PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (59)
 

Clipboard (0)
None

Select a Filter Below

Journals
more »
Year of Publication
more »
Document Types
1.  The identification of a novel TP53 cancer susceptibility mutation through whole genome sequencing of a patient with therapy-related AML 
Context
The identification of patients with inherited cancer susceptibility syndromes facilitates early diagnosis, prevention, and treatment. However, in many cases of suspected cancer susceptibility, the family history is unclear and genetic testing of common cancer susceptibility genes is unrevealing.
Objective
To apply whole-genome sequencing to a patient with suspected cancer susceptibility (and lacking a clear family history of cancer and no BRCA1 and BRCA2 mutations) to identify rare or novel germline variants in cancer susceptibility genes.
Design, Setting, and Participant
Skin (normal) and bone marrow (leukemia) DNA were obtained from a patient with early-onset breast and ovarian cancer and therapy-related acute myeloid leukemia (t-AML), and analyzed with: 1) whole genome sequencing using paired end reads; 2) SNP genotyping; 3) RNA expression profiling; and 4) spectral karyotyping.
Main Outcome Measures
Structural variants, copy number alterations, single nucleotide variants and small insertions and deletions (indels) were detected and validated using the above platforms.
Results
Whole genome sequencing revealed a novel, heterozygous 3 Kb deletion removing exons 7-9 of TP53 in the patient’s normal skin DNA, which was homozygous in the leukemia DNA as a result of uniparental disomy. In addition, a total of 28 validated somatic single nucleotide variations or indels in coding genes, 8 somatic structural variants, and 12 somatic copy number alterations were detected in the patient’s leukemia genome.
Conclusions
Whole genome sequencing can identify novel, cryptic variants in cancer susceptibility genes in addition to providing unbiased information on the spectrum of mutations in a cancer genome.
doi:10.1001/jama.2011.473
PMCID: PMC3170052  PMID: 21505135
2.  Enhanced CREB phosphorylation in immature dentate gyrus granule cells precedes neurotrophin expression and indicates a specific role of CREB in granule cell differentiation 
Differentiation and maturation of dentate gyrus granule cells requires coordinated interactions of numerous processes. These must be regulated by protein factors capable of integrating signals mediated through diverse signalling pathways. Such integrators of inter and intracellular physiological stimuli include the cAMP-response element binding protein (CREB), a leucine-zipper class transcription factor that is activated through phosphorylation. Neuronal activity and neurotrophic factors, known to be involved in granule cell differentiation, are major physiologic regulators of CREB function. To examine whether CREB may play a role in governing coordinated gene transcription during granule cell differentiation, we determined the spatial and temporal profiles of phosphorylated (activated) CREB throughout postnatal development in immature rat hippocampus. We demonstrate that CREB activation is confined to discrete, early stages of granule cell differentiation. In addition, CREB phosphorylation occurs prior to expression of the neurotrophins BDNF and NT-3. These data indicate that in a signal transduction cascade connecting CREB and neurotrophins in the process of granule cell maturation, CREB is located upstream of neurotrophins. Importantly, CREB may be a critical component of the machinery regulating the coordinated transcription of genes contributing to the differentiation of granule cells and their integration into the dentate gyrus network.
PMCID: PMC3108563  PMID: 11207803
development; hippocampus; neurogenesis; rat; transcription factor
3.  DIFFERENTIAL AND AGE-DEPENDENT EXPRESSION OF HYPERPOLARIZATION-ACTIVATED, CYCLIC NUCLEOTIDE-GATED CATION CHANNEL ISOFORMS 1–4 SUGGESTS EVOLVING ROLES IN THE DEVELOPING RAT HIPPOCAMPUS 
Neuroscience  2001;106(4):689-698.
Hyperpolarization-activated cation currents (Ih) are found in several brain regions including thalamus and hippocampus. Important functions of these currents in promoting synchronized network activity and in determining neuronal membrane properties have been progressively recognized, but the molecular underpinnings of these currents are only emerging. Ih currents are generated by hyperpolarization-activated, cyclic nucleotide-gated cation channels (HCNs). These channel proteins are encoded by at least four HCN genes, that govern the kinetic and functional properties of the resulting channels. Because of the potential impact of Ih-mediated coordinated neuronal activity on the maturation of the functional hippocampal network, this study focused on determining the expression of the four members of the HCN gene family throughout postnatal hippocampal development at both the regional and single cell level.
The results of these experiments demonstrated that HCNs 1, 2 and 4 are differentially expressed in interneuronal and principal cell populations of the rat hippocampal formation. Expression profiles of each HCN isoform evolve during postnatal development, and patterns observed during early postnatal ages differ significantly from those in mature hippocampus. The onset of HCN expression in interneurons of the hippocampus proper precedes that in the dentate gyrus, suggesting that HCN-mediated pacing activity may be generated in hippocampal interneurons prior to those in the hilus.
Taken together, these findings indicate an age-dependent spatiotemporal evolution of specific HCN expression in distinct hippocampal cell populations, and suggest that these channels serve differing and evolving functions in the maturation of coordinated hippocampal activity.
PMCID: PMC3084019  PMID: 11682156
development; pacemaker; ion channel; synchronization; interneurons; plasticity
4.  HIPPOCAMPAL CORTICOTROPIN RELEASING HORMONE: PRE- AND POSTSYNAPTIC LOCATION AND RELEASE BY STRESS 
Neuroscience  2004;126(3):533-540.
Neuropeptides modulate neuronal function in hippocampus, but the organization of hippocampal sites of peptide release and actions is not fully understood. The stress-associated neuropeptide corticotropin releasing hormone (CRH) is expressed in inhibitory interneurons of rodent hippocampus, yet physiological and pharmacological data indicate that it excites pyramidal cells. Here we aimed to delineate the structural elements underlying the actions of CRH, and determine whether stress influenced hippocampal principal cells also via actions of this endogenous peptide.
In hippocampal pyramidal cell layers, CRH was located exclusively in a subset of GABAergic somata, axons and boutons, whereas the principal receptor mediating the peptide’s actions, CRH receptor 1 (CRF1), resided mainly on dendritic spines of pyramidal cells. Acute ‘psychological’ stress led to activation of principal neurons that expressed CRH receptors, as measured by rapid phosphorylation of the transcription factor cyclic AMP responsive element binding protein. This neuronal activation was abolished by selectively blocking the CRF1 receptor, suggesting that stress-evoked endogenous CRH release was involved in the activation of hippocampal principal cells.
doi:10.1016/j.neuroscience.2004.03.036
PMCID: PMC2923444  PMID: 15183503
neuropeptide; CRH; CRF; synapse; CREB; learning and memory
5.  Risk of malignancies in patients with diabetes treated with human insulin or insulin analogues: a cohort study 
Diabetologia  2009;52(9):1732-1744.
Aims/hypothesis
The aim of this cohort study was to investigate the risk of malignant neoplasms and mortality in patients with diabetes treated either with human insulin or with one of three insulin analogues.
Methods
Data were provided by the largest German statutory health insurance fund (time-frame: January 1998 to June 2005 inclusive), on patients without known malignant disease who had received first-time therapy for diabetes mellitus exclusively with human insulin, aspart, lispro or glargine. The primary outcome was the diagnosis of a malignant neoplasm. Data were analysed by multiple Cox regression models adjusting for potential confounders.
Results
A total of 127,031 patients were included, with a mean follow-up time of 1.63 (median 1.41, maximum 4.41) years. A positive association between cancer incidence and insulin dose was found for all insulin types. Because patients receiving combined therapy with insulin analogues and human insulin were excluded, the mean daily dose was much lower for glargine than for human insulin, and a slightly lower cancer incidence in the glargine group was found. After adjusting for dose, a dose-dependent increase in cancer risk was found for treatment with glargine compared with human insulin (p < 0.0001): the adjusted HR was 1.09 (95% CI 1.00 to 1.19) for a daily dose of 10 IU, 1.19 (95% CI 1.10 to 1.30) for a daily dose of 30 IU, and 1.31 (95% CI 1.20 to 1.42) for a daily dose of 50 IU. No increased risk was found for aspart (p = 0.30) or lispro (p = 0.96) compared with human insulin.
Conclusions/interpretation
Considering the overall relationship between insulin dose and cancer, and the lower dose with glargine, the cancer incidence with glargine was higher than expected compared with human insulin. Our results based on observational data support safety concerns surrounding the mitogenic properties of glargine in diabetic patients. Prospective long-term studies are needed to further evaluate the safety of insulin analogues, especially glargine.
Electronic supplementary material
The online version of this article (doi:10.1007/s00125-009-1418-4) contains supplementary material, which is available to authorised users.
doi:10.1007/s00125-009-1418-4
PMCID: PMC2723679  PMID: 19565214
Aspart; Cohort study; Diabetes; Glargine; Human insulin; Insulin analogue; Lispro; Mortality; Neoplasm
6.  Differences in the structure of CAHPS measures among the medicare fee-for-service, medicare managed care, and privately insured populations. 
Health Services Research  2001;36(3):489-508.
OBJECTIVE: To confirm in a new population, the Medicare fee-for-service population, the factor structure previously found in two Consumer Assessment of Health Plans Study (CAHPS) field-test surveys with Medicare HMO and adult privately insured populations. DATA SOURCES: Primary data were collected in the fall of 1998. Survey responses from the Medicare Fee-for-Service CAHPS survey field test were compared to results from the Medicare HMO and adult privately insured field-test studies conducted in the fall of 1996. STUDY DESIGN: Respondents for the field-test survey were a random sample of Medicare beneficiaries in five states who had opted for the original Medicare plan (fee-for-service). DATA COLLECTION: Data were collected by a mailed survey with a telephone follow-up survey to those who did not return the mailed survey. PRINCIPAL FINDINGS: A confirmatory factor analysis in two different samples of Medicare fee-for-service beneficiaries provided basic support for a previously reported three-factor structure underlying the CAHPS reports and rating items: (1) quality of provider or staff communications; (2) timely access to quality health care; and (3) quality of plan administration. An exploratory factor analysis revealed a variant three-factor structure. CONCLUSION: Because of differences in the factor structures among the different populations discussed, caution needs to be exercised in any composite development, based on factor analysis or any other basis, by which cross-population comparisons will be made. Comparisons should only be made on composites representing stable structure across all populations concerned.
PMCID: PMC1089239  PMID: 11482586
7.  Effect on hip fractures of increased use of hip protectors in nursing homes: cluster randomised controlled trial 
BMJ : British Medical Journal  2003;326(7380):76.
Objective
To assess the effects of an intervention programme designed to increase use of hip protectors in elderly people in nursing homes.
Design
Cluster randomised controlled trial with 18 months of follow up.
Setting
Nursing homes in Hamburg (25 clusters in intervention group; 24 in control group).
Participants
Residents with a high risk of falling (459 in intervention group; 483 in control group).
Intervention
Single education session for nursing staff, who then educated residents; provision of three hip protectors per resident in intervention group. Usual care optimised by brief information to nursing staff about hip protectors and provision of two hip protectors per cluster for demonstration purposes.
Main outcome measure
Incidence of hip fractures.
Results
Mean follow up was 15 months for the intervention group and 14 months for the control group. In total 167 residents in the intervention group and 207 in the control group died or moved away. There were 21 hip fractures in 21 (4.6%) residents in the intervention group and 42 hip fractures in 39 (8.1%) residents in the control group (relative risk 0.57, absolute risk difference −3.5%, 95% confidence interval −7.3% to 0.3%, P=0.072). After adjustment for the cluster randomisation the proportions of fallers who used a hip protector were 68% and 15% respectively (mean difference 53%, 38% to 67%, P=0.0001). There were 39 other fractures in the intervention group and 38 in the control group.
Conclusion
The introduction of a structured education programme and the provision of free hip protectors in nursing homes increases the use of protectors and may reduce the number of hip fractures.
What is already known on this topicNursing home residents are at particularly high risk of fracturing a hipHip protectors can effectively prevent hip fracturesAdherence to the use of hip protectors is poorWhat this study addsThe use of hip protectors in nursing homes can be substantially increased by a single session education targeted at nursing staff and residents and provision of free hip protectorsIncreasing the use of hip protectors resulted in a relative reduction of hip fractures of about 40%
PMCID: PMC139934  PMID: 12521969
9.  Efficiency of nanoparticles as a carrier system for antiviral agents in human immunodeficiency virus-infected human monocytes/macrophages in vitro. 
Polyhexylcyanoacrylate nanoparticles loaded with either the human immunodeficiency virus (HIV) protease inhibitor saquinavir (Ro 31-8959) or the nucleoside analog zalcitabine (2',3'-dideoxycytidine) were prepared by emulsion polymerization and tested for antiviral activity in primary human monocytes/macrophages in vitro. Both nanoparticulate formulations led to a dose-dependent reduction of HIV type 1 antigen production. While nanoparticle-bound zalcitabine showed no superiority to an aqueous solution of the drug, a significantly higher efficacy was observed with saquinavir-loaded nanoparticles. In acutely infected cells, an aqueous solution of saquinavir showed little antiviral activity at concentrations below 10 nM, whereas the nanoparticulate formulation exhibited a good antiviral effect at a concentration of 1 nM and a still-significant antigen reduction at 0.1 nM (50% inhibitory concentrations = 4.23 nM for the free drug and 0.39 nM for the nanoparticle-bound drug). At a concentration of 100 nM, saquinavir was completely inactive in chronically HIV-infected macrophages, but when bound to nanoparticles it caused a 35% decrease in antigen production. Using nanoparticles as a drug carrier system could improve the delivery of antiviral agents to the mononuclear phagocyte system in vivo, overcoming pharmacokinetic problems and enhancing the activities of drugs for the treatment of HIV infection and AIDS.
PMCID: PMC163350  PMID: 8726020
11.  Preclinical evaluation of HBY 097, a new nonnucleoside reverse transcriptase inhibitor of human immunodeficiency virus type 1 replication. 
Antimicrobial Agents and Chemotherapy  1995;39(10):2253-2257.
HBY 097 [(S)-4-isopropoxycarbonyl-6-methoxy-3-(methylthiomethyl)-3, 4-dihydroquinoxaline-2(1H)-thione] was selected from a series of quinoxalines as a nonnucleoside inhibitor of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (NNRTI). HBY 097 was shown to be a highly potent inhibitor of HIV-1 induced cell killing and HIV-1 replication in a variety of human cell lines as well as in fresh human peripheral blood lymphocytes and macrophages. The compound was also active against a variety of clinical isolates of HIV-1 including different HIV-1 subtypes and viruses resistant to 3'-deoxy-3'-azidothymidine. Mutant reverse transcriptases which arise as a consequence of treatment with other nonnucleoside inhibitors of HIV-1 reverse transcriptase were still inhibited by HBY 097 at relatively low concentrations. An HIV-1MN variant resistant to inhibition by HBY 097 displayed in the reverse transcriptase gene a mutation causing a substitution at position 190 of a glutamic acid for a glycine residue (G190 --> E), which is characteristic for quinoxaline derivatives. The drug was demonstrated to possess a favorable toxicity profile and to show good oral bioavailability in both mice and dogs. As a consequence of its outstanding properties, HBY 097 was selected for further development and is at present undergoing clinical trials.
PMCID: PMC162925  PMID: 8619578
12.  Repression of the Klebsiella aerogenes nac promoter. 
Journal of Bacteriology  1995;177(19):5535-5538.
Transcription of the nitrogen-regulated nac promoter of Klebsiella aerogenes requires sigma54 RNA polymerase, is activated by the phosphorylated form of the transcription factor nitrogen regulator I (NRI) (NtrC), and is repressed by the product of the nac gene, Nac. Nac protects a large portion of the nac control region, extending from positions -130 to -70, from digestion by DNase I. This site(s) lies immediately upstream from the site at which sigma 54 RNA polymerase binds, is downstream of a high-affinity binding site for the transcriptional activator NRI approximately P, and partially overlaps a low-affinity NRI approximately P-binding site. Binding of Nac to the DNA resulted in bending of the DNA but did not interfere with the binding of sigma 54 RNA polymerase to the promoter or with the binding of NRI approximately P to either the high-affinity site or low-affinity site. Furthermore, transcription assays with various wild-type and mutant templates suggested that Nac did not exclude NRI approximately P from either the low- or high-affinity sites, nor did Nac interfere with the ability of the polymerase to form the open complex when the binding sites for NRI approximately P were moved to different locations upstream from the promoter. Rather, Nac seemed to repress by an antiactivation mechanism in which the interaction of the NRI approximately P, bound at its normal sites, with sigma 54 RNA polymerase, bound to the promoter, was prevented.
PMCID: PMC177361  PMID: 7559339
13.  Activation of transcription initiation from the nac promoter of Klebsiella aerogenes. 
Journal of Bacteriology  1995;177(19):5523-5534.
The nac gene of Klebsiella aerogenes encodes a bifunctional transcription factor that activates or represses the expression of several operons under conditions of nitrogen limitation. In experiments with purified components, transcription from the nac promoter was initiated by sigma 54 RNA polymerase and was activated by the phosphorylated form of nitrogen regulator I (NRI) (NtrC). The activation of the nac promoter required a higher concentration of NRI approximately P than did the activation of the Escherichia coli glnAp2 promoter, and both the promoter and upstream enhancer element contributed to this difference. The nac promoter had a lower affinity for sigma 54 RNA polymerase than did glnAp2, and uninitiated competitor-resistant transcription complexes formed at the nac promoter decayed to competitor-sensitive complexes at a greater rate than did similar complexes formed at the glnAp2 promoter. The nac enhancer, consisting of a single high-affinity NRI-binding site and an adjacent site with low affinity for NRI, was less efficient in stimulating transcription than was the glnA enhancer, which consists of two adjacent high-affinity NRI-binding sites. When these binding sites were exchanged, transcription from the nac promoter was increased and transcription from the glnAp2 promoter was decreased at low concentrations of NRI approximately P. Another indication of the difference in the efficiency of these enhancers is that although activation of a nac promoter construct containing the glnA enhancer was relatively insensitive to subtle alterations in the position of these sites relative to the position of the promoter, activation of the natural nac promoter or a nac promoter construct containing only a single high-affinity NRI approximately P binding site was strongly affected by subtle alterations in the position of the NRI approximately P binding site(s), indicating a face-of-the-helix dependency for activation.
PMCID: PMC177360  PMID: 7559338
14.  Activation of the Escherichia coli lacZ promoter by the Klebsiella aerogenes nitrogen assimilation control protein (NAC), a LysR family transcription factor. 
Journal of Bacteriology  1995;177(16):4820-4824.
A chimeric promoter with the nitrogen assimilation control protein binding site from hutUp of Klebsiella aerogenes fused to the lacZ core promoter from Escherichia coli was built and cloned in a lacZ reporter plasmid. This construct showed a 14-fold increase of beta-galactosidase activity upon nitrogen limitation. Primer extension experiments showed that the nitrogen assimilation control protein activates lacZp1 in a position-dependent manner.
PMCID: PMC177252  PMID: 7642513
15.  The nitrogen assimilation control protein, NAC, is a DNA binding transcription activator in Klebsiella aerogenes. 
Journal of Bacteriology  1995;177(12):3546-3555.
A 32-kDa polypeptide corresponding to NAC, the product of the Klebsiella aerogenes nac gene, was overexpressed from a plasmid carrying a tac'-'nac operon fusion and purified to near homogeneity by taking advantage of its unusual solubility properties. NAC was able to shift the electrophoretic migration of DNA fragments carrying the NAC-sensitive promoters hutUp, putPp1, and ureDp. The interaction between NAC and hutUp was localized to a 26-bp region centered approximately 64 bp upstream of the hutUp transcription initiation site. Moreover, NAC protected this region from DNase I digestion. Mobility shift and DNase I protection studies utilizing the putP and ureD promoter regions identified NAC-binding regions of sizes and locations similar to those found in hutUp. Comparison of the DNA sequences which were protected from DNase I digestion by NAC suggests a minimal NAC-binding consensus sequence: 5'-ATA-N9-TAT-3'. In vitro transcription assays demonstrated that NAC was capable of activating the transcription of hutUp by sigma 70-RNA polymerase holoenzyme when this promoter was presented as either a linear or supercoiled DNA molecule. Thus, NAC displays the in vitro DNA-binding and transcription activation properties which have been predicted for the product of the nac gene.
PMCID: PMC177061  PMID: 7768865
16.  Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. 
Journal of Bacteriology  1994;176(17):5525-5529.
Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.
Images
PMCID: PMC196741  PMID: 8071231
17.  Roles of catabolite activator protein sites centered at -81.5 and -41.5 in the activation of the Klebsiella aerogenes histidine utilization operon hutUH. 
Journal of Bacteriology  1994;176(17):5513-5524.
The Klebsiella aerogenes hutUH operon is preceded by a promoter region, hut(P), that contains two divergent promoters (hutUp and Pc) which overlap and are alternately expressed. In the absence of the catabolite gene activator protein-cyclic AMP (CAP-cAMP) complex, Pc is predominantly expressed while hutUp is largely repressed. CAP-cAMP has the dual effect of repressing transcription from Pc while simultaneously activating transcription from hutUp. DNA deletion mutations in this region were used to identify DNA sequences required for transcription of these two promoters. We showed that inactivation of Pc by DNA deletion did not result in activation of hutUp in vitro or in vivo. In addition, Escherichia coli CAP mutants that are known to bind and bend DNA normally but are unable to activate various CAP-dependent promoters were also unable to activate hutUp in vivo. These results invalidate an indirect activation model by which CAP-mediated repression of Pc in itself would led to activation of hutUp. Gel retardation asays with various deletion mutations of hut(P) and DNase I protection analyses revealed a high-affinity CAP binding site (CAP site 1) centered at -81.5 relative to the hutUp start of transcription and a second low-affinity CAP site (CAP site 2) centered at about -41.5. CAP site 1 is essential for activation of hutUp. Although CAP site 2 by itself is unable to activate hutUp in vivo under catabolite-activating conditions, it appears to be required for maximal transcription from a site centered at -41.5, does not activate hutUp suggests that the role of CAP-cAMP at the weaker CAP site may be different from that of other promoters containing a similarly positioned site. We propose that CAP directly stimulates the activity of RNA polymerase at hutUp and that this reaction is completely dependent on a naturally occurring CAP site centered at -81.5 and also involves a second CAP site centered at about -41.5 for maximal activation.
Images
PMCID: PMC196740  PMID: 8071230
18.  Activity of a novel quinoxaline derivative against human immunodeficiency virus type 1 reverse transcriptase and viral replication. 
S-2720 [6-chloro-3,3-dimethyl-4-(isopropenyloxycarbonyl)-3,4- dihydroquinoxalin-2(1H)-thione], a quinoxaline derivative, was found to be a very potent inhibitor of both human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) activity and HIV-1 replication in tissue culture. Like other nonnucleoside RT inhibitors, S-2720 does not affect the HIV-2 RT. A S-2720-resistant virus was selected and shown to possess a mutation within the RT-coding region that has not previously been described. Notably, this mutation gives rise to a dramatic decrease in enzyme activity. S-2720, therefore, belongs to a new class of RT inhibitors that bind differently to the RT than other known nonnucleoside RT inhibitors. As no toxic effects were observed with S-2720 in mice, these quinoxaline derivatives deserve further evaluation to prove their potency as possible therapeutic agents for HIV-1 infection.
PMCID: PMC188037  PMID: 7692812
19.  The nac (nitrogen assimilation control) gene from Klebsiella aerogenes. 
Journal of Bacteriology  1993;175(7):2107-2115.
The Klebsiella aerogenes nac gene, whose product is necessary for nitrogen regulation of a number of operons, was identified and its DNA sequence determined. The nac sequence predicted a protein a 305 amino acids with a strong similarity to members of the LysR family of regulatory proteins, especially OxyR from Escherichia coli. Analysis of proteins expressed in minicells showed that nac is a single-gene operon whose product has an apparent molecular weight of about 32 kDa as measured in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Immediately downstream from nac is a two-gene operon, the first gene of which encodes another member of the LysR family. Upstream from nac is a tRNAAsn gene transcribed divergently from nac. About 60 bp upstream from the nac open reading frame lies a sequence nearly identical to the consensus for sigma 54-dependent promoters, with the conserved GG and GC nucleotides at -26 and -14 relative to the start of transcription. About 130 bp farther upstream (at -153 relative to the start of transcription) is a sequence nearly identical to the transcriptional activator NTRC-responsive enhancer consensus. Another weaker NTRC-binding site is located adjacent to this site (at -133 relative to the start of transcription). Thus, we propose that nac is transcribed by RNA polymerase carrying sigma 54 in response to the nitrogen regulatory (NTR) system. A transposon located between the promoter and the nac ORF prevented NTR-mediated expression of nac, supporting this identification of the promoter sequence. The insertion of over 5 kb of transposon DNA between the enhancer and its target promoter had only a weak effect on enhancer-mediated regulation, suggesting that enhancers may be able to act at a considerable distance on the bacterial chromosome.
Images
PMCID: PMC204317  PMID: 8458853
20.  The product of the Klebsiella aerogenes nac (nitrogen assimilation control) gene is sufficient for activation of the hut operons and repression of the gdh operon. 
Journal of Bacteriology  1993;175(7):2116-2124.
In Klebsiella aerogenes, the formation of a large number of enzymes responds to the quality and quantity of the nitrogen source provided in the growth medium, and this regulation requires the action of the nitrogen regulatory (NTR) system in every case known. Nitrogen regulation of several operons requires not only the NTR system, but also NAC, the product of the nac gene, raising the question of whether the role of NAC is to activate operons directly or by modifying the specificity of the NTR system. We isolated an insertion of the transposon Tn5tac1 which puts nac gene expression under the control of the IPTG-inducible tac promoter rather than the nitrogen-responsive nac promoter. When IPTG was present, cells carrying the tac-nac fusion activated NAC-dependent operons and repressed NAC-repressible operons independent of the nitrogen supply and even in the absence of an active NTR system. Thus, NAC is sufficient to regulate operons like hut (encoding histidase) and gdh (encoding glutamate dehydrogenase), confirming the model that the NTR system activates nac expression and NAC activates hut and represses gdh. Activation of urease formation occurred at a lower level of NAC than that required for glutamate dehydrogenase repression, and activation of histidase formation required still more NAC.
PMCID: PMC204320  PMID: 8458854
21.  Surveillance of traumatic occupational fatalities in Alaska--implications for prevention. 
Public Health Reports  1992;107(1):70-74.
Data on occupational injury fatalities in Alaska for the period 1980-85 were complied from workers' compensation claims and death certificates. These data yielded 422 unique cases for the 6-year period, for an average annual fatality rate of 36.3 per 100,000 workers. This rate is 5 times higher than the Bureau of Labor Statistics estimate of 7.6 per 100,000 for the United States during the same period. The four industries with the highest fatality rates were the same for Alaska as for the nation (agriculture-forestry-fishing, construction, mining, and transportation-communication-public utilities). The leading causes of occupational fatalities in Alaska, however, were considerably different than for the United States as a whole. Nationally, motor vehicles and industrial equipment accidents are the leading causes of death. In Alaska, the leading causes of occupational injury mortality are aircraft crashes and drowning. These findings highlight the benefit of local surveillance in planning prevention strategies.
PMCID: PMC1403604  PMID: 1531389
22.  Map position of the glnE gene from Escherichia coli. 
Journal of Bacteriology  1992;174(23):7876-7877.
PMCID: PMC207512  PMID: 1360007
23.  Klebsiella aerogenes catabolite gene activator protein and the gene encoding it (crp). 
Journal of Bacteriology  1991;173(20):6626-6631.
The catabolite gene activator protein from Klebsiella aerogenes (CAPK) and the corresponding protein from Escherichia coli (CAPE) were shown to be nearly identical. Both CAPK and CAPE activated transcription from the CAP-dependent promoters derived from E. coli and K. aerogenes. The crp gene from K. aerogenes (encoding CAP) is tightly linked to rpsL. The nucleotide sequence of crp predicts an amino acid sequence for CAPK that differs in only one position from that of CAPE.
Images
PMCID: PMC209001  PMID: 1655718
24.  In vitro transcription of the histidine utilization (hutUH) operon from Klebsiella aerogenes. 
Journal of Bacteriology  1991;173(1):116-123.
The promoter region preceding the hutUH operon in Klebsiella aerogenes contains two oppositely oriented, overlapping promoters. In the absence of catabolite gene activator protein-cyclic AMP (CAP-cAMP), transcription proceeds primarily from the backward-oriented promoter (Pc), whose function has not yet been determined, and only very weakly from the forward hutUH promoter, hutUp. In the presence of CAP-cAMP, Pc is repressed and transcription from hutUp is favored. Two protein components required for this in vitro transcription system, RNA polymerase (RNAP) and CAP, were purified from K. aerogenes and were shown to be functionally interchangeable with the corresponding proteins from Escherichia coli, suggesting that E. coli RNAP could be used to study some aspects of hut transcription. We showed that a gradual activation of hutUp (by increasing concentrations of CAP, cAMP, or glycerol) resulted in a parallel repression of Pc, arguing in favor of a direct competition between the two promoters. The presence of a DNA sequence resembling the consensus for CAP-binding sites and centered at nucleotide -82 (relative to hutUp) initially suggested that a primary role of CAP was to repress Pc, thereby indirectly activating hutUp. However, the relatively slow formation of open complexes at Pc, even in the absence of CAP-cAMP, showed that Pc is a weak promoter and likely to be a poor competitor for RNAP. The observed dominance of Pc over hutUp suggested that the latter is an even weaker promoter. Thus, repression of Pc would not be sufficient to cause the observed increase in hutUp activity, and the CAP-cAMP complex must play a direct role in the activation of hutUp.
Images
PMCID: PMC207164  PMID: 1846133
25.  Regulation of assimilatory nitrate reductase formation in Klebsiella aerogenes W70. 
Journal of Bacteriology  1990;172(12):7256-7259.
Klebsiella aerogenes W70 could grow aerobically with nitrate or nitrite as the sole nitrogen source. The assimilatory nitrate reductase and nitrite reductase responsible for this ability required the presence of either nitrate or nitrite as an inducer, and both enzymes were repressed by ammonia. The repression by ammonia, which required the NTR (nitrogen regulatory) system (A. Macaluso, E. A. Best, and R. A. Bender, J. Bacteriol. 172:7249-7255, 1990), did not act solely at the level of inducer exclusion, since strains in which the expression of assimilatory nitrate reductase and nitrite reductase was was independent of the inducer were also susceptible to repression by ammonia. Insertion mutations in two distinct genes, neither of which affected the NTR system, resulted in the loss of both assimilatory nitrate reductase and nitrite reductase. One of these mutants reverted to the wild type, but the other yielded pseudorevertants at high frequency that were independent of inducer but still responded to ammonia repression.
PMCID: PMC210850  PMID: 2254283

Results 1-25 (59)