Search tips
Search criteria

Results 1-25 (78)

Clipboard (0)

Select a Filter Below

Year of Publication
more »
1.  High-Temperature Protein G Is an Essential Virulence Factor of Leptospira interrogans 
Infection and Immunity  2014;82(3):1123-1131.
Leptospira interrogans is a global zoonotic pathogen and is the causative agent of leptospirosis, an endemic disease of humans and animals worldwide. There is limited understanding of leptospiral pathogenesis; therefore, further elucidation of the mechanisms involved would aid in vaccine development and the prevention of infection. HtpG (high-temperature protein G) is the bacterial homolog to the highly conserved molecular chaperone Hsp90 and is important in the stress responses of many bacteria. The specific role of HtpG, especially in bacterial pathogenesis, remains largely unknown. Through the use of an L. interrogans htpG transposon insertion mutant, this study demonstrates that L. interrogans HtpG is essential for virulence in the hamster model of acute leptospirosis. Complementation of the htpG mutant completely restored virulence. Surprisingly, the htpG mutant did not appear to show sensitivity to heat or oxidative stress, phenotypes common in htpG mutants in other bacterial species. Furthermore, the mutant did not show increased sensitivity to serum complement, reduced survival within macrophages, or altered protein or lipopolysaccharide expression. The underlying cause for attenuation thus remains unknown, but HtpG is a novel leptospiral virulence factor and one of only a very small number identified to date.
PMCID: PMC3958012  PMID: 24366253
2.  Role of Acinetobacter baumannii UmuD Homologs in Antibiotic Resistance Acquired through DNA Damage-Induced Mutagenesis 
The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from that of the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene, the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.
PMCID: PMC3957856  PMID: 24342640
3.  Biological Cost of Different Mechanisms of Colistin Resistance and Their Impact on Virulence in Acinetobacter baumannii 
Two mechanisms of resistance to colistin have been described in Acinetobacter baumannii. One involves complete loss of lipopolysaccharide (LPS), resulting from mutations in lpxA, lpxC, or lpxD, and the second is associated with phosphoethanolamine addition to LPS, mediated through mutations in pmrAB. In order to assess the clinical impacts of both resistance mechanisms, A. baumannii ATCC 19606 and its isogenic derivatives, AL1851 ΔlpxA, AL1852 ΔlpxD, AL1842 ΔlpxC, and ATCC 19606 pmrB, were analyzed for in vitro growth rate, in vitro and in vivo competitive growth, infection of A549 respiratory alveolar epithelial cells, virulence in the Caenorhabditis elegans model, and virulence in a systemic mouse infection model. The in vitro growth rate of the lpx mutants was clearly diminished; furthermore, in vitro and in vivo competitive-growth experiments revealed a reduction in fitness for both mutant types. Infection of A549 cells with ATCC 19606 or the pmrB mutant resulted in greater loss of viability than with lpx mutants. Finally, the lpx mutants were highly attenuated in both the C. elegans and mouse infection models, while the pmrB mutant was attenuated only in the C. elegans model. In summary, while colistin resistance in A. baumannii confers a clear selective advantage in the presence of colistin treatment, it causes a noticeable cost in terms of overall fitness and virulence, with a more striking reduction associated with LPS loss than with phosphoethanolamine addition. Therefore, we hypothesize that colistin resistance mediated by changes in pmrAB will be more likely to arise in clinical settings in patients treated with colistin.
PMCID: PMC3910726  PMID: 24189257
4.  Evolutionary Analysis of Burkholderia pseudomallei Identifies Putative Novel Virulence Genes, Including a Microbial Regulator of Host Cell Autophagy 
Journal of Bacteriology  2013;195(24):5487-5498.
Burkholderia pseudomallei, the causative agent of melioidosis, contains a large pathogen genome (7.2 Mb) with ∼2,000 genes of putative or unknown function. Interactions with potential hosts and environmental factors may induce rapid adaptations in these B. pseudomallei genes, which can be discerned through evolutionary analysis of multiple B. pseudomallei genomes. Here we show that several previously uncharacterized B. pseudomallei genes bearing genetic signatures of rapid adaptation (positive selection) can induce diverse cellular phenotypes when expressed in mammalian cells. Notably, several of these phenotypes are plausibly related to virulence, including multinuclear giant cell formation, apoptosis, and autophagy induction. Specifically, we show that BPSS0180, a type VI cluster-associated gene, is capable of inducing autophagy in both phagocytic and nonphagocytic mammalian cells. Following infection of macrophages, a B. pseudomallei mutant disrupted in BPSS0180 exhibited significantly decreased colocalization with LC3 and impaired intracellular survival; these phenotypes were rescued by introduction of an intact BPSS0180 gene. The results suggest that BPSS0180 may be a novel inducer of host cell autophagy that contributes to B. pseudomallei intracellular growth. More generally, our study highlights the utility of applying evolutionary principles to microbial genomes to identify novel virulence genes.
PMCID: PMC3889600  PMID: 24097950
5.  Structural and Functional Characterization of an Orphan ATP-Binding Cassette ATPase Involved in Manganese Utilization and Tolerance in Leptospira spp. 
Journal of Bacteriology  2013;195(24):5583-5591.
Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn2+, we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn2+, suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn2+ toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg2+-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.
PMCID: PMC3889601  PMID: 24123817
6.  Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii 
Journal of Bacteriology  2013;195(24):5577-5582.
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
PMCID: PMC3889614  PMID: 24123815
7.  Pasteurella multocida Heddleston Serovar 3 and 4 Strains Share a Common Lipopolysaccharide Biosynthesis Locus but Display both Inter- and Intrastrain Lipopolysaccharide Heterogeneity 
Journal of Bacteriology  2013;195(21):4854-4864.
Pasteurella multocida is a Gram-negative multispecies pathogen and the causative agent of fowl cholera, a serious disease of poultry which can present in both acute and chronic forms. The major outer membrane component lipopolysaccharide (LPS) is both an important virulence factor and a major immunogen. Our previous studies determined the LPS structures expressed by different P. multocida strains and revealed that a number of strains belonging to different serovars contain the same LPS biosynthesis locus but express different LPS structures due to mutations within glycosyltransferase genes. In this study, we report the full LPS structure of the serovar 4 type strain, P1662, and reveal that it shares the same LPS outer core biosynthesis locus, L3, with the serovar 3 strains P1059 and Pm70. Using directed mutagenesis, the role of each glycosyltransferase gene in LPS outer core assembly was determined. LPS structural analysis of 23 Australian field isolates that contain the L3 locus revealed that at least six different LPS outer core structures can be produced as a result of mutations within the LPS glycosyltransferase genes. Moreover, some field isolates produce multiple but related LPS glycoforms simultaneously, and three LPS outer core structures are remarkably similar to the globo series of vertebrate glycosphingolipids. Our in-depth analysis showing the genetics and full range of P. multocida lipopolysaccharide structures will facilitate the improvement of typing systems and the prediction of the protective efficacy of vaccines.
PMCID: PMC3807493  PMID: 23974032
8.  Leptospiral LruA Is Required for Virulence and Modulates an Interaction with Mammalian Apolipoprotein AI 
Infection and Immunity  2013;81(10):3872-3879.
Leptospirosis is a worldwide zoonosis caused by spirochetes of the genus Leptospira. While understanding of pathogenesis remains limited, the development of mutagenesis in Leptospira has provided a powerful tool for identifying novel virulence factors. LruA is a lipoprotein that has been implicated in leptospiral uveitis as a target of the immune response. In this study, two lruA mutants, M754 and M765, generated by transposon mutagenesis from Leptospira interrogans serovar Manilae, were characterized. In M754, the transposon inserted in the middle of lruA, resulting in no detectable expression of LruA. In M765, the transposon inserted toward the 3′ end of the gene, resulting in expression of a truncated protein. LruA was demonstrated to be on the cell surface in M765 and the wild type (WT). M754, but not M765, was attenuated in a hamster model of acute infection. A search for differential binding to human serum proteins identified a serum protein of around 30 kDa bound to the wild type and the LruA deletion mutant (M754), but not to the LruA truncation mutant (M765). Two-dimensional separation of proteins from leptospiral cells incubated with guinea pig serum identified the 28-kDa apolipoprotein A-I (ApoA-I) as a major mammalian serum protein that binds Leptospira in vitro. Interestingly, M754 (with no detectable LruA) bound more ApoA-I than did the LruA-expressing strains Manilae wild type and M765. Our data thus identify LruA as a surface-exposed leptospiral virulence factor that contributes to leptospiral pathogenesis, possibly by modulating cellular interactions with serum protein ApoA-I.
PMCID: PMC3811782  PMID: 23918777
9.  Precipitation of Iron on the Surface of Leptospira interrogans Is Associated with Mutation of the Stress Response Metalloprotease HtpX 
Applied and Environmental Microbiology  2013;79(15):4653-4660.
High concentrations of free metal ions in the environment can be detrimental to bacterial survival. However, bacteria utilize strategies, including the activation of stress response pathways and immobilizing chemical elements on their surface, to limit this toxicity. In this study, we characterized LA4131, the HtpX-like M48 metalloprotease from Leptospira interrogans, with a putative role in bacterial stress response and membrane homeostasis. Growth of the la4131 transposon mutant strain (L522) in 360 μM FeSO4 (10-fold the normal in vitro concentration) resulted in the production of an amorphous iron precipitate. Atomic force microscopy and transmission electron microscopy analysis of the strain demonstrated that precipitate production was associated with the generation and release of outer membrane vesicles (OMVs) from the leptospiral surface. Transcriptional studies indicated that inactivation of la4131 resulted in altered expression of a subset of metal toxicity and stress response genes. Combining these findings, this report describes OMV production in response to environmental stressors and associates OMV production with the in vitro activity of an HtpX-like metalloprotease.
PMCID: PMC3719529  PMID: 23709510
10.  Leptospiral Outer Membrane Protein LipL41 Is Not Essential for Acute Leptospirosis but Requires a Small Chaperone Protein, Lep, for Stable Expression 
Infection and Immunity  2013;81(8):2768-2776.
Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.
PMCID: PMC3719587  PMID: 23690405
11.  The Fimbrial Protein FlfA from Gallibacterium anatis Is a Virulence Factor and Vaccine Candidate 
Infection and Immunity  2013;81(6):1964-1973.
The Gram-negative bacterium Gallibacterium anatis is a major cause of salpingitis and peritonitis in egg-laying chickens, leading to decreased egg production worldwide. Widespread multidrug resistance largely prevents treatment of this organism using traditional antimicrobial agents, while antigenic diversity hampers disease prevention by classical vaccines. Thus, insight into its pathogenesis and knowledge about important virulence factors is urgently required. A key event during the colonization and invasion of mucosal surfaces is adherence, and recently, at least three F17-like fimbrial gene clusters were identified in the genomes of several G. anatis strains. The objective of this study was to characterize the putative F17-like fimbrial subunit protein FlfA from G. anatis 12656-12 and determine its importance for virulence. In vitro expression and surface exposure of FlfA was demonstrated by flow cytometry and immunofluorescence microscopy. The predicted function of FlfA as a fimbrial subunit protein was confirmed by immunogold electron microscopy. An flfA deletion mutant (ΔflfA) was generated in G. anatis 12656-12, and importantly, this mutant was significantly attenuated in the natural chicken host. Furthermore, protection against G. anatis 12656-12 could be induced by immunizing chickens with recombinant FlfA. Finally, in vitro expression of FlfA homologs was observed in a genetically diverse set of G. anatis strains, suggesting the potential of FlfA as a serotype-independent vaccine candidate This is the first study describing a fimbrial subunit protein of G. anatis with a clear potential as a vaccine antigen.
PMCID: PMC3676021  PMID: 23509151
12.  Cell surface hydrophobicity of colistin-susceptible versus -resistant Acinetobacter baumannii determined by contact angles: methodological considerations and implications 
Journal of applied microbiology  2012;113(4):940-951.
Contact angle analysis of cell surface hydrophobicity (CSH) describes the tendency of a water droplet to spread across a lawn of filtered bacterial cells. Colistin-induced disruption of the Gram-negative outer membrane necessitates hydrophobic contacts with lipopolysaccharide (LPS). We aimed to characterize the CSH of Acinetobacter baumannii using contact angles, to provide insight into the mechanism of colistin resistance.
Contact angles were analysed for five paired colistin-susceptible and -resistant A. baumannii strains. Drainage of the water droplet through bacterial layers was demonstrated to influence results. Consequently, measurements were performed 0.66-sec after droplet deposition. Colistin-resistant cells exhibited lower contact angles (38.8±2.8° to 46.8±1.3°) compared to their paired-susceptible strains (40.7±3.0° to 48.0±1.4°; ANOVA; p<0.05). Contact angles increased at stationary phase (50.3±2.9° to 61.5±2.5° and 47.4±2.0° to 50.8±3.2°, susceptible and resistant, respectively, ANOVA; p<0.05), and in response to colistin 32-mgL−1 exposure (44.5±1.5° to 50.6±2.8° and 43.5±2.2° to 48.0±2.2°, susceptible and resistant, respectively; ANOVA; p<0.05). Analysis of complemented strains constructed with an intact lpxA gene, or empty vector, highlighted the contribution of LPS to CSH.
Compositional outer-membrane variations likely account for CSH differences between A. baumannii phenotypes, which influence the hydrophobic colistin-bacterium interaction.
Important insight into the mechanism of colistin resistance has been provided. Greater consideration of contact angle mehodology is nescessary to ensure accurate analyses are performed.
PMCID: PMC3434258  PMID: 22574702
Antimicrobials; Lipopolysaccharide; Mechanism of Action
13.  Lipopolysaccharide-Deficient Acinetobacter baumannii Shows Altered Signaling through Host Toll-Like Receptors and Increased Susceptibility to the Host Antimicrobial Peptide LL-37 
Infection and Immunity  2013;81(3):684-689.
Infections caused by multidrug-resistant Acinetobacter baumannii have emerged as a serious global health problem. We have shown previously that A. baumannii can become resistant to the last-line antibiotic colistin via the loss of lipopolysaccharide (LPS), including the lipid A anchor, from the outer membrane (J. H. Moffatt, M. Harper, P. Harrison, J. D. Hale, E. Vinogradov, T. Seemann, R. Henry, B. Crane, F. St. Michael, A. D. Cox, B. Adler, R. L. Nation, J. Li, and J. D. Boyce, Antimicrob. Agents Chemother. 54:4971–4977, 2010). Here, we show how these LPS-deficient bacteria interact with components of the host innate immune system. LPS-deficient A. baumannii stimulated 2- to 4-fold lower levels of NF-κB activation and tumor necrosis factor alpha (TNF-α) secretion from immortalized murine macrophages, but it still elicited low levels of TNF-α secretion via a Toll-like receptor 2-dependent mechanism. Furthermore, we show that while LPS-deficient A. baumannii was not altered in its resistance to human serum, it showed increased susceptibility to the human antimicrobial peptide LL-37. Thus, LPS-deficient, colistin-resistant A. baumannii shows significantly altered activation of the host innate immune inflammatory response.
PMCID: PMC3584870  PMID: 23250952
14.  Mechanical signals as anabolic agents in bone 
Nature reviews. Rheumatology  2010;6(1):50-59.
Aging and a sedentary lifestyle conspire to reduce bone quantity and quality, decrease muscle mass and strength, and undermine postural stability, culminating in an elevated risk of skeletal fracture. Concurrently, a marked reduction in the available bone-marrow-derived population of mesenchymal stem cells (MSCs) jeopardizes the regenerative potential that is critical to recovery from musculoskeletal injury and disease. A potential way to combat the deterioration involves harnessing the sensitivity of bone to mechanical signals, which is crucial in defining, maintaining and recovering bone mass. To effectively utilize mechanical signals in the clinic as a non-drug-based intervention for osteoporosis, it is essential to identify the components of the mechanical challenge that are critical to the anabolic process. Large, intense challenges to the skeleton are generally presumed to be the most osteogenic, but brief exposure to mechanical signals of high frequency and extremely low intensity, several orders of magnitude below those that arise during strenuous activity, have been shown to provide a significant anabolic stimulus to bone. Along with positively influencing osteoblast and osteocyte activity, these low-magnitude mechanical signals bias MSC differentiation towards osteoblastogenesis and away from adipogenesis. Mechanical targeting of the bone marrow stem-cell pool might, therefore, represent a novel, drug-free means of slowing the age-related decline of the musculoskeletal system.
PMCID: PMC3743048  PMID: 20046206
15.  Beclin 1 Is Required for Starvation-Enhanced, but Not Rapamycin-Enhanced, LC3-Associated Phagocytosis of Burkholderia pseudomallei in RAW 264.7 Cells 
Infection and Immunity  2013;81(1):271-277.
LC3-associated phagocytosis (LAP) of Burkholderia pseudomallei by murine macrophage (RAW 264.7) cells is an intracellular innate defense mechanism. Beclin 1, a protein with several roles in autophagic processes, is known to be recruited to phagosomal membranes as a very early event in LAP. We sought to determine whether knockdown of Beclin 1 by small interfering RNA (siRNA) would affect recruitment of LC3 and subsequent LAP of infecting B. pseudomallei. Both starvation and rapamycin treatment can induce Beclin 1-dependent autophagy. Therefore, we analyzed the consequences of Beclin 1 knockdown for LAP in infected cells that had been either starved or treated with rapamycin by determining the levels of bacterial colocalization with LC3 and intracellular survival. Concurrently, we confirmed the location of bacteria as either contained in phagosomes or free in the cytoplasm. We found that both rapamycin and starvation treatment enhanced LAP of B. pseudomallei but that the rapamycin response is Beclin 1 independent whereas the starvation response is Beclin 1 dependent.
PMCID: PMC3536138  PMID: 23115045
16.  Leptospira interrogans Catalase Is Required for Resistance to H2O2 and for Virulence 
Infection and Immunity  2012;80(11):3892-3899.
Pathogenic Leptospira spp. are likely to encounter higher concentrations of reactive oxygen species induced by the host innate immune response. In this study, we characterized Leptospira interrogans catalase (KatE), the only annotated catalase found within pathogenic Leptospira species, by assessing its role in resistance to H2O2-induced oxidative stress and during infection in hamsters. Pathogenic L. interrogans bacteria had a 50-fold-higher survival rate under H2O2-induced oxidative stress than did saprophytic L. biflexa bacteria, and this was predominantly catalase dependent. We also characterized KatE, the only annotated catalase found within pathogenic Leptospira species. Catalase assays performed with recombinant KatE confirmed specific catalase activity, while protein fractionation experiments localized KatE to the bacterial periplasmic space. The insertional inactivation of katE in pathogenic Leptospira bacteria drastically diminished leptospiral viability in the presence of extracellular H2O2 and reduced virulence in an acute-infection model. Combined, these results suggest that L. interrogans KatE confers in vivo resistance to reactive oxygen species induced by the host innate immune response.
PMCID: PMC3486042  PMID: 22927050
17.  Application of protein purification methods for the enrichment of a cytotoxin from Campylobacter jejuni 
BMC Microbiology  2012;12:303.
Campylobater jejuni, a major foodborne diarrhoeal pathogen is reported to produce a number of cytotoxins of which only a cytolethal distending toxin (CDT) has been characterised so far. One or more additional cytotoxins other than CDT, including a Chinese hamster ovary (CHO) cell active, Vero cell inactive cytotoxin, may mediate inflammatory diarrhoea. Our objective was to develop a method to enrich and thus partially characterise this cytotoxin, as a pathway to the eventual identification and characterisation of the toxin.
A number of biochemical methods including cation- and anion-exchange chromatography were evaluated to enrich the cytotoxin from a cell lysate of a known cytotoxin-producing C. jejuni, C31. The cytotoxin in crude lysate was initially prepared by size-exclusion desalting and then subjected to high pressure liquid chromatography (HPLC) ion-exchange fractionation. One pooled fraction (pool B) was cytotoxic for CHO cells equivalent to crude toxin (tissue culture infectivity dose 50 [TCID50] of 1–2 μg/ml). The proteins of pool B were identified by mass spectrometry (MS) after separation by SDS-PAGE and trypsin digestion. Also, pool B was directly digested with trypsin and then subjected to liquid chromatography tandem mass spectrometry (LCMS) analysis for identification of lesser abundant proteins in the fraction. A total of 41 proteins were found in the fraction, which included enzymes involved in metabolic and transport functions. Eighteen non-cytoplasmic proteins including 2 major antigenic peptide proteins (PEB2 and PEB3) and 3 proteins of unknown function were also identified in the screen. Cytotoxicity in pool B was trypsin-sensitive indicating its protein nature. The cytotoxic activity was heat-stable to 50°C, and partially inactivated at 60-70°C. The pool B fraction also induced fluid accumulation in the adult rabbit ileal loop assay with cytotoxicity for mucosa confirming the presence of the cytotoxin.
We report the enrichment and partial purification of C. jejuni cytotoxin by HPLC ion-exchange chromatography. Further purification may be achieved using additional complementary chromatographic techniques. A short-list of six candidate cytotoxin proteins was identified using an LCMS screen of pool B. Successful isolation of the cytotoxin will initiate steps for the determination of the role of this cytotoxin in the pathogenesis of C. jejuni diarrhoea.
PMCID: PMC3541203  PMID: 23259594
C. jejuni; Cytotoxin; Biochemical methods; HPLC ion-exchange chromatography
18.  FlaA Proteins in Leptospira interrogans Are Essential for Motility and Virulence but Are Not Required for Formation of the Flagellum Sheath 
Infection and Immunity  2012;80(6):2019-2025.
Spirochetes have periplasmic flagella composed of a core surrounded by a sheath. The pathogen Leptospira interrogans has four flaB (proposed core subunit) and two flaA (proposed sheath subunit) genes. The flaA genes are organized in a locus with flaA2 immediately upstream of flaA1. In this study, flaA1 and flaA2 mutants were constructed by transposon mutagenesis. Both mutants still produced periplasmic flagella. The flaA1 mutant did not produce FlaA1 but continued to produce FlaA2 and retained normal morphology and virulence in a hamster model of infection but had reduced motility. The flaA2 mutant did not produce either the FlaA1 or the FlaA2 protein. Cells of the flaA2 mutant lacked the distinctive hook-shaped ends associated with L. interrogans and lacked translational motility in liquid and semisolid media. These observations were confirmed with a second, independent flaA2 mutant. The flaA2 mutant failed to cause disease in animal models of acute infection. Despite lacking FlaA proteins, the flagella of the flaA2 mutant were of the same thickness as wild-type flagella, as measured by electron microscopy, and exhibited a normal flagellum sheath, indicating that FlaA proteins are not essential for the synthesis of the flagellum sheath, as observed for other spirochetes. This study shows that FlaA subunits contribute to leptospiral translational motility, cellular shape, and virulence.
PMCID: PMC3370569  PMID: 22451522
19.  Effect of colistin exposure and growth phase on the surface properties of live Acinetobacter baumannii cells examined by atomic force microscopy 
The diminishing antimicrobial development pipeline has forced the revival of colistin as a last line of defence against infections caused by multidrug-resistant Gram-negative ‘superbugs’ such as Acinetobacter baumannii. The complete loss of lipopolysaccharide (LPS) mediates colistin resistance in some A. baumannii strains. Atomic force microscopy was used to examine the surface properties of colistin-susceptible and -resistant A. baumannii strains at mid-logarithmic and stationary growth phases in liquid and in response to colistin treatment. The contribution of LPS to surface properties was investigated using A. baumannii strains constructed with and without the lpxA gene. Bacterial spring constant measurements revealed that colistin-susceptible cells were significantly stiffer than colistin-resistant cells at both growth phases (P < 0.01), whilst colistin treatment at high concentrations (32 mg/L) resulted in more rigid surfaces for both phenotypes. Multiple, large adhesive peaks frequently noted in force curves captured on colistin-susceptible cells were not evident for colistin-resistant cells. Adhesion events were markedly reduced following colistin exposure. The cell membranes of strains of both phenotypes remained intact following colistin treatment, although fine topographical details were illustrated. These studies, conducted for the first time on live A. baumannii cells in liquid, have contributed to our understanding of the action of colistin in this problematic pathogen.
PMCID: PMC3433558  PMID: 21925844
Atomic force microscopy; Colistin; Acinetobacter baumannii; Morphology; Surface properties
20.  Screening of 71 P. multocida Proteins for Protective Efficacy in a Fowl Cholera Infection Model and Characterization of the Protective Antigen PlpE 
PLoS ONE  2012;7(7):e39973.
There is a strong need for a recombinant subunit vaccine against fowl cholera. We used a reverse vaccinology approach to identify putative secreted or cell surface associated P. multocida proteins that may represent potential vaccine candidate antigens.
Principal Findings
A high-throughput cloning and expression protocol was used to express and purify 71 recombinant proteins for vaccine trials. Of the 71 proteins tested, only one, PlpE in denatured insoluble form, protected chickens against fowl cholera challenge. PlpE also elicited comparable levels of protection in mice. PlpE was localized by immunofluorescence to the bacterial cell surface, consistent with its ability to elicit a protective immune response. To explore the role of PlpE during infection and immunity, a plpE mutant was generated. The plpE mutant strain retained full virulence for mice.
These studies show that PlpE is a surface exposed protein and was the only protein of 71 tested that was able to elicit a protective immune response. However, PlpE is not an essential virulence factor. This is the first report of a denatured recombinant protein stimulating protection against fowl cholera.
PMCID: PMC3390355  PMID: 22792202
21.  Colistin-Resistant, Lipopolysaccharide-Deficient Acinetobacter baumannii Responds to Lipopolysaccharide Loss through Increased Expression of Genes Involved in the Synthesis and Transport of Lipoproteins, Phospholipids, and Poly-β-1,6-N-Acetylglucosamine 
We recently demonstrated that colistin resistance in Acinetobacter baumannii can result from mutational inactivation of genes essential for lipid A biosynthesis (Moffatt JH, et al., Antimicrob. Agents Chemother. 54:4971–4977). Consequently, strains harboring these mutations are unable to produce the major Gram-negative bacterial surface component, lipopolysaccharide (LPS). To understand how A. baumannii compensates for the lack of LPS, we compared the transcriptional profile of the A. baumannii type strain ATCC 19606 to that of an isogenic, LPS-deficient, lpxA mutant strain. The analysis of the expression profiles indicated that the LPS-deficient strain showed increased expression of many genes involved in cell envelope and membrane biogenesis. In particular, upregulated genes included those involved in the Lol lipoprotein transport system and the Mla-retrograde phospholipid transport system. In addition, genes involved in the synthesis and transport of poly-β-1,6-N-acetylglucosamine (PNAG) also were upregulated, and a corresponding increase in PNAG production was observed. The LPS-deficient strain also exhibited the reduced expression of genes predicted to encode the fimbrial subunit FimA and a type VI secretion system (T6SS). The reduced expression of genes involved in T6SS correlated with the detection of the T6SS-effector protein AssC in culture supernatants of the A. baumannii wild-type strain but not in the LPS-deficient strain. Taken together, these data show that, in response to total LPS loss, A. baumannii alters the expression of critical transport and biosynthesis systems associated with modulating the composition and structure of the bacterial surface.
PMCID: PMC3256090  PMID: 22024825
22.  Cross-protective Immunity Against Leptospirosis Elicited by a Live, Attenuated Lipopolysaccharide Mutant 
The Journal of Infectious Diseases  2011;203(6):870-879.
Background. Leptospira species cause leptospirosis, a zoonotic disease found worldwide. Current vaccines against leptospirosis provide protection only against closely related serovars.
Methods. We evaluated an attenuated transposon mutant of Leptospira interrogans serovar Manilae (M1352, defective in lipopolysaccharide biosynthesis) as a live vaccine against leptospirosis. Hamsters received a single dose of vaccine and were challenged with the homologous serovar (Manilae) and a serologically unrelated heterologous serovar (Pomona). Comparisons were made with killed vaccines. Potential cross-protective antigens against leptospirosis were investigated.
Results. Live M1352 vaccine induced superior protection in hamsters against homologous challenge. The live vaccine also stimulated cross-protection against heterologous challenge, with 100% survival (live M1352) versus 40% survival (killed vaccine). Hamsters receiving either vaccine responded to the dominant membrane proteins LipL32 and LipL41. Hamsters receiving the live vaccine additionally recognized LA3961/OmpL36 (unknown function), Loa22 (OmpA family protein, recognized virulence factor), LA2372 (general secretory protein G), and LA1939 (hypothetical protein). Manilae LigA was recognized by M1352 vaccinates, whereas LipL36 was detected in Pomona.
Conclusion. This study demonstrated that a live, attenuated vaccine can stimulate cross-protective immunity to L. interrogans and has identified antigens that potentially confer cross-protection against leptospirosis.
PMCID: PMC3071135  PMID: 21220775
23.  Role for the Burkholderia pseudomallei Type Three Secretion System Cluster 1 bpscN Gene in Virulence ▿  
Infection and Immunity  2011;79(9):3659-3664.
Burkholderia pseudomallei, the causal agent of melioidosis, employs a number of virulence factors during its infection of mammalian cells. One such factor is the type three secretion system (TTSS), which is proposed to mediate the transport and secretion of bacterial effector molecules directly into host cells. The B. pseudomallei genome contains three TTSS gene clusters (designated TTSS1, TTSS2, and TTSS3). Previous research has indicated that neither TTSS1 nor TTSS2 is involved in B. pseudomallei virulence in a hamster infection model. We have characterized a B. pseudomallei mutant lacking expression of the predicted TTSS1 ATPase encoded by bpscN. This mutant was significantly attenuated for virulence in a respiratory melioidosis mouse model of infection. In addition, analyses in vitro showed diminished survival and replication in RAW264.7 cells and an increased level of colocalization with the autophagy marker protein LC3 but an unhindered ability to escape from phagosomes. Taken together, these data provide evidence that the TTSS1 bpscN gene product plays an important role in the intracellular survival of B. pseudomallei and the pathogenesis of murine infection.
PMCID: PMC3165474  PMID: 21768285
24.  Different surface charge of colistin-susceptible and -resistant Acinetobacter baumannii cells measured with zeta potential as a function of growth phase and colistin treatment 
Electrostatic forces mediate the initial interaction between cationic colistin and Gram-negative bacterial cells. Lipopolysaccharide (LPS) loss mediates colistin resistance in some A. baumannii strains. Our aim was to determine the surface charge of colistin-susceptible and –resistant A. baumannii as a function of growth phase and in response to polymyxin treatment.
The zeta potential of A. baumannii ATCC 19606 and 10 clinical multidrug-resistant strains (MICs 0.5–2 mg/L) was assessed. Colistin-resistant derivatives (MIC >128 mg/L) of wild-type strains were selected in the presence of 10 mg/L colistin, including the LPS-deficient lpxA mutant, ATCC 19606R. To determine the contribution of LPS to surface charge, two complemented ATCC 19606R derivatives were examined, namely ATCC 19606R + lpxA (containing an intact lpxA gene) and ATCC 19606R + V (containing empty vector). Investigations were conducted as a function of growth phase and polymyxin treatment (1, 4 and 8 mg/L).
Wild-type cells exhibited a greater negative charge (−60.5 ± 2.36 to −26.2 ± 2.56 mV) thancolistin-resistant cells (−49.2 ± 3.09 to −19.1 ± 2.80 mV) at mid-log phase (ANOVA, P < 0.05). Opposing growth-phase trends were observed for both phenotypes: wild-type cells displayed reduced negative charge and colistin-resistant cells displayed increased negative charge at stationary compared with mid-logarithmic phase. Polymyxin exposure resulted in a concentration-dependent increase in zeta potential. Examination of ATCC 19606R and complemented strains supported the importance of LPS in determining surface charge, suggesting a potential mechanism of colistin resistance.
Zeta potential differences between A. baumannii phenotypes probably reflect compositional outer-membrane variations that impact the electrostatic component of colistin activity.
PMCID: PMC3001852  PMID: 21081544
physicochemical properties; Gram-negative; polymyxin
25.  Insertion Sequence ISAba11 Is Involved in Colistin Resistance and Loss of Lipopolysaccharide in Acinetobacter baumannii▿ 
Infections caused by Acinetobacter baumannii are of increasing concern, largely due to the multidrug resistance of many strains. Here we show that insertion sequence ISAba11 movement can result in inactivation of the A. baumannii lipid A biosynthesis genes lpxA and lpxC, resulting in the complete loss of lipopolysaccharide production and high-level colistin resistance.
PMCID: PMC3101452  PMID: 21402838

Results 1-25 (78)