention of rotavirus gastroenteritis (RV-GE) in Ghana, West Africa, with infants receiving the first dose during the neonatal period and the second before 60 days of age.
Methods. In a double-blinded, randomized, placebo-controlled trial in Navrongo, Ghana, we recruited neonates to receive 2 doses of RRV-TV or placebo and followed them to age 12 months.
Results. In the intention-to-treat population of 998 infants, we measured a vaccine efficacy of 63.1% against RV-GE of any severity associated with any of the 4 serotypes represented in the vaccine and 60.7% against RV-GE associated with any rotavirus serotype.
Conclusions. RRV-TV in a 2-dose schedule with the first dose during the neonatal period is efficacious in preventing RV-GE in rural Ghana. Neonatal dosing results in early protection and may be the optimum schedule to avoid or significantly reduce intussusception, now reported to be associated in international settings with the 2 most widely marketed, licensed, live virus, oral rotavirus vaccines.
doi:10.1093/infdis/jit174
PMCID: PMC3699001  PMID: 23599316
rotavirus; rotavirus infections; rotavirus vaccines; Ghana; randomized controlled trial; diarrhea; infantile; gastroenteritis; humans; infant; vaccines; attenuated
12.  Independence of Measles-Specific Humoral and Cellular Immune Responses to Vaccination 
Human Immunology  2012;73(5):474-479.
With a larger, independent cohort and more sophisticated measures, we sought to confirm our work that indicated independence of humoral and cellular immunity following measles vaccination. We recruited an age-stratified random cohort of 764 healthy subjects from all socio-economic strata, all with medical-record documentation of two age-appropriate doses of measles-containing vaccine. We quantified measles-specific neutralizing antibody levels and assayed the IFN-γ ELISPOT response to measles virus. We also measured secreted cytokines from the PBMCs in response to measles virus by performing enzyme-linked immunosorbent assays as secondary measures of cellular immune status. The median antibody level and median IFN-γ ELISPOT response were 844 mIU/mL (IQR: 418 to 1,752) and 36 (IQR: 13.00 to 69.00) spot-forming cells (per 2×105 PBMCs), respectively. We found only a very weak and negative correlation [Spearman’s rs or rho of −0.090 (95 percent confidence interval −0.162 to −0.018)]. We found a similar lack of quantitatively important correlations between the neutralizing antibody level and any of the secondary measures. Our data confirm the independence of humoral and cellular immune responses after the second dose of measles vaccination. As researchers pursue novel measles vaccine and measles vaccine delivery systems, they must not infer that humoral responses predict cellular responses.
doi:10.1016/j.humimm.2012.02.016
PMCID: PMC3338862  PMID: 22406060
Measles Vaccine; Immunity, Humoral; Immunity, Cellular; Antibody Formation; Cytokines
13.  Measles, Mumps, and Rubella 
Measles, mumps, and rubella are viral diseases that may adversely affect non-immune pregnant women and their fetuses/neonates. Prevention of these diseases and their complications can be achieved through measles-mumps-rubella (MMR) vaccination prior to pregnancy. The vaccine is contraindicated during pregnancy because it contains live, attenuated viruses that pose a theoretical risk to the fetus. However, accidental receipt of MMR vaccination is not known to cause maternal/fetal complications. MMR immunization is recommended to non-immune obstetric patients upon completion or termination of pregnancy.
doi:10.1097/GRF.0b013e31824df256
PMCID: PMC3334858  PMID: 22510638
Measles-Mumps-Rubella Vaccine; Measles; Mumps; Rubella; Congenital Rubella Syndrome; Obstetrics
14.  Leptin and Leptin-Related Gene Polymorphisms, Obesity, and Influenza A/H1N1 Vaccine–Induced Immune Responses in Older Individuals 
Vaccine  2013;32(7):881-887.
Obesity is a risk factor for complicated influenza A/H1N1 disease and poor vaccine immunogenicity. Leptin, an adipocyte-derived hormone/cytokine, has many immune regulatory functions and therefore could explain susceptibility to infections and poor vaccine outcomes. We recruited 159 healthy adults (5074 years old) who were immunized with inactivated TIV influenza vacci–ne that contained A/California/7/2009/H1N1 virus. We found a strong correlation between leptin concentration and BMI (r=0.55, p<0.0001), but no association with hemagglutination antibody inhibition (HAI), B-cell, or granzyme B responses. We found a slight correlation between leptin concentration and an immunosenescence marker (TREC: T-cell receptor excision circles) level (r=0.23, p=0.01). We found eight SNPs in the LEP/LEPR/GHRL genes that were associated with leptin levels and four SNPs in the PTPN1/LEPR/STAT3 genes associated with peripheral blood TREC levels (p<0.05). Heterozygosity of the synonymous variant rs2230604 in the PTPN1 gene was associated with a significantly lower (531 vs. 259, p = 0.005) TREC level, as compared to the homozygous major variant. We also found eight SNPs in the LEP/PPARG/CRP genes associated with variations in influenza-specific HAI and B-cell responses (p<0.05). Our results suggest that specific allelic variations in the leptin-related genes may influence adaptive immune responses to influenza vaccine.
doi:10.1016/j.vaccine.2013.12.009
PMCID: PMC3922536  PMID: 24360890
Influenza Vaccines; Influenza A Virus; H1N1 Subtype; Immunity; Polymorphism; Single Nucleotide; Receptors; Leptin; Obesity; Adipose Tissue; Overweight; Aging; Adult; Adipocytes; A/H1N1 virus; immune response; SNPs; obese; immunosenescence; BMI
15.  Health outcomes in diabetics measured with Minnesota Community Measurement quality metrics 
Objective
Our objective was to understand the relationship between optimal diabetes control, as defined by Minnesota Community Measurement (MCM), and adverse health outcomes including emergency department (ED) visits, hospitalizations, 30-day rehospitalization, intensive care unit (ICU) stay, and mortality.
Patients and methods
In 2009, we conducted a retrospective cohort study of empaneled Employee and Community Health patients with diabetes mellitus. We followed patients from 1 September 2009 until 30 June 2011 for hospitalization and until 5 January 2014 for mortality. Optimal control of diabetes mellitus was defined as achieving the following three measures: low-density lipoprotein (LDL) cholesterol <100 mg/mL, blood pressure <140/90 mmHg, and hemoglobin A1c <8%. Using the electronic medical record, we assessed hospitalizations, ED visits, ICU stays, 30-day rehospitalizations, and mortality. The chi-square or Wilcoxon rank-sum tests were used to compare those with and without optimal control. We used Cox proportional hazard models to estimate the associations between optimal diabetes mellitus status and each outcome.
Results
We identified 5,731 empaneled patients with diabetes mellitus; 2,842 (49.6%) were in the optimal control category. After adjustment, we observed that non-optimally controlled patients had higher risks for hospitalization (hazard ratio [HR] 1.11; 95% confidence interval [CI] 1.00–1.23), ED visits (HR 1.15; 95% CI 1.06–1.25), and mortality (HR 1.29; 95% CI 1.09–1.53) than diabetic patients with optimal control. No differences were observed in ICU stay or 30-day rehospitalization.
Conclusion
Diabetic patients without optimal control had higher risks of adverse health outcomes than those with optimal control. Patients with optimal control defined by the MCM were associated with decreased morbidity and mortality.
doi:10.2147/DMSO.S71726
PMCID: PMC4274142  PMID: 25565873
case management; diabetes mellitus; hyperlipidemia; hypertension
16.  Assessment of humoral and cell-mediated immune response to measles–mumps–rubella vaccine viruses among patients with asthma 
Little is known about the influence of asthma status on humoral and cell-mediated immune responses to measles–mumps–rubella (MMR) vaccine viruses. We compared the virus-specific IgG levels and lymphoproliferative response of peripheral blood mononuclear cells to MMR vaccine viruses between asthmatic and nonasthmatic patients. The study subjects included 342 healthy children aged 12–18 years who had received two doses of the MMR vaccine. We ascertained asthma status by applying predetermined criteria. Of the 342 subjects, 230 were available for this study of whom 25 were definite asthmatic patients (10.9%) and the rest of subjects were nonasthmatic patients. The mean of the log-transformed lymphoproliferative responses between definite asthma and nonasthma who had a family history of asthma were for measles, 0.92 ± 0.31 versus 1.54 ± 0.17 (p = 0.125); for mumps, 0.98 ± 0.64 versus 2.20 ± 0.21 (p = 0.035); and for rubella, 0.12 ± 0.37 versus 0.97 ± 0.16 (p = 0.008), respectively, adjusting for the duration between the first MMR vaccination and determination of the immune responses. There were no such differences among children without a family history of asthma. MMR virus–specific IgG levels were not different between study subjects with or without asthma. The study findings suggest asthmatic patients may have a suboptimal cell-mediated immune response to MMR vaccine viruses and a family history of asthma modifies this effect.
doi:10.2500/aap.2010.31.3399
PMCID: PMC3941466  PMID: 21708062
17.  Impact of delay in asthma diagnosis on health care service use 
Delays in diagnosing asthma in children are common and are known to delay asthma-specific treatment. Few studies have investigated whether a delay in asthma diagnosis impacts the use of health care services. This study was designed to assess whether a delay in diagnosis of asthma influences the use of health care services. This was a retrospective cohort study with subjects elicited from a convenience sample of 839 healthy children. The criteria for asthma was met in 276 (33%) subjects; of these subjects 179 (65%) had a delay in the diagnosis of asthma and 97 (35%) had a timely diagnosis. Data on health care services (e.g., flu shot, availability of a peak flow meter, hospitalizations, and urgent care or emergency department visits) and the frequency of systemic steroid treatments were collected from medical records during the first 18 years of life. The frequencies of health service and use of systemic steroids were compared using Poisson and logistic regression models in asthmatic children with and without a delay in asthma diagnosis. Children with a delay in asthma diagnosis were more likely to visit urgent care centers at least once (40.8% versus 21.6%; p < 0.001), compared with those with a timely diagnosis. There were no significant differences in other health care service or systemic steroid use. A delay in the diagnosis of asthma was associated with an increase in urgent care visits suggesting suboptimal care. Clinicians should be aware that a delay in the diagnosis of asthma in children may result in the use of suboptimal health care services.
doi:10.2500/aap.2010.31.3358
PMCID: PMC3920287  PMID: 20819315
Accessibility; adolescent; asthma; child; control; delivery of health care; diagnosis; health services; treatment; urgent care
18.  Genome-Wide Genetic Associations with IFNγ Response to Smallpox Vaccine 
Human genetics  2012;131(9):1433-1451.
Smallpox is a deadly and debilitating disease that killed hundreds of millions of people in the past century alone. The use of vaccinia-virus based smallpox vaccines led to the eradication of smallpox. These vaccines are remarkably effective, inducing the characteristic pustule or “take” at the vaccine site in > 97% of recipients, and inducing a wide spectrum of long-lasting humoral and cellular immune responses. The mechanisms behind inter-individual vaccine response variability are likely to involve host genetic variation, but have not been fully characterized. We report here the first smallpox vaccine-response genome-wide association study of over 1,000 recent recipients of Dryvax®. The data presented here focus on cellular immune responses as measured by both production of secreted IFNγ and quantitation of IFNγ secreting cells by ELISPOT assay. We identified multiple significant SNP associations in genes (RASA1, ADRA1D, TCF7L1, FAS) that are critical components of signaling pathways that directly control lymphocyte IFNγ production or cytotoxic T cell function. Similarly, we found many associations with SNPs located in genes integral to nerve cell function; findings that, given the complex interplay between the nervous and immune systems, deserve closer examination in follow-up studies.
doi:10.1007/s00439-012-1179-x
PMCID: PMC4170655  PMID: 22661280
smallpox vaccine; vaccinia virus; genome-wide association study; single nucleotide polymorphism; interferon-gamma
19.  Impact of Asthma on the Severity of Serious Pneumococcal Disease 
We recently reported an increased risk of serious pneumococcal disease (SPD) in asthmatics. Little is known about the impact of asthma status on the severity of SPD. We compared the severity of serious pneumococcal disease (SPD) between patients with asthma and those without asthma. The study subjects were Rochester, Minnesota residents who developed SPD between 1964 and 1983. SPD and asthma status were ascertained by using explicit predetermined criteria Severity of SPD was assessed using intensive care unit (ICU) admission rate and total days of ICU stay and hospitalization associated with treatment for SPD. We found that there were no significant differences in severity outcomes between asthmatics (n=11) and non-asthmatics (n=163). Asthma status may increase the risk of SPD but not influence its severity. However, given a small sample size of our study, a larger study needs to be considered to clarify the relationship between asthma and severity of SPD.
doi:10.4172/2161-1165.S3-001
PMCID: PMC4166487  PMID: 25243098
Asthma; Epidemiology; Pneumococcal disease; Atopy; Severity; Prognosis; Pneumonia; Invasive pneumococcal disease; Vaccine; Serious pneumococcal disease
20.  Asthma and the immune response to MMR vaccine viruses in Somali immigrant children: a cross-sectional retrospective cohort study 
Background
According to the `hygiene hypothesis', an increase in microbial exposure in childhood leads to a T-helper cell 1 (Th1) predominant immune response and protection against asthma and atopic conditions.
Aims
To assess the prevalence of asthma and other atopic conditions in Somali immigrants and to determine the humoral immune response to the measles, mumps, and rubella (MMR) vaccine viruses in Somali immigrants with asthma.
Methods
A retrospective cohort study was conducted in Olmsted County, Minnesota. Study subjects were Somali immigrants who were born and lived in Africa during childhood and immigrated to the USA. The subjects had participated in a previous MMR vaccine study. Asthma was ascertained using predetermined asthma criteria after a thorough medical record review. An atopic condition was determined from physician-diagnosed ICD codes. Virus-specific IgG levels in response to the MMR vaccine viruses were determined using an enzyme immunoassay.
Results
Of the 62 eligible subjects, 33 (53%) were female and 29 (47%) were male; 10 (16%) had asthma and 22 (35%) had other atopic conditions. There was no difference in the rubella (p=0.150) and measles (p=0.715) virus-specific IgG levels between the subjects with and without asthma. Mumps virus-specific IgG antibody levels were lower in those with asthma than in those without asthma (mean±SE 2.08±0.28 vs. 3.06±0.14, p=0.005).
Conclusions
Our study results may not support the hygiene hypothesis. In addition, the previously reported abnormal T-cell development in Caucasian children with atopy can be considered even in Somali immigrants.
doi:10.4104/pcrj.2013.00039
PMCID: PMC3914143  PMID: 23636585
asthma; hygiene hypothesis; immunity; measles; mumps; rubella
21.  Characteristics of Children with Asthma Who Achieved Remission of Asthma 
Objective
To characterize two groups of asthmatics who had achieved remission and those who had not achieved remission of asthma.
Methods
The study was a retrospective cohort study based on 117 asthmatic children who participated in a previous study. We categorized the children into two groups: asthmatics with remission versus asthmatics without remission. We defined remission of asthma as lack of symptoms/signs of asthma or asthma-related medications or health care services for at least three consecutive years. Long-term remission was defined by no relapse of asthma after achieving remission. We characterized these groups.
Results
Of the 117 subjects, 70 (60%) were male, 91 (78%) were Caucasians, and the mean age at index date of asthma was 8.1 years. A total of 59 asthmatic children (50%) achieved remission and 28 asthmatics (24%) achieved long-term remission. Asthmatics with remission were more likely to be Caucasian (87%) compared to those without (69%) (p = .039) There were no differences in the frequency of visits for viral (0.3 vs. 0.4 per person-years, p = .29) or bacterial infections (0.7 vs. 0.5 per person-years, p = .49) between asthmatics with and without remission. Gender, socioeconomic status, smoking exposure, family history of asthma or atopy, breastfeeding history, peak flow meter availability, asthma action plan, and influenza vaccinations were not associated with remission.
Conclusions
Only half of asthmatic children accomplished remission of asthma ever and 24% of asthmatic children had long-term remission. Ethnicity may affect remission of asthma but microbial infections may not influence the likelihood of remission of asthma and vice versa.
doi:10.3109/02770903.2013.787625
PMCID: PMC3761883  PMID: 23514196
asthma; childhood; epidemiology; microbial infection; remission; risk
22.  Vaccinomics, adversomics, and the immune response network theory: Individualized vaccinology in the 21st century 
Seminars in immunology  2013;25(2):89-103.
Vaccines, like drugs and medical procedures, are increasingly amenable to individualization or personalization, often based on novel data resulting from high throughput “omics” technologies. As a result of these technologies, 21st century vaccinology will increasingly see the abandonment of a “one size fits all” approach to vaccine dosing and delivery, as well as the abandonment of the empiric “isolate–inactivate–inject” paradigm for vaccine development. In this review, we discuss the immune response network theory and its application to the new field of vaccinomics and adversomics, and illustrate how vaccinomics can lead to new vaccine candidates, new understandings of how vaccines stimulate immune responses, new biomarkers for vaccine response, and facilitate the understanding of what genetic and other factors might be responsible for rare side effects due to vaccines. Perhaps most exciting will be the ability, at a systems biology level, to integrate increasingly complex high throughput data into descriptive and predictive equations for immune responses to vaccines. Herein, we discuss the above with a view toward the future of vaccinology.
doi:10.1016/j.smim.2013.04.007
PMCID: PMC3752773  PMID: 23755893
Adaptive immunity; Biotechnology; Computational biology; Genomics; Immunogenetics; Individualized medicine; Proteomics; Systems biology; Vaccination; Vaccines; Modeling; Vaccinomics; Adversomics; Predictive equation; Immune response network theory; Individualized vaccinology
23.  The Role of HLA DR-DQ Haplotypes in Variable Antibody Responses to Anthrax Vaccine Adsorbed 
Genes and immunity  2011;12(6):457-465.
Host genetic variation, particularly within the human leukocyte antigen (HLA) loci, reportedly mediates heterogeneity in immune response to certain vaccines; however, no large study of genetic determinants of anthrax vaccine response has been described. We searched for associations between the IgG antibody to protective antigen (AbPA) response to Anthrax Vaccine Adsorbed (AVA) in humans and polymorphisms at HLA class I (HLA-A, -B, and -C) and class II (HLA-DRB1, -DQA1, -DQB1, -DPB1) loci. The study included 794 European-Americans and 200 African-Americans participating in a 43-month, double-blind, placebo-controlled, clinical trial of AVA (clinicaltrials.gov identifier NCT00119067). Among European-Americans, genes from tightly linked HLA-DRB1-DQA1-DQB1 haplotypes displayed significant overall associations with longitudinal variation in AbPA levels at 4, 8, 26, and 30 weeks from baseline in response to vaccination with 3 or 4 doses of AVA (global p=6.53×10−4). In particular, carriage of the DRB1-DQA1-DQB1 haplotypes *1501-*0102-*0602 (p=1.17×10−5), *0101-*0101-*0501 (p=0.009), and *0102-*0101-*0501 (p=0.006) was associated with significantlylower AbPA levels. In carriers of two copies of these haplotypes, lower AbPA levels persisted following subsequent vaccinations. No significant associations were observed amongst African-Americans or for any HLA class I allele/haplotype. Further studies will be required to replicate these findings and to explore the role of host genetic variation outside of the HLA region.
doi:10.1038/gene.2011.15
PMCID: PMC3165112  PMID: 21368772
Anthrax vaccines; Bacillus anthracis; Bacterial vaccines; Vaccination; HLA Antigens
24.  Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine 
Vaccine  2011;29(48):8988-8997.
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans.
Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20.
In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.
doi:10.1016/j.vaccine.2011.09.043
PMCID: PMC3941984  PMID: 21939710
Single Nucleotide Polymorphisms; Haplotypes; Antiviral genes; Measles vaccine; Immunity
25.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response

Results 1-25 (85)