PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (75)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
1.  Leptin and Leptin-Related Gene Polymorphisms, Obesity, and Influenza A/H1N1 Vaccine–Induced Immune Responses in Older Individuals 
Vaccine  2013;32(7):881-887.
Obesity is a risk factor for complicated influenza A/H1N1 disease and poor vaccine immunogenicity. Leptin, an adipocyte-derived hormone/cytokine, has many immune regulatory functions and therefore could explain susceptibility to infections and poor vaccine outcomes. We recruited 159 healthy adults (5074 years old) who were immunized with inactivated TIV influenza vacci–ne that contained A/California/7/2009/H1N1 virus. We found a strong correlation between leptin concentration and BMI (r=0.55, p<0.0001), but no association with hemagglutination antibody inhibition (HAI), B-cell, or granzyme B responses. We found a slight correlation between leptin concentration and an immunosenescence marker (TREC: T-cell receptor excision circles) level (r=0.23, p=0.01). We found eight SNPs in the LEP/LEPR/GHRL genes that were associated with leptin levels and four SNPs in the PTPN1/LEPR/STAT3 genes associated with peripheral blood TREC levels (p<0.05). Heterozygosity of the synonymous variant rs2230604 in the PTPN1 gene was associated with a significantly lower (531 vs. 259, p = 0.005) TREC level, as compared to the homozygous major variant. We also found eight SNPs in the LEP/PPARG/CRP genes associated with variations in influenza-specific HAI and B-cell responses (p<0.05). Our results suggest that specific allelic variations in the leptin-related genes may influence adaptive immune responses to influenza vaccine.
doi:10.1016/j.vaccine.2013.12.009
PMCID: PMC3922536  PMID: 24360890
Influenza Vaccines; Influenza A Virus; H1N1 Subtype; Immunity; Polymorphism; Single Nucleotide; Receptors; Leptin; Obesity; Adipose Tissue; Overweight; Aging; Adult; Adipocytes; A/H1N1 virus; immune response; SNPs; obese; immunosenescence; BMI
2.  Health outcomes in diabetics measured with Minnesota Community Measurement quality metrics 
Objective
Our objective was to understand the relationship between optimal diabetes control, as defined by Minnesota Community Measurement (MCM), and adverse health outcomes including emergency department (ED) visits, hospitalizations, 30-day rehospitalization, intensive care unit (ICU) stay, and mortality.
Patients and methods
In 2009, we conducted a retrospective cohort study of empaneled Employee and Community Health patients with diabetes mellitus. We followed patients from 1 September 2009 until 30 June 2011 for hospitalization and until 5 January 2014 for mortality. Optimal control of diabetes mellitus was defined as achieving the following three measures: low-density lipoprotein (LDL) cholesterol <100 mg/mL, blood pressure <140/90 mmHg, and hemoglobin A1c <8%. Using the electronic medical record, we assessed hospitalizations, ED visits, ICU stays, 30-day rehospitalizations, and mortality. The chi-square or Wilcoxon rank-sum tests were used to compare those with and without optimal control. We used Cox proportional hazard models to estimate the associations between optimal diabetes mellitus status and each outcome.
Results
We identified 5,731 empaneled patients with diabetes mellitus; 2,842 (49.6%) were in the optimal control category. After adjustment, we observed that non-optimally controlled patients had higher risks for hospitalization (hazard ratio [HR] 1.11; 95% confidence interval [CI] 1.00–1.23), ED visits (HR 1.15; 95% CI 1.06–1.25), and mortality (HR 1.29; 95% CI 1.09–1.53) than diabetic patients with optimal control. No differences were observed in ICU stay or 30-day rehospitalization.
Conclusion
Diabetic patients without optimal control had higher risks of adverse health outcomes than those with optimal control. Patients with optimal control defined by the MCM were associated with decreased morbidity and mortality.
doi:10.2147/DMSO.S71726
PMCID: PMC4274142  PMID: 25565873
case management; diabetes mellitus; hyperlipidemia; hypertension
3.  Efficacy, Immunogenicity, and Safety of Two Doses of a Tetravalent Rotavirus Vaccine RRV-TV in Ghana With the First Dose Administered During the Neonatal Period 
The Journal of Infectious Diseases  2013;208(3):423-431.
Background. Oral rhesus/rhesus-human reassortant rotavirus tetravalent vaccine (RRV-TV) was licensed in 1998 but withdrawn in 1999 due to a rare association with intussusception, which occurred disproportionately in infants receiving their first dose at ≥90 days of age. This study examined RRV-TV for the prevention of rotavirus gastroenteritis (RV-GE) in Ghana, West Africa, with infants receiving the first dose during the neonatal period and the second before 60 days of age.
Methods. In a double-blinded, randomized, placebo-controlled trial in Navrongo, Ghana, we recruited neonates to receive 2 doses of RRV-TV or placebo and followed them to age 12 months.
Results. In the intention-to-treat population of 998 infants, we measured a vaccine efficacy of 63.1% against RV-GE of any severity associated with any of the 4 serotypes represented in the vaccine and 60.7% against RV-GE associated with any rotavirus serotype.
Conclusions. RRV-TV in a 2-dose schedule with the first dose during the neonatal period is efficacious in preventing RV-GE in rural Ghana. Neonatal dosing results in early protection and may be the optimum schedule to avoid or significantly reduce intussusception, now reported to be associated in international settings with the 2 most widely marketed, licensed, live virus, oral rotavirus vaccines.
doi:10.1093/infdis/jit174
PMCID: PMC3699001  PMID: 23599316
rotavirus; rotavirus infections; rotavirus vaccines; Ghana; randomized controlled trial; diarrhea; infantile; gastroenteritis; humans; infant; vaccines; attenuated
4.  Genome-Wide Genetic Associations with IFNγ Response to Smallpox Vaccine 
Human genetics  2012;131(9):1433-1451.
Smallpox is a deadly and debilitating disease that killed hundreds of millions of people in the past century alone. The use of vaccinia-virus based smallpox vaccines led to the eradication of smallpox. These vaccines are remarkably effective, inducing the characteristic pustule or “take” at the vaccine site in > 97% of recipients, and inducing a wide spectrum of long-lasting humoral and cellular immune responses. The mechanisms behind inter-individual vaccine response variability are likely to involve host genetic variation, but have not been fully characterized. We report here the first smallpox vaccine-response genome-wide association study of over 1,000 recent recipients of Dryvax®. The data presented here focus on cellular immune responses as measured by both production of secreted IFNγ and quantitation of IFNγ secreting cells by ELISPOT assay. We identified multiple significant SNP associations in genes (RASA1, ADRA1D, TCF7L1, FAS) that are critical components of signaling pathways that directly control lymphocyte IFNγ production or cytotoxic T cell function. Similarly, we found many associations with SNPs located in genes integral to nerve cell function; findings that, given the complex interplay between the nervous and immune systems, deserve closer examination in follow-up studies.
doi:10.1007/s00439-012-1179-x
PMCID: PMC4170655  PMID: 22661280
smallpox vaccine; vaccinia virus; genome-wide association study; single nucleotide polymorphism; interferon-gamma
5.  Impact of Asthma on the Severity of Serious Pneumococcal Disease 
We recently reported an increased risk of serious pneumococcal disease (SPD) in asthmatics. Little is known about the impact of asthma status on the severity of SPD. We compared the severity of serious pneumococcal disease (SPD) between patients with asthma and those without asthma. The study subjects were Rochester, Minnesota residents who developed SPD between 1964 and 1983. SPD and asthma status were ascertained by using explicit predetermined criteria Severity of SPD was assessed using intensive care unit (ICU) admission rate and total days of ICU stay and hospitalization associated with treatment for SPD. We found that there were no significant differences in severity outcomes between asthmatics (n=11) and non-asthmatics (n=163). Asthma status may increase the risk of SPD but not influence its severity. However, given a small sample size of our study, a larger study needs to be considered to clarify the relationship between asthma and severity of SPD.
doi:10.4172/2161-1165.S3-001
PMCID: PMC4166487  PMID: 25243098
Asthma; Epidemiology; Pneumococcal disease; Atopy; Severity; Prognosis; Pneumonia; Invasive pneumococcal disease; Vaccine; Serious pneumococcal disease
6.  Asthma and the immune response to MMR vaccine viruses in Somali immigrant children: a cross-sectional retrospective cohort study 
Background
According to the `hygiene hypothesis', an increase in microbial exposure in childhood leads to a T-helper cell 1 (Th1) predominant immune response and protection against asthma and atopic conditions.
Aims
To assess the prevalence of asthma and other atopic conditions in Somali immigrants and to determine the humoral immune response to the measles, mumps, and rubella (MMR) vaccine viruses in Somali immigrants with asthma.
Methods
A retrospective cohort study was conducted in Olmsted County, Minnesota. Study subjects were Somali immigrants who were born and lived in Africa during childhood and immigrated to the USA. The subjects had participated in a previous MMR vaccine study. Asthma was ascertained using predetermined asthma criteria after a thorough medical record review. An atopic condition was determined from physician-diagnosed ICD codes. Virus-specific IgG levels in response to the MMR vaccine viruses were determined using an enzyme immunoassay.
Results
Of the 62 eligible subjects, 33 (53%) were female and 29 (47%) were male; 10 (16%) had asthma and 22 (35%) had other atopic conditions. There was no difference in the rubella (p=0.150) and measles (p=0.715) virus-specific IgG levels between the subjects with and without asthma. Mumps virus-specific IgG antibody levels were lower in those with asthma than in those without asthma (mean±SE 2.08±0.28 vs. 3.06±0.14, p=0.005).
Conclusions
Our study results may not support the hygiene hypothesis. In addition, the previously reported abnormal T-cell development in Caucasian children with atopy can be considered even in Somali immigrants.
doi:10.4104/pcrj.2013.00039
PMCID: PMC3914143  PMID: 23636585
asthma; hygiene hypothesis; immunity; measles; mumps; rubella
7.  Independence of Measles-Specific Humoral and Cellular Immune Responses to Vaccination 
Human Immunology  2012;73(5):474-479.
With a larger, independent cohort and more sophisticated measures, we sought to confirm our work that indicated independence of humoral and cellular immunity following measles vaccination. We recruited an age-stratified random cohort of 764 healthy subjects from all socio-economic strata, all with medical-record documentation of two age-appropriate doses of measles-containing vaccine. We quantified measles-specific neutralizing antibody levels and assayed the IFN-γ ELISPOT response to measles virus. We also measured secreted cytokines from the PBMCs in response to measles virus by performing enzyme-linked immunosorbent assays as secondary measures of cellular immune status. The median antibody level and median IFN-γ ELISPOT response were 844 mIU/mL (IQR: 418 to 1,752) and 36 (IQR: 13.00 to 69.00) spot-forming cells (per 2×105 PBMCs), respectively. We found only a very weak and negative correlation [Spearman’s rs or rho of −0.090 (95 percent confidence interval −0.162 to −0.018)]. We found a similar lack of quantitatively important correlations between the neutralizing antibody level and any of the secondary measures. Our data confirm the independence of humoral and cellular immune responses after the second dose of measles vaccination. As researchers pursue novel measles vaccine and measles vaccine delivery systems, they must not infer that humoral responses predict cellular responses.
doi:10.1016/j.humimm.2012.02.016
PMCID: PMC3338862  PMID: 22406060
Measles Vaccine; Immunity, Humoral; Immunity, Cellular; Antibody Formation; Cytokines
8.  Assessment of humoral and cell-mediated immune response to measles–mumps–rubella vaccine viruses among patients with asthma 
Little is known about the influence of asthma status on humoral and cell-mediated immune responses to measles–mumps–rubella (MMR) vaccine viruses. We compared the virus-specific IgG levels and lymphoproliferative response of peripheral blood mononuclear cells to MMR vaccine viruses between asthmatic and nonasthmatic patients. The study subjects included 342 healthy children aged 12–18 years who had received two doses of the MMR vaccine. We ascertained asthma status by applying predetermined criteria. Of the 342 subjects, 230 were available for this study of whom 25 were definite asthmatic patients (10.9%) and the rest of subjects were nonasthmatic patients. The mean of the log-transformed lymphoproliferative responses between definite asthma and nonasthma who had a family history of asthma were for measles, 0.92 ± 0.31 versus 1.54 ± 0.17 (p = 0.125); for mumps, 0.98 ± 0.64 versus 2.20 ± 0.21 (p = 0.035); and for rubella, 0.12 ± 0.37 versus 0.97 ± 0.16 (p = 0.008), respectively, adjusting for the duration between the first MMR vaccination and determination of the immune responses. There were no such differences among children without a family history of asthma. MMR virus–specific IgG levels were not different between study subjects with or without asthma. The study findings suggest asthmatic patients may have a suboptimal cell-mediated immune response to MMR vaccine viruses and a family history of asthma modifies this effect.
doi:10.2500/aap.2010.31.3399
PMCID: PMC3941466  PMID: 21708062
9.  Vaccinomics, adversomics, and the immune response network theory: Individualized vaccinology in the 21st century 
Seminars in immunology  2013;25(2):89-103.
Vaccines, like drugs and medical procedures, are increasingly amenable to individualization or personalization, often based on novel data resulting from high throughput “omics” technologies. As a result of these technologies, 21st century vaccinology will increasingly see the abandonment of a “one size fits all” approach to vaccine dosing and delivery, as well as the abandonment of the empiric “isolate–inactivate–inject” paradigm for vaccine development. In this review, we discuss the immune response network theory and its application to the new field of vaccinomics and adversomics, and illustrate how vaccinomics can lead to new vaccine candidates, new understandings of how vaccines stimulate immune responses, new biomarkers for vaccine response, and facilitate the understanding of what genetic and other factors might be responsible for rare side effects due to vaccines. Perhaps most exciting will be the ability, at a systems biology level, to integrate increasingly complex high throughput data into descriptive and predictive equations for immune responses to vaccines. Herein, we discuss the above with a view toward the future of vaccinology.
doi:10.1016/j.smim.2013.04.007
PMCID: PMC3752773  PMID: 23755893
Adaptive immunity; Biotechnology; Computational biology; Genomics; Immunogenetics; Individualized medicine; Proteomics; Systems biology; Vaccination; Vaccines; Modeling; Vaccinomics; Adversomics; Predictive equation; Immune response network theory; Individualized vaccinology
10.  Impact of delay in asthma diagnosis on health care service use 
Delays in diagnosing asthma in children are common and are known to delay asthma-specific treatment. Few studies have investigated whether a delay in asthma diagnosis impacts the use of health care services. This study was designed to assess whether a delay in diagnosis of asthma influences the use of health care services. This was a retrospective cohort study with subjects elicited from a convenience sample of 839 healthy children. The criteria for asthma was met in 276 (33%) subjects; of these subjects 179 (65%) had a delay in the diagnosis of asthma and 97 (35%) had a timely diagnosis. Data on health care services (e.g., flu shot, availability of a peak flow meter, hospitalizations, and urgent care or emergency department visits) and the frequency of systemic steroid treatments were collected from medical records during the first 18 years of life. The frequencies of health service and use of systemic steroids were compared using Poisson and logistic regression models in asthmatic children with and without a delay in asthma diagnosis. Children with a delay in asthma diagnosis were more likely to visit urgent care centers at least once (40.8% versus 21.6%; p < 0.001), compared with those with a timely diagnosis. There were no significant differences in other health care service or systemic steroid use. A delay in the diagnosis of asthma was associated with an increase in urgent care visits suggesting suboptimal care. Clinicians should be aware that a delay in the diagnosis of asthma in children may result in the use of suboptimal health care services.
doi:10.2500/aap.2010.31.3358
PMCID: PMC3920287  PMID: 20819315
Accessibility; adolescent; asthma; child; control; delivery of health care; diagnosis; health services; treatment; urgent care
11.  Measles, Mumps, and Rubella 
Measles, mumps, and rubella are viral diseases that may adversely affect non-immune pregnant women and their fetuses/neonates. Prevention of these diseases and their complications can be achieved through measles-mumps-rubella (MMR) vaccination prior to pregnancy. The vaccine is contraindicated during pregnancy because it contains live, attenuated viruses that pose a theoretical risk to the fetus. However, accidental receipt of MMR vaccination is not known to cause maternal/fetal complications. MMR immunization is recommended to non-immune obstetric patients upon completion or termination of pregnancy.
doi:10.1097/GRF.0b013e31824df256
PMCID: PMC3334858  PMID: 22510638
Measles-Mumps-Rubella Vaccine; Measles; Mumps; Rubella; Congenital Rubella Syndrome; Obstetrics
12.  Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine 
Vaccine  2011;29(48):8988-8997.
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans.
Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20.
In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans.
doi:10.1016/j.vaccine.2011.09.043
PMCID: PMC3941984  PMID: 21939710
Single Nucleotide Polymorphisms; Haplotypes; Antiviral genes; Measles vaccine; Immunity
13.  The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity 
Human genetics  2011;130(4):547-561.
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.
doi:10.1007/s00439-011-0977-x
PMCID: PMC3924423  PMID: 21424379
TLRs; Immunogenetics; Measles vaccine; Antibodies; Cytokines; Immune response
14.  Differential Cellular Immune Responses to Wild-Type and Attenuated Edmonston Tag Measles Virus Strains Are Primarily Defined by the Viral Phosphoprotein Gene 
Journal of medical virology  2010;82(11):1966-1975.
The measles virus phosphoprotein (P) gene encodes the P, V, and C proteins, which have multiple functions including type I interferon (IFN) inhibition. With a focus on viral immune modulation, we conducted a study on healthy vaccinees (n = 179) to compare cytokine secretion patterns/cell frequencies and gene expression after in vitro encounter with a highly attenuated strain of measles virus (MVEdmtag), wild-type MV (MVwt) or recombinant MVEdmtag expressing the wild-type P gene (MVwtP). Cytokines were quantified by ELISA and Elispot. Gene expression profiling was performed using real-time PCR. We found differential MV-specific cytokine responses to all detected cytokines characterized by significantly higher cytokine levels (P <0.001) and higher frequencies (P <0.0001) of cytokine-producing cells after stimulation with the highly attenuated MVEdm-tag strain in comparison with MVwt or MVwtP. Furthermore, gene expression profiling revealed significant cytokine suppression at the transcriptional level for viruses encoding the functional wt P gene, compared to attenuated MVEdmtag (P <0.05). Using lentivirus-mediated stable expression of P gene-encoded proteins in human cell lines, we demonstrated that the expression of the functional wt V protein significantly down-modulated the induction of IFNs type I, II, and III in lymphocytes and monocytes. Taken together our results indicate that Th1, Th2, and innate/inflammatory cytokine responses in vaccinees are suppressed both at the protein and transcriptional level by viruses expressing the functional wt P gene products. The functional P gene-encoded viral proteins (particularly V proteins) emerge as crucial immune evasion factors for modulating and shaping the measles virus-specific cytokine responses in humans.
doi:10.1002/jmv.21899
PMCID: PMC3924428  PMID: 20872725
measles virus; P gene; MMR vaccine; cellular immunity; cytokines; gene expression
16.  Characteristics of Children with Asthma Who Achieved Remission of Asthma 
Objective
To characterize two groups of asthmatics who had achieved remission and those who had not achieved remission of asthma.
Methods
The study was a retrospective cohort study based on 117 asthmatic children who participated in a previous study. We categorized the children into two groups: asthmatics with remission versus asthmatics without remission. We defined remission of asthma as lack of symptoms/signs of asthma or asthma-related medications or health care services for at least three consecutive years. Long-term remission was defined by no relapse of asthma after achieving remission. We characterized these groups.
Results
Of the 117 subjects, 70 (60%) were male, 91 (78%) were Caucasians, and the mean age at index date of asthma was 8.1 years. A total of 59 asthmatic children (50%) achieved remission and 28 asthmatics (24%) achieved long-term remission. Asthmatics with remission were more likely to be Caucasian (87%) compared to those without (69%) (p = .039) There were no differences in the frequency of visits for viral (0.3 vs. 0.4 per person-years, p = .29) or bacterial infections (0.7 vs. 0.5 per person-years, p = .49) between asthmatics with and without remission. Gender, socioeconomic status, smoking exposure, family history of asthma or atopy, breastfeeding history, peak flow meter availability, asthma action plan, and influenza vaccinations were not associated with remission.
Conclusions
Only half of asthmatic children accomplished remission of asthma ever and 24% of asthmatic children had long-term remission. Ethnicity may affect remission of asthma but microbial infections may not influence the likelihood of remission of asthma and vice versa.
doi:10.3109/02770903.2013.787625
PMCID: PMC3761883  PMID: 23514196
asthma; childhood; epidemiology; microbial infection; remission; risk
17.  Human Leukocyte Antigens and Cellular Immune Responses to Anthrax Vaccine Adsorbed 
Infection and Immunity  2013;81(7):2584-2591.
Interindividual variations in vaccine-induced immune responses are in part due to host genetic polymorphisms in the human leukocyte antigen (HLA) and other gene families. This study examined associations between HLA genotypes, haplotypes, and homozygosity and protective antigen (PA)-specific cellular immune responses in healthy subjects following immunization with Anthrax Vaccine Adsorbed (AVA). While limited associations were observed between individual HLA alleles or haplotypes and variable lymphocyte proliferative (LP) responses to AVA, analyses of homozygosity supported the hypothesis of a “heterozygote advantage.” Individuals who were homozygous for any HLA locus demonstrated significantly lower PA-specific LP than subjects who were heterozygous at all eight loci (median stimulation indices [SI], 1.84 versus 2.95, P = 0.009). Similarly, we found that class I (HLA-A) and class II (HLA-DQA1 and HLA-DQB1) homozygosity was significantly associated with an overall decrease in LP compared with heterozygosity at those three loci. Specifically, individuals who were homozygous at these loci had significantly lower PA-specific LP than subjects heterozygous for HLA-A (median SI, 1.48 versus 2.13, P = 0.005), HLA-DQA1 (median SI, 1.75 versus 2.11, P = 0.007), and HLA-DQB1 (median SI, 1.48 versus 2.13, P = 0.002) loci, respectively. Finally, homozygosity at an increasing number (≥4) of HLA loci was significantly correlated with a reduction in LP response (P < 0.001) in a dose-dependent manner. Additional studies are needed to reproduce these findings and determine whether HLA-heterozygous individuals generate stronger cellular immune response to other virulence factors (Bacillus anthracis LF and EF) than HLA-homozygous subjects.
doi:10.1128/IAI.00269-13
PMCID: PMC3697592  PMID: 23649091
18.  Sedation levels during propofol administration for outpatient colonoscopies 
The levels of sedation required for patients to comfortably undergo colonoscopy with propofol were examined. One hundred patients undergoing colonoscopy with propofol were enrolled. In addition to standard-of-care monitoring, sedation level was monitored with the Patient State Index (PSI) obtained from a brain function monitor, transcutaneous carbon dioxide (tcpCO2) was monitored with the TCM TOSCA monitor, and end-tidal carbon dioxide was monitored via nasal cannula. The Ramsay Sedation Score (RSS) was also assessed and recorded. After baseline data were obtained from the first 40 consecutive patients enrolled in the study, the remaining 60 patients were randomized into two groups. In one group the PSI value was blinded from the anesthesiologist and in the second group the PSI was visible and the impact of this information on the management of the sedation was analyzed. Overall 96% of patients reached levels of deep sedation and 89% reached levels of general anesthesia. When comparing the blinded to PSI versus unblinded groups, the blinded group had a significantly lower PSI and higher RSS and tcpCO2, indicating the blinded group was maintained at a deeper sedation level with more respiratory compromise than the unblinded group. Patients undergoing colonoscopy under propofol sedation delivered by a bolus technique are frequently taken to levels of general anesthesia and are at risk for respiratory depression, airway obstruction, and hemodynamic compromise.
PMCID: PMC3862122  PMID: 24381393
19.  Impact of Cytokine and Cytokine Receptor Gene Polymorphisms on Cellular Immunity after Smallpox Vaccination 
Gene  2012;510(1):59-65.
We explored associations between SNPs in cytokine/cytokine receptor genes and cellular immunity in subjects following primary smallpox vaccination. We also analyzed the genotype-phenotype associations discovered in the Caucasian subjects among a cohort of African-Americans. In Caucasians we found 277 associations (p<0.05) between gene SNPs and inter-individual variations in IFN-α, IL-12p40, IL-1β, IL-2, and TNF-α secretion levels. A collection of SNPs in the IL1RN, IL2RB, IL4R, IL6, IL10RB, IL12A, and IL12RB2 genes had consistent associations among both Caucasians and African-Americans. A regulatory SNP (rs452204) in the IL1RN gene was significantly associated with higher levels of IL-2 secretion in an allele dose-dependent manner in both race groups (p=0.05 for Caucasians and p=0.002 for African-Americans). IL12RB2 polymorphism rs3790567 was associated with a dose-related decrease in IL-1β secretion (p=0.009 for Caucasians and p=0.01 for African-Americans). Our results demonstrate that variations in smallpox vaccine-induced cytokine responses are modulated by genetic polymorphisms in cytokine and cytokine receptor genes.
doi:10.1016/j.gene.2012.08.021
PMCID: PMC3463724  PMID: 23009887
Immunogenetics; SNPs; Smallpox Vaccine; Cytokine; Cytokine Receptor; Cellular Immunity; Caucasians; African-Americans
20.  High-Dimensional Gene Expression Profiling Studies in High and Low Responders to Primary Smallpox Vaccination 
The Journal of Infectious Diseases  2012;206(10):1512-1520.
Background. The mechanisms underlying smallpox vaccine-induced variations in immune responses are not well understood, but are of considerable interest to a deeper understanding of poxvirus immunity and correlates of protection.
Methods. We assessed transcriptional messenger RNA expression changes in 197 recipients of primary smallpox vaccination representing the extremes of humoral and cellular immune responses.
Results. The 20 most significant differentially expressed genes include a tumor necrosis factor–receptor superfamily member, an interferon (IFN) gene, a chemokine gene, zinc finger protein genes, nuclear factors, and histones (P ≤ 1.06E−20, q ≤ 2.64E−17). A pathway analysis identified 4 enriched pathways with cytokine production by the T-helper 17 subset of CD4+ T cells being the most significant pathway (P = 3.42E−05). Two pathways (antiviral actions of IFNs, P = 8.95E−05; and IFN-α/β signaling pathway, P = 2.92E−04), integral to innate immunity, were enriched when comparing high with low antibody responders (false discovery rate, < 0.05). Genes related to immune function and transcription (TLR8, P = .0002; DAPP1, P = .0003; LAMP3, P = 9.96E−05; NR4A2, P ≤ .0002; EGR3, P = 4.52E−05), and other genes with a possible impact on immunity (LNPEP, P = 3.72E−05; CAPRIN1, P = .0001; XRN1, P = .0001), were found to be expressed differentially in high versus low antibody responders.
Conclusion. We identified novel and known immunity-related genes and pathways that may account for differences in immune response to smallpox vaccination.
doi:10.1093/infdis/jis546
PMCID: PMC3475634  PMID: 22949304
21.  The genetic basis for interindividual immune response variation to measles vaccine: new understanding and new vaccine approaches 
Expert review of vaccines  2013;12(1):57-70.
The live-attenuated measles vaccine is effective, but measles outbreaks still occur in vaccinated populations. This warrants elucidation of the determinants of measles vaccine-induced protective immunity. Interindividual variability in markers of measles vaccine-induced immunity, including neutralizing antibody levels, is regulated in part by host genetic factor variations. This review summarizes recent advances in our understanding of measles vaccine immunogenetics relative to the perspective of developing better measles vaccines. Important genetic regulators of measles vaccine-induced immunity, such as HLA class I and HLA class II genotypes, single nucleotide polymorphisms in cytokine/cytokine receptor genes (IL12B, IL12RB1, IL2, IL10) and the cell surface measles virus receptor CD46 gene, have been identified and independently replicated. New technologies present many opportunities for identification of novel genetic signatures and genetic architectures. These findings help explain a variety of immune response-related phenotypes and promote a new paradigm of ‘vaccinomics’ for novel vaccine development.
doi:10.1586/erv.12.134
PMCID: PMC3570049  PMID: 23256739
adaptive immunity; genetic association studies; human leukocyte antigens; immunogenetics; measles vaccine; single nucleotide polymorphisms
22.  The Role of HLA DR-DQ Haplotypes in Variable Antibody Responses to Anthrax Vaccine Adsorbed 
Genes and immunity  2011;12(6):457-465.
Host genetic variation, particularly within the human leukocyte antigen (HLA) loci, reportedly mediates heterogeneity in immune response to certain vaccines; however, no large study of genetic determinants of anthrax vaccine response has been described. We searched for associations between the IgG antibody to protective antigen (AbPA) response to Anthrax Vaccine Adsorbed (AVA) in humans and polymorphisms at HLA class I (HLA-A, -B, and -C) and class II (HLA-DRB1, -DQA1, -DQB1, -DPB1) loci. The study included 794 European-Americans and 200 African-Americans participating in a 43-month, double-blind, placebo-controlled, clinical trial of AVA (clinicaltrials.gov identifier NCT00119067). Among European-Americans, genes from tightly linked HLA-DRB1-DQA1-DQB1 haplotypes displayed significant overall associations with longitudinal variation in AbPA levels at 4, 8, 26, and 30 weeks from baseline in response to vaccination with 3 or 4 doses of AVA (global p=6.53×10−4). In particular, carriage of the DRB1-DQA1-DQB1 haplotypes *1501-*0102-*0602 (p=1.17×10−5), *0101-*0101-*0501 (p=0.009), and *0102-*0101-*0501 (p=0.006) was associated with significantlylower AbPA levels. In carriers of two copies of these haplotypes, lower AbPA levels persisted following subsequent vaccinations. No significant associations were observed amongst African-Americans or for any HLA class I allele/haplotype. Further studies will be required to replicate these findings and to explore the role of host genetic variation outside of the HLA region.
doi:10.1038/gene.2011.15
PMCID: PMC3165112  PMID: 21368772
Anthrax vaccines; Bacillus anthracis; Bacterial vaccines; Vaccination; HLA Antigens
23.  Genome-Wide Association Study of Antibody Response to Smallpox Vaccine 
Vaccine  2012;30(28):4182-4189.
We performed a genome-wide association study (GWAS) of antibody levels in a multi-ethnic group of 1,071 healthy smallpox vaccine recipients. In Caucasians, the most prominent association was found with promoter SNP rs10489759 in the LOC647132 pseudogene on chromosome 1 (p=7.77 × 10-8). In African-Americans, we identified eight genetic loci at p< 5 × 10-7. The SNP association with the lowest p-value (rs10508727, p=1.05 × 10-10) was in the Mohawk homeobox (MKX) gene on chromosome 10. Other candidate genes included LOC388460, GPR158, ZHX2, SPIRE1, GREM2, CSMD1, and RUNX1. In Hispanics, the top six associations between genetic variants and antibody levels had p-values less than 5 × 10-7, with p=1.78 × 10-10 for the strongest statistical association (promoter SNP rs12256830 in the PCDH15 gene). In addition, SNP rs4748153 in the immune response gene PRKCQ (protein kinase C, theta) was significantly associated with neutralizing antibody levels (p=2.51 × 10-8). Additional SNP associations in Hispanics (p ≤3.40 × 10-7) were mapped to the KIF6/LOC100131899, CYP2C9, and ANKLE2/GOLGA3 genes. This study has identified candidate SNPs that may be important in regulating humoral immunity to smallpox vaccination. Replication studies, as well as studies elucidating the functional consequences of contributing genes and polymorphisms, are underway.
doi:10.1016/j.vaccine.2012.04.055
PMCID: PMC3367131  PMID: 22542470
GWAS; Smallpox Vaccine; Vaccinia Virus; Humoral Immunity; Immunogenetics; SNPs
24.  Understanding the immune response to seasonal influenza vaccination in older adults: a systems biology approach 
Expert review of vaccines  2012;11(8):985-994.
Annual vaccination against seasonal influenza is recommended to decrease disease-related mortality and morbidity. However, one population that responds suboptimally to influenza vaccine is adults over the age of 65 years. The natural aging process is associated with a complex deterioration of multiple components of the host immune system. Research into this phenomenon, known as immunosenescence, has shown that aging alters both the innate and adaptive branches of the immune system. The intricate mechanisms involved in immune response to influenza vaccine, and how these responses are altered with age, have led us to adopt a more encompassing systems biology approach to understand exactly why the response to vaccination diminishes with age. Here, the authors review what changes occur with immunosenescence, and some immunogenetic factors that influence response, and outline the systems biology approach to understand the immune response to seasonal influenza vaccination in older adults.
doi:10.1586/erv.12.61
PMCID: PMC3514506  PMID: 23002979
bioinformatics; immunogenetics; immunosenescence; influenza; seasonal influenza vaccine; systems biology; vaccinomics; vaccine-induced immunity
25.  Impact of Delay in Asthma Diagnosis on Chest X-ray and Antibiotic Utilization by Clinicians 
Objective
To evaluate the effect of the timeliness of asthma diagnosis on chest X-ray (CXR) and antibiotic utilization in children.
Patients and methods
This was a retrospective cohort study of 276 asthmatic children aged 5–12 years from Rochester, Minnesota. From the time when children met our predetermined asthma criteria, the frequency of CXR and antibiotic utilizations for respiratory illnesses were collected from medical records until age 18 years. Using a Poisson regression model, the frequency of CXR and antibiotic utilizations were compared in children with timely, delayed, or no clinician diagnosis of asthma.
Results
Of the 276 asthmatic patients, 97 (35%) had a timely diagnosis, 122 (44%) had a delayed diagnosis, while 57 patients (21%) had no clinician diagnosis of asthma. There was no significant difference in CXR or antibiotic utilization for respiratory illness between these groups. In addition, this was true for the comparison between the timely diagnosed group and the delayed diagnosed group combining both the group with a delay in asthma diagnosis and the group who never had asthma diagnosis.
Conclusions
A delay in the diagnosis of asthma in children is common and overall it may not influence antibiotic and CXR utilization for respiratory symptoms by clinicians. However, its impact on access to asthma-related therapies and other healthcare utilizations could be possible and was not assessed in this study. Given the limitations of our study, a larger prospective study needs to be considered.
doi:10.3109/02770903.2011.637596
PMCID: PMC3433831  PMID: 22149172
adolescent; antibacterial agents; child; health services; radiography; therapeutics; thoracic

Results 1-25 (75)