PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (27)
 

Clipboard (0)
None

Select a Filter Below

Journals
Year of Publication
more »
author:("Lin, shengjie")
1.  Light-Promoted Rhodopsin Expression and Starvation Survival in the Marine Dinoflagellate Oxyrrhis marina 
PLoS ONE  2014;9(12):e114941.
The discovery of microbial rhodopsins in marine proteobacteria changed the dogma that photosynthesis is the only pathway to use the solar energy for biological utilization in the marine environment. Although homologs of these rhodopsins have been identified in dinoflagellates, the diversity of the encoding genes and their physiological roles remain unexplored. As an initial step toward addressing the gap, we conducted high-throughput transcriptome sequencing on Oxyrrhis marina to retrieve rhodopsin transcripts, rapid amplification of cDNA ends to isolate full-length cDNAs of dominant representatives, and quantitative reverse-transcription PCR to investigate their expression under varying conditions. Our phylogenetic analyses showed that O. marina contained both the proton-pumping type (PR) and sensory type (SR) rhodopsins, and the transcriptome data showed that the PR type dominated over the SR type. We compared rhodopsin gene expression for cultures kept under light: dark cycle and continuous darkness in a time course of 24 days without feeding. Although both types of rhodopsin were expressed under the two conditions, the expression levels of PR were much higher than SR, consistent with the transcriptomic data. Furthermore, relative to cultures kept in the dark, rhodopsin expression levels and cell survival rate were both higher in cultures grown in the light. This is the first report of light-dependent promotion of starvation survival and concomitant promotion of PR expression in a eukaryote. While direct evidence needs to come from functional test on rhodopsins in vitro or gene knockout/knockdown experiments, our results suggest that the proton-pumping rhodopsin might be responsible for the light-enhanced survival of O. marina, as previously demonstrated in bacteria.
doi:10.1371/journal.pone.0114941
PMCID: PMC4266641  PMID: 25506945
2.  Detecting In Situ Copepod Diet Diversity Using Molecular Technique: Development of a Copepod/Symbiotic Ciliate-Excluding Eukaryote-Inclusive PCR Protocol 
PLoS ONE  2014;9(7):e103528.
Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.
doi:10.1371/journal.pone.0103528
PMCID: PMC4110036  PMID: 25058323
3.  The Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP): Illuminating the Functional Diversity of Eukaryotic Life in the Oceans through Transcriptome Sequencing 
Keeling, Patrick J. | Burki, Fabien | Wilcox, Heather M. | Allam, Bassem | Allen, Eric E. | Amaral-Zettler, Linda A. | Armbrust, E. Virginia | Archibald, John M. | Bharti, Arvind K. | Bell, Callum J. | Beszteri, Bank | Bidle, Kay D. | Cameron, Connor T. | Campbell, Lisa | Caron, David A. | Cattolico, Rose Ann | Collier, Jackie L. | Coyne, Kathryn | Davy, Simon K. | Deschamps, Phillipe | Dyhrman, Sonya T. | Edvardsen, Bente | Gates, Ruth D. | Gobler, Christopher J. | Greenwood, Spencer J. | Guida, Stephanie M. | Jacobi, Jennifer L. | Jakobsen, Kjetill S. | James, Erick R. | Jenkins, Bethany | John, Uwe | Johnson, Matthew D. | Juhl, Andrew R. | Kamp, Anja | Katz, Laura A. | Kiene, Ronald | Kudryavtsev, Alexander | Leander, Brian S. | Lin, Senjie | Lovejoy, Connie | Lynn, Denis | Marchetti, Adrian | McManus, George | Nedelcu, Aurora M. | Menden-Deuer, Susanne | Miceli, Cristina | Mock, Thomas | Montresor, Marina | Moran, Mary Ann | Murray, Shauna | Nadathur, Govind | Nagai, Satoshi | Ngam, Peter B. | Palenik, Brian | Pawlowski, Jan | Petroni, Giulio | Piganeau, Gwenael | Posewitz, Matthew C. | Rengefors, Karin | Romano, Giovanna | Rumpho, Mary E. | Rynearson, Tatiana | Schilling, Kelly B. | Schroeder, Declan C. | Simpson, Alastair G. B. | Slamovits, Claudio H. | Smith, David R. | Smith, G. Jason | Smith, Sarah R. | Sosik, Heidi M. | Stief, Peter | Theriot, Edward | Twary, Scott N. | Umale, Pooja E. | Vaulot, Daniel | Wawrik, Boris | Wheeler, Glen L. | Wilson, William H. | Xu, Yan | Zingone, Adriana | Worden, Alexandra Z.
PLoS Biology  2014;12(6):e1001889.
Current sampling of genomic sequence data from eukaryotes is relatively poor, biased, and inadequate to address important questions about their biology, evolution, and ecology; this Community Page describes a resource of 700 transcriptomes from marine microbial eukaryotes to help understand their role in the world's oceans.
doi:10.1371/journal.pbio.1001889
PMCID: PMC4068987  PMID: 24959919
4.  Massive Gene Transfer and Extensive RNA Editing of a Symbiotic Dinoflagellate Plastid Genome 
Genome Biology and Evolution  2014;6(6):1408-1422.
Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8–3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly.
doi:10.1093/gbe/evu109
PMCID: PMC4079212  PMID: 24881086
RNA editing; plastid-associated genes; dinoflagellate; Symbiodinium minutum; hydropathy; light-harvesting complex proteins; minicircles
5.  Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae) 
PLoS ONE  2013;8(8):e71232.
Gene structure and expression regulation of form II RuBisCO (rbcII) in dinoflagellates are still poorly understood. Here we isolated this gene (Pdrbc) and investigated its diel expression pattern in a harmful algal bloom forming dinoflagellate Prorocentrum donghaiense. We obtained cDNA sequences with triple tandem repeats of the coding unit (CU); the 5′ region has the sequence of a typical dinoflagellate plastid gene, encoding an N-terminus with two transmembrane regions separated by a plastid transit peptide. The CUs (1,455 bp except 1464 bp in last CU) are connected through a 63 bp spacer. Phylogenetic analysis showed that rbcII CUs within species formed monophyletic clusters, indicative of intraspecific gene duplication or purifying evolution. Using quantitative PCR (qPCR) we estimated 117±40 CUs of Pdrbc in the P. donghaiense genome. Although it is commonly believed that most dinoflagellate genes lack transcriptional regulation, our RT-qPCR analysis on synchronized cultures revealed remarkable diel rhythm of Pdrbc expression, showing significant correlations of transcript abundance with the timing of the dark-to-light transition and cell cycle G2M-phase. When the cultures were shifted to continuous light, Pdrbc expression remained significantly correlated with the G2M-phase. Under continuous darkness the cell cycle was arrested at the G1 phase, and the rhythm of Pdrbc transcription disappeared. Our results suggest that dinoflagellate rbcII 1) undergoes duplication or sequence purification within species, 2) is organized in tandem arrays in most species probably to facilitate efficient translation and import of the encoded enzyme, and 3) is regulated transcriptionally in a cell cycle-dependent fashion at least in some dinoflagellates.
doi:10.1371/journal.pone.0071232
PMCID: PMC3747160  PMID: 23976999
6.  Apical Groove Type and Molecular Phylogeny Suggests Reclassification of Cochlodinium geminatum as Polykrikos geminatum 
PLoS ONE  2013;8(8):e71346.
Traditionally Cocholodinium and Gymnodinium sensu lato clade are distinguished based on the cingulum turn number, which has been increasingly recognized to be inadequate for Gymnodiniales genus classification. This has been improved by the combination of the apical groove characteristics and molecular phylogeny, which has led to the erection of several new genera (Takayama, Akashiwo, Karenia, and Karlodinium). Taking the apical groove characteristics and molecular phylogeny combined approach, we reexamined the historically taxonomically uncertain species Cochlodinium geminatum that formed massive blooms in Pearl River Estuary, China, in recent years. Samples were collected from a bloom in 2011 for morphological, characteristic pigment, and molecular analyses. We found that the cingulum in this species wraps around the cell body about 1.2 turns on average but can appear under the light microscopy to be >1.5 turns after the cells have been preserved. The shape of its apical groove, however, was stably an open-ended anticlockwise loop of kidney bean shape, similar to that of Polykrikos. Furthermore, the molecular phylogenetic analysis using 18S rRNA-ITS-28S rRNA gene cistron we obtained in this study also consistently placed this species closest to Polykrikos within the Gymnodinium sensu stricto clade and set it far separated from the clade of Cochlodinium. These results suggest that this species should be transferred to Polykrikos as Polykrikos geminatum. Our results reiterate the need to use the combination of apical groove morphology and molecular phylogeny for the classification of species within the genus of Cochlodinium and other Gymnodiniales lineages.
doi:10.1371/journal.pone.0071346
PMCID: PMC3747182  PMID: 23990946
7.  Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp. 
PLoS ONE  2013;8(4):e60826.
Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
doi:10.1371/journal.pone.0060826
PMCID: PMC3621762  PMID: 23585853
8.  Effect of Inorganic and Organic Ligands on the Bioavailability of Methylmercury as Determined by Using a mer-lux Bioreporter 
Applied and Environmental Microbiology  2012;78(20):7276-7282.
A mer-lux bioreporter was constructed to assess the bioavailability of methylmercury [CH3Hg(II)] in Escherichia coli. The bioreporter was shown to be sensitive, with a detection limit of 2.5 nM CH3Hg(II), and was used to investigate the effects of chlorides, humic acids, and thiols on the bioavailability of CH3Hg(II) in E. coli. It was found that increasing the concentration of chlorides resulted in an increase in CH3Hg(II) bioavailability, suggesting that there was passive diffusion of the neutral complex (CH3HgCl0). Humic acids were found to reduce the bioavailability of CH3Hg(II) in varying degrees. Complexation with cysteine resulted in increased bioavailability of CH3Hg(II), while assays with equivalent concentrations of methionine and leucine had little or no effect on bioavailability. The mechanism of uptake of the mercurial-cysteine complexes is likely not passive diffusion but could result from the activities of a cysteine transport system. The bioavailability of CH3Hg(II) decreased with increasing glutathione concentrations.
doi:10.1128/AEM.00362-12
PMCID: PMC3457092  PMID: 22865079
9.  Prevalent Ciliate Symbiosis on Copepods: High Genetic Diversity and Wide Distribution Detected Using Small Subunit Ribosomal RNA Gene 
PLoS ONE  2012;7(9):e44847.
Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.
doi:10.1371/journal.pone.0044847
PMCID: PMC3443111  PMID: 23024768
10.  High Sequence Variability, Diverse Subcellular Localizations, and Ecological Implications of Alkaline Phosphatase in Dinoflagellates and Other Eukaryotic Phytoplankton 
Alkaline phosphatase (AP) is a key enzyme for phytoplankton to utilize dissolved organic phosphorus (DOP) when dissolved inorganic phosphorus is limited. While three major types of AP and their correspondingly diverse subcellular localization have been recognized in bacteria, little is known about AP in eukaryotic phytoplankton such as dinoflagellates. Here, we isolated a full-length AP cDNA from a latest-diverging dinoflagellate genus Alexandrium, and conducted comparative analyses with homologs from a relatively basal (Amphidinium carterae) and late-diverging (Karenia brevis) lineage of dinoflagellates as well as other eukaryotic algae. New data and previous studies indicate that AP is common in dinoflagellates and most other major eukaryotic groups of phytoplankton. AP sequences are more variable than many other genes studied in dinoflagellates, and are divergent among different eukaryotic phytoplankton lineages. Sequence comparison to the other characterized APs suggests that dinoflagellates and some other eukaryotic phytoplankton possess the putative AP as phoA type, but some other eukaryotic phytoplankton seem to have other types. Phylogenetic analyses based on AP amino acid sequences indicated that the “red-type” eukaryotic lineages formed a monophyletic group, suggesting a common origin of their APs. As different amino acid sequences have been found to predictably determine different spatial distribution in the cells, which may facilitate access to different pools of DOP, existing computational models were adopted to predict the subcellular localizations of putative AP in the three dinoflagellates and other eukaryotic phytoplankton. Results showed different subcellular localizations of APs in different dinoflagellates and other lineages. The linkage between AP sequence divergence, subcellular localization, and ecological niche differentiation requires rigorous experimental verification, and this study now provides a framework for such a future effort.
doi:10.3389/fmicb.2012.00235
PMCID: PMC3387780  PMID: 22783243
alkaline phosphatase; phosphate limitation; phytoplankton; dinoflagellate; diverse subcellular localization; highly divergent
11.  Nuclear, Mitochondrial and Plastid Gene Phylogenies of Dinophysis miles (Dinophyceae): Evidence of Variable Types of Chloroplasts 
PLoS ONE  2011;6(12):e29398.
The Dinophysis genus is an ecologically and evolutionarily important group of marine dinoflagellates, yet their molecular phylogenetic positions and ecological characteristics such as trophic modes remain poorly understood. Here, a population of Dinophysis miles var. indica was sampled from South China Sea in March 2010. Nuclear ribosomal RNA gene (rDNA) SSU, ITS1-5.8S-ITS2 and LSU, mitochondrial genes encoding cytochrome B (cob) and cytochrome C oxidase subunit I (cox1), and plastid rDNA SSU were PCR amplified and sequenced. Phylogenetic analyses based on cob, cox1, and the nuclear rRNA regions showed that D. miles was closely related to D. tripos and D. caudata while distinct from D. acuminata. Along with morphology the LSU and ITS1-5.8S-ITS2 molecular data confirmed that this population was D. miles var. indica. Furthermore, the result demonstrated that ITS1-5.8S-ITS2 fragment was the most effective region to distinguish D. miles from other Dinophysis species. Three distinct types of plastid rDNA sequences were detected, belonging to plastids of a cryptophyte, a haptophyte, and a cyanobacterium, respectively. This is the first documentation of three photosynthetic entities associated with a Dinophysis species. While the cyanobacterial sequence likely represented an ectosymbiont of the D. miles cells, the detection of the cryptophyte and haptophyte plastid sequences indicates that the natural assemblage of D. miles likely retain more than one type of plastids from its prey algae for temporary use in photosynthesis. The result, together with recent findings of plastid types in other Dinophysis species, suggests that more systematic research is required to understand the complex nutritional physiology of this genus of dinoflagellates.
doi:10.1371/journal.pone.0029398
PMCID: PMC3248434  PMID: 22242118
12.  Spliced Leader RNAs, Mitochondrial Gene Frameshifts and Multi-Protein Phylogeny Expand Support for the Genus Perkinsus as a Unique Group of Alveolates 
PLoS ONE  2011;6(5):e19933.
The genus Perkinsus occupies a precarious phylogenetic position. To gain a better understanding of the relationship between perkinsids, dinoflagellates and other alveolates, we analyzed the nuclear-encoded spliced-leader (SL) RNA and mitochondrial genes, intron prevalence, and multi-protein phylogenies. In contrast to the canonical 22-nt SL found in dinoflagellates (DinoSL), P. marinus has a shorter (21-nt) and a longer (22-nt) SL with slightly different sequences than DinoSL. The major SL RNA transcripts range in size between 80–83 nt in P. marinus, and ∼83 nt in P. chesapeaki, significantly larger than the typical ≤56-nt dinoflagellate SL RNA. In most of the phylogenetic trees based on 41 predicted protein sequences, P. marinus branched at the base of the dinoflagellate clade that included the ancient taxa Oxyrrhis and Amoebophrya, sister to the clade of apicomplexans, and in some cases clustered with apicomplexans as a sister to the dinoflagellate clade. Of 104 Perkinsus spp. genes examined 69.2% had introns, a higher intron prevalence than in dinoflagellates. Examination of Perkinsus spp. mitochondrial cytochrome B and cytochrome C oxidase subunit I genes and their cDNAs revealed no mRNA editing, but these transcripts can only be translated when frameshifts are introduced at every AGG and CCC codon as if AGGY codes for glycine and CCCCU for proline. These results, along with the presence of the numerous uncharacterized ‘marine alveolate group I' and Perkinsus-like lineages separating perkinsids from core dinoflagellates, expand support for the affiliation of the genus Perkinsus with an independent lineage (Perkinsozoa) positioned between the phyla of Apicomplexa and Dinoflagellata.
doi:10.1371/journal.pone.0019933
PMCID: PMC3101222  PMID: 21629701
13.  Two Functionally Distinct Ciliates Dwelling in Acropora Corals in the South China Sea near Sanya, Hainan Province, China▿  
Applied and Environmental Microbiology  2010;76(16):5639-5643.
We detected and characterized two distinct scuticociliate ciliates inside Acropora corals in the South China Sea. One, voraciously foraging on Symbiodinium, resembled the brown band disease of ciliates. The other, which is closely related to Paranophrys magna, grazed on detritus instead of Symbiodinium. These two ciliates may serve contrasting functions (competitor versus “cleaner”) in the coral-ciliate-Symbiodinium triangular relationship.
doi:10.1128/AEM.03009-09
PMCID: PMC2918966  PMID: 20581178
14.  Dinoflagellate Spliced Leader RNA Genes Display a Variety of Sequences and Genomic Arrangements 
Molecular Biology and Evolution  2009;26(8):1757-1771.
Spliced leader (SL) trans-splicing is a common mRNA processing mechanism in dinoflagellates, in which a 22-nt sequence is transferred from the 5′-end of a small noncoding RNA, the SL RNA, to the 5′-end of mRNA molecules. Although the SL RNA gene was shown initially to be organized as tandem repeats with transcripts of 50–60 nt, shorter than most of their counterparts in other organisms, other gene organizations and transcript lengths were reported subsequently. To address the evolutionary gradient of gene organization complexity, we thoroughly examined transcript and gene organization of the SL RNA in a phylogenetically and ecologically diverse group of dinoflagellates representing four Orders. All these dinoflagellates possessed SL RNA transcripts of 50–60 nt, although in one species additional transcripts of up to 92 nt were also detected. At the genomic level, various combinations of SL RNA and 5S rRNA tandem gene arrays, including SL RNA–only, 5S rRNA–only, and mixed SL RNA–5S rRNA (SL–5S) clusters, were amplified by polymerase chain reaction for six dinoflagellates, containing intergenic spacers ranging from 88 bp to over 1.2 kb. Of these species, no SL–5S cluster was detected in Prorocentrum minimum, and only Karenia brevis showed the U6 small nuclear RNA gene associated with these mixed arrays. The 5S rRNA–only array was also found in three dinoflagellates, along with two SL–5S-adjacent arrangements found in two other species that could represent junctions. Two species contained multimeric SL exon repeats with no associated intron. These results suggest that 1) both the SL RNA tandem repeat and the SL–5S cluster genomic organizations are an “ancient” and widespread feature within the phylum of dinoflagellates and 2) rampant genomic duplication and recombination are ongoing independently in each dinoflagellate lineage, giving rise to the highly complex and diversified genomic arrangements of the SL RNA gene, while conserving the length and structure of the functional SL RNA.
doi:10.1093/molbev/msp083
PMCID: PMC2734150  PMID: 19387009
Dinoflagellate; SL RNA; complex genomic arrangement
15.  Serious Overestimation in Quantitative PCR by Circular (Supercoiled) Plasmid Standard: Microalgal pcna as the Model Gene 
PLoS ONE  2010;5(3):e9545.
Quantitative real-time PCR (qPCR) has become a gold standard for the quantification of nucleic acids and microorganism abundances, in which plasmid DNA carrying the target genes are most commonly used as the standard. A recent study showed that supercoiled circular confirmation of DNA appeared to suppress PCR amplification. However, to what extent to which different structural types of DNA (circular versus linear) used as the standard may affect the quantification accuracy has not been evaluated. In this study, we quantitatively compared qPCR accuracies based on circular plasmid (mostly in supercoiled form) and linear DNA standards (linearized plasmid DNA or PCR amplicons), using proliferating cell nuclear gene (pcna), the ubiquitous eukaryotic gene, in five marine microalgae as a model gene. We observed that PCR using circular plasmids as template gave 2.65-4.38 more of the threshold cycle number than did equimolar linear standards. While the documented genome sequence of the diatom Thalassiosira pseudonana shows a single copy of pcna, qPCR using the circular plasmid as standard yielded an estimate of 7.77 copies of pcna per genome whereas that using the linear standard gave 1.02 copies per genome. We conclude that circular plasmid DNA is unsuitable as a standard, and linear DNA should be used instead, in absolute qPCR. The serious overestimation by the circular plasmid standard is likely due to the undetected lower efficiency of its amplification in the early stage of PCR when the supercoiled plasmid is the dominant template.
doi:10.1371/journal.pone.0009545
PMCID: PMC2832698  PMID: 20221433
17.  Distinct Gene Number-Genome Size Relationships for Eukaryotes and Non-Eukaryotes: Gene Content Estimation for Dinoflagellate Genomes 
PLoS ONE  2009;4(9):e6978.
The ability to predict gene content is highly desirable for characterization of not-yet sequenced genomes like those of dinoflagellates. Using data from completely sequenced and annotated genomes from phylogenetically diverse lineages, we investigated the relationship between gene content and genome size using regression analyses. Distinct relationships between log10-transformed protein-coding gene number (Y′) versus log10-transformed genome size (X′, genome size in kbp) were found for eukaryotes and non-eukaryotes. Eukaryotes best fit a logarithmic model, Y′ = ln(-46.200+22.678X′, whereas non-eukaryotes a linear model, Y′ = 0.045+0.977X′, both with high significance (p<0.001, R2>0.91). Total gene number shows similar trends in both groups to their respective protein coding regressions. The distinct correlations reflect lower and decreasing gene-coding percentages as genome size increases in eukaryotes (82%–1%) compared to higher and relatively stable percentages in prokaryotes and viruses (97%–47%). The eukaryotic regression models project that the smallest dinoflagellate genome (3×106 kbp) contains 38,188 protein-coding (40,086 total) genes and the largest (245×106 kbp) 87,688 protein-coding (92,013 total) genes, corresponding to 1.8% and 0.05% gene-coding percentages. These estimates do not likely represent extraordinarily high functional diversity of the encoded proteome but rather highly redundant genomes as evidenced by high gene copy numbers documented for various dinoflagellate species.
doi:10.1371/journal.pone.0006978
PMCID: PMC2737104  PMID: 19750009
18.  High-Level Diversity of Dinoflagellates in the Natural Environment, Revealed by Assessment of Mitochondrial cox1 and cob Genes for Dinoflagellate DNA Barcoding ▿ †  
DNA barcoding is a diagnostic technique for species identification using a short, standardized DNA. An effective DNA barcoding marker would be very helpful for unraveling the poorly understood species diversity of dinoflagellates in the natural environment. In this study, the potential utility for DNA barcoding of mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob) was assessed. Among several primer sets examined, the one amplifying a 385-bp cob fragment was most effective for dinoflagellates. This short cob fragment is easy to sequence and yet possess reasonable taxon resolution. While the lack of a uniform gap between interspecific and intraspecific distances poses difficulties in establishing a phylum-wide species-discriminating distance threshold, the variability of cob allows recognition of species within particular lineages. The potential of this cob fragment as a dinoflagellate species marker was further tested by applying it to an analysis of the dinoflagellate assemblages in Long Island Sound (LIS) and Mirror Lake in Connecticut. In LIS, a highly diverse assemblage of dinoflagellates was detected. Some taxa can be identified to the species and some to the genus level, including a taxon distinctly related to the bipolar species Polarella glacialis, and the large number of others cannot be clearly identified, due to the inadequate database. In Mirror Lake, a Ceratium species and an unresolved taxon were detected, exhibiting a temporal transition from one to the other. We demonstrate that this 385-bp cob fragment is promising for lineage-wise dinoflagellate species identification, given an adequate database.
doi:10.1128/AEM.01578-08
PMCID: PMC2648164  PMID: 19114529
19.  Retrieval of Missing Spliced Leader in Dinoflagellates 
PLoS ONE  2009;4(1):e4129.
Spliced leader (SL) trans-splicing has recently been shown to be a common mRNA processing mechanism in dinoflagellates, in which a short (22-nt) sequence, DCCGUAGCCAUUUUGGCUCAAG (D = U, A, or G), is transplanted from the 5′-end of a small non-coding RNA (SL RNA) to the 5′ end of mRNA molecules. The widespread existence of the mechanism in dinoflagellates has been demonstrated by detection of this SL (DinoSL) in a wide phylogenetic range of dinoflagellates. Furthermore, the presence of DinoSL in the transcripts of highly diverse groups of nuclear-encoded genes has led us to postulate that SL trans-splicing is universal in dinoflagellate nuclear genome. However, some observations inconsistent to this postulation have been reported, exemplified by a recent article reporting apparent absence of DinoSL in the transcripts of some nuclear-encoded genes in Amphidinium carterae. Absence of SL in these gene transcripts would have important implication on gene regulation in dinoflagellates and utility of DinoSL as a universal dinoflagellate-specific primer to study dinoflagellate transcriptomics. In this study, we re-examined transcripts of these genes and found that all of them actually contained DinoSL. Therefore, results to date are consistent to our initial postulation that DinoSL occurs in all dinoflagellate nuclear-encoded mRNAs.
doi:10.1371/journal.pone.0004129
PMCID: PMC2606063  PMID: 19122814
20.  Mitochondrial cob and cox1 Genes and Editing of the Corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with Special Reference to the Phylogenetic Position of the Genus Dinophysis▿  
Dinophysis acuminata cells were isolated from Narragansett Bay water samples in June 2005 using flow cytometry. Dinoflagellate-specific PCR primers were used to isolate small-subunit rRNA (18S rRNA), mitochondrial cytochrome b (cob), and cytochrome c oxidase I (cox1) genes and the encoded cDNAs. Maximum-likelihood analysis of a concatenated data set of ribosomal DNA and cDNA sequences of cob and cox1 showed that D. acuminata was sister to Gonyaulacoids, but without strong bootstrap support. The approximately unbiased test could not reject alternative positions of D. acuminata. To gain better resolution, mRNA editing of cob and cox1 was inferred for D. acuminata and 13 other dinoflagellate species. The location and type of editing as well as the distribution pattern in D. acuminata were generally similar to those in other dinoflagellates except for two edited sites that are unique to this species. Bayesian analyses of a matrix that recorded the location and type of editing, and of a matrix that included the protein sequences of COB and COX1 with the editing data yielded tree topologies similar to the three-gene tree but again failed to resolve the phylogenetic position of D. acuminata. However, the density of edited sites in the D. acuminata mitochondrial genes, consistent with phylogenetic trees, indicated that Dinophysis is a derived dinoflagellate lineage, diverging after other lineages such as Oxyrrhis, Amphidinium, and Symbiodinium. We demonstrate that dinoflagellate-specific PCR coupled with flow cytometry can be a useful tool to analyze genes and their transcripts from a natural dinoflagellate population.
doi:10.1128/AEM.02103-07
PMCID: PMC2258633  PMID: 18165361
21.  Development of a Dinoflagellate-Oriented PCR Primer Set Leads to Detection of Picoplanktonic Dinoflagellates from Long Island Sound†  
We developed dinoflagellate-specific 18S rRNA gene primers. PCR amplification using these oligonucleotides for a picoplanktonic DNA sample from Long Island Sound yielded 24 clones, and all but one of these clones were dinoflagellates primarily belonging to undescribed and Amoebophrya-like lineages. These results highlight the need for a systematic investigation of picodinoflagellate diversity in both coastal and oceanic ecosystems.
doi:10.1128/AEM.00586-06
PMCID: PMC1538694  PMID: 16885319
22.  Development of a cob-18S rRNA Gene Real-Time PCR Assay for Quantifying Pfiesteria shumwayae in the Natural Environment†  
Applied and Environmental Microbiology  2005;71(11):7053-7063.
Despite the fact that the heterotrophic dinoflagellate Pfiesteria shumwayae is an organism of high interest due to alleged toxicity, its abundance in natural environments is poorly understood. To address this inadequacy, a real-time quantitative PCR assay based on mitochondrial cytochrome b (cob) and18S rRNA gene was developed and P. shumwayae abundance was investigated in several geographic locations. First, cob and its 5′-end region were isolated from a P. shumwayae culture, revealing three different copies, each consisting of an identical cob coding region and an unidentified region (X) of variable length and sequence. The unique sequences in cob and the X region were then used to develop a P. shumwayae-specific primer set. This primer set was used with reported P. shumwayae-specific 18S primers in parallel real-time PCRs to investigate P. shumwayae abundance from Maine to North Carolina along the U.S. east coast and along coasts in Chile, Hawaii, and China. Both genes generally gave similar results, indicating that this species was present, but at low abundance (mostly <10 cells · ml−1), in all the American coast locations investigated (with the exception of Long Island Sound, where which both genes gave negative results). Genetic variation was detected by use of both genes in most of the locations, and while cob consistently detected P. shumwayae or close genetic variants, some of the 18S PCR products were unrelated to P. shumwayae. We conclude that (i) the real-time PCR assay developed is useful for specific quantification of P. shumwayae, and (ii) P. shumwayae is distributed widely at the American coasts, but normally only as a minor component of plankton even in high-risk estuaries (Neuse River and the Chesapeake Bay).
doi:10.1128/AEM.71.11.7053-7063.2005
PMCID: PMC1287735  PMID: 16269741
23.  Mitogen-Activated Protein Kinase in Pfiesteria piscicida and Its Growth Rate-Related Expression† 
A full-length cDNA (1,434 bp) of mitogen-activated protein kinase (MAPK), a key molecule of a signal transduction cascade, was isolated from the estuarine heterotrophic dinoflagellate Pfiesteria piscicida. This cDNA (Ppmapk1) encoded a protein (PpMAPK1) of 428 amino acid residues that shared about 30 to 40% amino acid similarity with MAPKs in other organisms. Phylogenetic analysis indicated that PpMAPK1 was tightly clustered with MAPK3 in protozoans. Using reverse transcription-PCR, expression of this gene was evaluated for P. piscicida cultures grown under different conditions. While salinity shock, heat shock, starvation, and a subsequent encounter with prey did not appear to affect expression of this gene, Ppmapk1 expression level was correlated with growth rate, suggesting involvement of this gene in the regulation of cell proliferation in the organism.
doi:10.1128/AEM.69.1.343-349.2003
PMCID: PMC152464  PMID: 12514014
24.  Detection and Quantification of Pfiesteria piscicida by Using the Mitochondrial Cytochrome b Gene† 
Mitochondrial cytochrome b was isolated from the dinoflagellate Pfiesteria piscicida, and the utility of the gene for species identification was examined. One of the primer sets designed was shown to be highly specific for P. piscicida. A time step PCR protocol was used to demonstrate the potential of this primer set for quantification of this species.
doi:10.1128/AEM.68.2.989-994.2002
PMCID: PMC126730  PMID: 11823251
25.  Bacterial Activity in South Pole Snow 
Applied and Environmental Microbiology  2000;66(10):4514-4517.
Large populations (200 to 5,000 cells ml−1 in snowmelt) of bacteria were present in surface snow and firn from the south pole sampled in January 1999 and 2000. DNA isolated from this snow yielded ribosomal DNA sequences similar to those of several psychrophilic bacteria and a bacterium which aligns closely with members of the genus Deinococcus, an ionizing-radiation- and desiccation-resistant genus. We also obtained evidence of low rates of bacterial DNA and protein synthesis which indicates that the organisms were metabolizing at ambient subzero temperatures (−12 to −17°C).
PMCID: PMC92333  PMID: 11010907

Results 1-25 (27)