PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (86)
 

Clipboard (0)
None

Select a Filter Below

Year of Publication
more »
1.  The transcriptomic response of Acinetobacter baumannii to colistin and doripenem alone and in combination in an in vitro pharmacokinetics/pharmacodynamics model 
Objectives
Colistin remains a last-line treatment for MDR Acinetobacter baumannii and combined use of colistin and carbapenems has shown synergistic effects against MDR strains. In order to understand the bacterial responses to these antibiotics, we analysed the transcriptome of A. baumannii following exposure to each.
Methods
RNA sequencing was employed to determine changes in the transcriptome following treatment with colistin and doripenem, both alone and in combination, using an in vitro pharmacokinetics (PK)/pharmacodynamics model to mimic the PK of both antibiotics in patients.
Results
After treatment with colistin (continuous infusion at 2 mg/L), >400 differentially regulated genes were identified, including many associated with outer membrane biogenesis, fatty acid metabolism and phospholipid trafficking. No genes were differentially expressed following treatment with doripenem (Cmax 25 mg/L, t1/2 1.5 h) for 15 min, but 45 genes were identified as differentially expressed after 1 h of growth under this condition. Treatment of A. baumannii with both colistin and doripenem together for 1 h resulted in >450 genes being identified as differentially expressed. More than 70% of these gene expression changes were also observed following colistin treatment alone.
Conclusions
These data suggest that colistin causes gross damage to the outer membrane, facilitates lipid exchange between the inner and outer membrane and alters the normal asymmetric outer membrane composition. The transcriptional response to colistin was highly similar to that observed for an LPS-deficient strain, indicating that many of the observed changes are responses to outer membrane instability resulting from LPS loss.
doi:10.1093/jac/dku536
PMCID: PMC4398468  PMID: 25587995
polymyxins; polymyxin resistance; carbapenems
2.  What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira 
PLoS Neglected Tropical Diseases  2016;10(2):e0004403.
Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic) vs. non-infectious Leptospira, this work provides new insights into the evolution of a genus of bacterial pathogens. This work will be a comprehensive roadmap for understanding leptospirosis pathogenesis. More generally, it provides new insights into mechanisms by which bacterial pathogens adapt to mammalian hosts.
Author Summary
Leptospirosis is an emerging and re-emerging globally important zoonotic infectious disease caused by spirochetes of the genus Leptospira. This genus is complex, with members that cause lethal human disease, yet mechanisms that underlie pathogenesis remain obscure. Leptospira species are divided into those that are infectious for mammals, and those that are non-infectious environmental saprophytes. Based on biological characteristics and molecular phylogeny, infectious Leptospira are further divided into pathogenic and intermediately pathogenic members. The pan-genus genomic analysis of 20 Leptospira species reported here shows the evolutionary relationship of the different Leptospira clades, and various genetic factors related to virulence and pathogenesis. Infectious Leptospira show key adaptations to mammals, for example sialic acid biosynthesis, pathogen-specific porphyrin metabolism, and the observation that pathogenic Leptospira are vitamin B12 autotrophs, able to synthesize it from a simple amino acid precursor, L-glutamine. A large novel protein family of unknown function—the Virulence Modifying proteins—is found uniquely in pathogenic Leptospira. Similarly, the CRISPR/Cas system was only found in pathogenic Leptospira. A comparative genomic analysis of a complex bacterial genus allowed us to identify large-scale changes that provides new insights into general processes by which bacteria evolve to become pathogenic.
doi:10.1371/journal.pntd.0004403
PMCID: PMC4758666  PMID: 26890609
3.  The Burkholderia pseudomallei Proteins BapA and BapC Are Secreted TTSS3 Effectors and BapB Levels Modulate Expression of BopE 
PLoS ONE  2015;10(12):e0143916.
Many Gram-negative pathogens use a type III secretion system (TTSS) for the injection of bacterial effector proteins into host cells. The injected effector proteins play direct roles in modulation of host cell pathways for bacterial benefit. Burkholderia pseudomallei, the causative agent of melioidosis, expresses three different TTSSs. One of these systems, the TTSS3, is essential for escape from host endosomes and therefore intracellular survival and replication. Here we have characterized three putative TTSS3 proteins; namely BapA, BapB and BapC. By employing a tetracysteine (TC)-FlAsH™ labelling technique to monitor the secretion of TC-tagged fusion proteins, BapA and BapC were shown to be secreted during in vitro growth in a TTSS3-dependant manner, suggesting a role as TTSS3 effectors. Furthermore, we constructed B. pseudomallei bapA, bapB and bapC mutants and used the well-characterized TTSS3 effector BopE as a marker of secretion to show that BapA, BapB and BapC are not essential for the secretion process. However, BopE transcription and secretion were significantly increased in the bapB mutant, suggesting that BapB levels modulate BopE expression. In a BALB/c mouse model of acute melioidosis, the bapA, bapB and bapC mutants showed a minor reduction of in vivo fitness. Thus, this study defines BapA and BapC as novel TTSS3 effectors, BapB as a regulator of BopE production, and all three as necessary for full B. pseudomallei in vivo fitness.
doi:10.1371/journal.pone.0143916
PMCID: PMC4666416  PMID: 26624293
4.  Burkholderia pseudomallei Type III Secretion System Cluster 3 ATPase BsaS, a Chemotherapeutic Target for Small-Molecule ATPase Inhibitors 
Infection and Immunity  2015;83(4):1276-1285.
Melioidosis is an infectious disease of high mortality for humans and other animal species; it is prevalent in tropical regions worldwide. The pathogenesis of melioidosis depends on the ability of its causative agent, the Gram-negative bacterium Burkholderia pseudomallei, to enter and survive in host cells. B. pseudomallei can escape from the phagosome into the cytosol of phagocytic cells where it replicates and acquires actin-mediated motility, avoiding killing by the autophagy-dependent process, LC3 (microtubule-associated protein light chain 3)-associated phagocytosis (LAP). The type III secretion system cluster 3 (TTSS3) facilitates bacterial escape from phagosomes, although the mechanism has not been fully elucidated. Given the recent identification of small-molecule inhibitors of the TTSS ATPase, we sought to determine the potential of the predicted TTSS3 ATPase, encoded by bsaS, as a target for chemotherapeutic treatment of infection. A B. pseudomallei bsaS deletion mutant was generated and used as a control against which to assess the effect of inhibitor treatment. Infection of RAW 264.7 cells with wild-type bacteria and subsequent treatment with the ATPase inhibitor compound 939 resulted in reduced intracellular bacterial survival, reduced escape from phagosomes, and increased colocalization with both LC3 and the lysosomal marker LAMP1 (lysosome-associated membrane protein 1). These changes were similar to those observed for infection of RAW 264.7 cells with the bsaS deletion mutant. We propose that treatment with the ATPase inhibitor compound 939 decreased intracellular bacterial survival through a reduced ability of bacteria to escape from phagosomes and increased killing via LAP. Therefore, small-molecule inhibitors of the TTSS3 ATPase have potential as therapeutic treatments against melioidosis.
doi:10.1128/IAI.03070-14
PMCID: PMC4363454  PMID: 25605762
5.  Development of a Rapid Multiplex PCR Assay To Genotype Pasteurella multocida Strains by Use of the Lipopolysaccharide Outer Core Biosynthesis Locus 
Journal of Clinical Microbiology  2014;53(2):477-485.
Pasteurella multocida is a Gram-negative bacterial pathogen that is the causative agent of a wide range of diseases in many animal species, including humans. A widely used method for differentiation of P. multocida strains involves the Heddleston serotyping scheme. This scheme was developed in the early 1970s and classifies P. multocida strains into 16 somatic or lipopolysaccharide (LPS) serovars using an agar gel diffusion precipitin test. However, this gel diffusion assay is problematic, with difficulties reported in accuracy, reproducibility, and the sourcing of quality serovar-specific antisera. Using our knowledge of the genetics of LPS biosynthesis in P. multocida, we have developed a multiplex PCR (mPCR) that is able to differentiate strains based on the genetic organization of the LPS outer core biosynthesis loci. The accuracy of the LPS-mPCR was compared with classical Heddleston serotyping using LPS compositional data as the “gold standard.” The LPS-mPCR correctly typed 57 of 58 isolates; Heddleston serotyping was able to correctly and unambiguously type only 20 of the 58 isolates. We conclude that our LPS-mPCR is a highly accurate LPS genotyping method that should replace the Heddleston serotyping scheme for the classification of P. multocida strains.
doi:10.1128/JCM.02824-14
PMCID: PMC4298526  PMID: 25428149
6.  Comparative Genomic Analysis of Asian Haemorrhagic Septicaemia-Associated Strains of Pasteurella multocida Identifies More than 90 Haemorrhagic Septicaemia-Specific Genes 
PLoS ONE  2015;10(7):e0130296.
Pasteurella multocida is the primary causative agent of a range of economically important diseases in animals, including haemorrhagic septicaemia (HS), a rapidly fatal disease of ungulates. There is limited information available on the diversity of P. multocida strains that cause HS. Therefore, we determined draft genome sequences of ten disease-causing isolates and two vaccine strains and compared these genomes using a range of bioinformatic analyses. The draft genomes of the 12 HS strains were between 2,298,035 and 2,410,300 bp in length. Comparison of these genomes with the North American HS strain, M1404, and other available P. multocida genomes (Pm70, 3480, 36950 and HN06) identified a core set of 1,824 genes. A set of 96 genes was present in all HS isolates and vaccine strains examined in this study, but absent from Pm70, 3480, 36950 and HN06. Moreover, 59 genes were shared only by the Asian B:2 strains. In two Pakistani isolates, genes with high similarity to genes in the integrative and conjugative element, ICEPmu1 from strain 36950 were identified along with a range of other antimicrobial resistance genes. Phylogenetic analysis indicated that the HS strains formed clades based on their country of isolation. Future analysis of the 96 genes unique to the HS isolates will aid the identification of HS-specific virulence attributes and facilitate the development of disease-specific diagnostic tests.
doi:10.1371/journal.pone.0130296
PMCID: PMC4495038  PMID: 26151935
7.  Complete Genome Sequence of Leptospira interrogans Serovar Bratislava, Strain PigK151 
Genome Announcements  2015;3(3):e00678-15.
Leptospira interrogans serovar Bratislava infection occurs in multiple domestic and wildlife species and is associated with poor reproductive performance in swine and horses. We present the complete genome assembly of strain PigK151 comprising two chromosomes, CI (4.457 Mbp) and CII (358 kbp).
doi:10.1128/genomeA.00678-15
PMCID: PMC4481285  PMID: 26112787
8.  High-Temperature Protein G Is an Essential Virulence Factor of Leptospira interrogans 
Infection and Immunity  2014;82(3):1123-1131.
Leptospira interrogans is a global zoonotic pathogen and is the causative agent of leptospirosis, an endemic disease of humans and animals worldwide. There is limited understanding of leptospiral pathogenesis; therefore, further elucidation of the mechanisms involved would aid in vaccine development and the prevention of infection. HtpG (high-temperature protein G) is the bacterial homolog to the highly conserved molecular chaperone Hsp90 and is important in the stress responses of many bacteria. The specific role of HtpG, especially in bacterial pathogenesis, remains largely unknown. Through the use of an L. interrogans htpG transposon insertion mutant, this study demonstrates that L. interrogans HtpG is essential for virulence in the hamster model of acute leptospirosis. Complementation of the htpG mutant completely restored virulence. Surprisingly, the htpG mutant did not appear to show sensitivity to heat or oxidative stress, phenotypes common in htpG mutants in other bacterial species. Furthermore, the mutant did not show increased sensitivity to serum complement, reduced survival within macrophages, or altered protein or lipopolysaccharide expression. The underlying cause for attenuation thus remains unknown, but HtpG is a novel leptospiral virulence factor and one of only a very small number identified to date.
doi:10.1128/IAI.01546-13
PMCID: PMC3958012  PMID: 24366253
9.  Role of Acinetobacter baumannii UmuD Homologs in Antibiotic Resistance Acquired through DNA Damage-Induced Mutagenesis 
The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from that of the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene, the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.
doi:10.1128/AAC.02346-13
PMCID: PMC3957856  PMID: 24342640
10.  In silico prediction of Gallibacterium anatis pan-immunogens 
Veterinary Research  2014;45(1):80.
The Gram-negative bacterium Gallibacterium anatis is a major cause of salpingitis and peritonitis in commercial egg-layers, leading to reduced egg production and increased mortality. Unfortunately, widespread multidrug resistance and antigenic diversity makes it difficult to control infections and novel prevention strategies are urgently needed. In this study, a pan-genomic reverse vaccinology (RV) approach was used to identify potential vaccine candidates. Firstly, the genomes of 10 selected Gallibacterium strains were analyzed and proteins selected on the following criteria; predicted surface-exposure or secretion, none or one transmembrane helix (TMH), and presence in six or more of the 10 genomes. In total, 42 proteins were selected. The genes encoding 27 of these proteins were successfully cloned in Escherichia coli and the proteins expressed and purified. To reduce the number of vaccine candidates for in vivo testing, each of the purified recombinant proteins was screened by ELISA for their ability to elicit a significant serological response with serum from chickens that had been infected with G. anatis. Additionally, an in silico prediction of the protective potential was carried out based on a protein property prediction method. Of the 27 proteins, two novel putative immunogens were identified; Gab_1309 and Gab_2312. Moreover, three previously characterized virulence factors; GtxA, FlfA and Gab_2156, were identified. Thus, by combining the pan-genomic RV approach with subsequent in vitro and in silico screening, we have narrowed down the pan-proteome of G. anatis to five vaccine candidates. Importantly, preliminary immunization trials indicated an in vivo protective potential of GtxA-N, FlfA and Gab_1309.
Electronic supplementary material
The online version of this article (doi:10.1186/s13567-014-0080-0) contains supplementary material, which is available to authorized users.
doi:10.1186/s13567-014-0080-0
PMCID: PMC4423631  PMID: 25223320
11.  Biological Cost of Different Mechanisms of Colistin Resistance and Their Impact on Virulence in Acinetobacter baumannii 
Two mechanisms of resistance to colistin have been described in Acinetobacter baumannii. One involves complete loss of lipopolysaccharide (LPS), resulting from mutations in lpxA, lpxC, or lpxD, and the second is associated with phosphoethanolamine addition to LPS, mediated through mutations in pmrAB. In order to assess the clinical impacts of both resistance mechanisms, A. baumannii ATCC 19606 and its isogenic derivatives, AL1851 ΔlpxA, AL1852 ΔlpxD, AL1842 ΔlpxC, and ATCC 19606 pmrB, were analyzed for in vitro growth rate, in vitro and in vivo competitive growth, infection of A549 respiratory alveolar epithelial cells, virulence in the Caenorhabditis elegans model, and virulence in a systemic mouse infection model. The in vitro growth rate of the lpx mutants was clearly diminished; furthermore, in vitro and in vivo competitive-growth experiments revealed a reduction in fitness for both mutant types. Infection of A549 cells with ATCC 19606 or the pmrB mutant resulted in greater loss of viability than with lpx mutants. Finally, the lpx mutants were highly attenuated in both the C. elegans and mouse infection models, while the pmrB mutant was attenuated only in the C. elegans model. In summary, while colistin resistance in A. baumannii confers a clear selective advantage in the presence of colistin treatment, it causes a noticeable cost in terms of overall fitness and virulence, with a more striking reduction associated with LPS loss than with phosphoethanolamine addition. Therefore, we hypothesize that colistin resistance mediated by changes in pmrAB will be more likely to arise in clinical settings in patients treated with colistin.
doi:10.1128/AAC.01597-13
PMCID: PMC3910726  PMID: 24189257
12.  Evolutionary Analysis of Burkholderia pseudomallei Identifies Putative Novel Virulence Genes, Including a Microbial Regulator of Host Cell Autophagy 
Journal of Bacteriology  2013;195(24):5487-5498.
Burkholderia pseudomallei, the causative agent of melioidosis, contains a large pathogen genome (7.2 Mb) with ∼2,000 genes of putative or unknown function. Interactions with potential hosts and environmental factors may induce rapid adaptations in these B. pseudomallei genes, which can be discerned through evolutionary analysis of multiple B. pseudomallei genomes. Here we show that several previously uncharacterized B. pseudomallei genes bearing genetic signatures of rapid adaptation (positive selection) can induce diverse cellular phenotypes when expressed in mammalian cells. Notably, several of these phenotypes are plausibly related to virulence, including multinuclear giant cell formation, apoptosis, and autophagy induction. Specifically, we show that BPSS0180, a type VI cluster-associated gene, is capable of inducing autophagy in both phagocytic and nonphagocytic mammalian cells. Following infection of macrophages, a B. pseudomallei mutant disrupted in BPSS0180 exhibited significantly decreased colocalization with LC3 and impaired intracellular survival; these phenotypes were rescued by introduction of an intact BPSS0180 gene. The results suggest that BPSS0180 may be a novel inducer of host cell autophagy that contributes to B. pseudomallei intracellular growth. More generally, our study highlights the utility of applying evolutionary principles to microbial genomes to identify novel virulence genes.
doi:10.1128/JB.00718-13
PMCID: PMC3889600  PMID: 24097950
13.  Structural and Functional Characterization of an Orphan ATP-Binding Cassette ATPase Involved in Manganese Utilization and Tolerance in Leptospira spp. 
Journal of Bacteriology  2013;195(24):5583-5591.
Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn2+, we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn2+, suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn2+ toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg2+-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.
doi:10.1128/JB.00915-13
PMCID: PMC3889601  PMID: 24123817
14.  Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii 
Journal of Bacteriology  2013;195(24):5577-5582.
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
doi:10.1128/JB.00853-13
PMCID: PMC3889614  PMID: 24123815
15.  Pasteurella multocida Heddleston Serovar 3 and 4 Strains Share a Common Lipopolysaccharide Biosynthesis Locus but Display both Inter- and Intrastrain Lipopolysaccharide Heterogeneity 
Journal of Bacteriology  2013;195(21):4854-4864.
Pasteurella multocida is a Gram-negative multispecies pathogen and the causative agent of fowl cholera, a serious disease of poultry which can present in both acute and chronic forms. The major outer membrane component lipopolysaccharide (LPS) is both an important virulence factor and a major immunogen. Our previous studies determined the LPS structures expressed by different P. multocida strains and revealed that a number of strains belonging to different serovars contain the same LPS biosynthesis locus but express different LPS structures due to mutations within glycosyltransferase genes. In this study, we report the full LPS structure of the serovar 4 type strain, P1662, and reveal that it shares the same LPS outer core biosynthesis locus, L3, with the serovar 3 strains P1059 and Pm70. Using directed mutagenesis, the role of each glycosyltransferase gene in LPS outer core assembly was determined. LPS structural analysis of 23 Australian field isolates that contain the L3 locus revealed that at least six different LPS outer core structures can be produced as a result of mutations within the LPS glycosyltransferase genes. Moreover, some field isolates produce multiple but related LPS glycoforms simultaneously, and three LPS outer core structures are remarkably similar to the globo series of vertebrate glycosphingolipids. Our in-depth analysis showing the genetics and full range of P. multocida lipopolysaccharide structures will facilitate the improvement of typing systems and the prediction of the protective efficacy of vaccines.
doi:10.1128/JB.00779-13
PMCID: PMC3807493  PMID: 23974032
16.  Leptospiral LruA Is Required for Virulence and Modulates an Interaction with Mammalian Apolipoprotein AI 
Infection and Immunity  2013;81(10):3872-3879.
Leptospirosis is a worldwide zoonosis caused by spirochetes of the genus Leptospira. While understanding of pathogenesis remains limited, the development of mutagenesis in Leptospira has provided a powerful tool for identifying novel virulence factors. LruA is a lipoprotein that has been implicated in leptospiral uveitis as a target of the immune response. In this study, two lruA mutants, M754 and M765, generated by transposon mutagenesis from Leptospira interrogans serovar Manilae, were characterized. In M754, the transposon inserted in the middle of lruA, resulting in no detectable expression of LruA. In M765, the transposon inserted toward the 3′ end of the gene, resulting in expression of a truncated protein. LruA was demonstrated to be on the cell surface in M765 and the wild type (WT). M754, but not M765, was attenuated in a hamster model of acute infection. A search for differential binding to human serum proteins identified a serum protein of around 30 kDa bound to the wild type and the LruA deletion mutant (M754), but not to the LruA truncation mutant (M765). Two-dimensional separation of proteins from leptospiral cells incubated with guinea pig serum identified the 28-kDa apolipoprotein A-I (ApoA-I) as a major mammalian serum protein that binds Leptospira in vitro. Interestingly, M754 (with no detectable LruA) bound more ApoA-I than did the LruA-expressing strains Manilae wild type and M765. Our data thus identify LruA as a surface-exposed leptospiral virulence factor that contributes to leptospiral pathogenesis, possibly by modulating cellular interactions with serum protein ApoA-I.
doi:10.1128/IAI.01195-12
PMCID: PMC3811782  PMID: 23918777
17.  Precipitation of Iron on the Surface of Leptospira interrogans Is Associated with Mutation of the Stress Response Metalloprotease HtpX 
Applied and Environmental Microbiology  2013;79(15):4653-4660.
High concentrations of free metal ions in the environment can be detrimental to bacterial survival. However, bacteria utilize strategies, including the activation of stress response pathways and immobilizing chemical elements on their surface, to limit this toxicity. In this study, we characterized LA4131, the HtpX-like M48 metalloprotease from Leptospira interrogans, with a putative role in bacterial stress response and membrane homeostasis. Growth of the la4131 transposon mutant strain (L522) in 360 μM FeSO4 (10-fold the normal in vitro concentration) resulted in the production of an amorphous iron precipitate. Atomic force microscopy and transmission electron microscopy analysis of the strain demonstrated that precipitate production was associated with the generation and release of outer membrane vesicles (OMVs) from the leptospiral surface. Transcriptional studies indicated that inactivation of la4131 resulted in altered expression of a subset of metal toxicity and stress response genes. Combining these findings, this report describes OMV production in response to environmental stressors and associates OMV production with the in vitro activity of an HtpX-like metalloprotease.
doi:10.1128/AEM.01097-13
PMCID: PMC3719529  PMID: 23709510
18.  Leptospiral Outer Membrane Protein LipL41 Is Not Essential for Acute Leptospirosis but Requires a Small Chaperone Protein, Lep, for Stable Expression 
Infection and Immunity  2013;81(8):2768-2776.
Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.
doi:10.1128/IAI.00531-13
PMCID: PMC3719587  PMID: 23690405
19.  The Fimbrial Protein FlfA from Gallibacterium anatis Is a Virulence Factor and Vaccine Candidate 
Infection and Immunity  2013;81(6):1964-1973.
The Gram-negative bacterium Gallibacterium anatis is a major cause of salpingitis and peritonitis in egg-laying chickens, leading to decreased egg production worldwide. Widespread multidrug resistance largely prevents treatment of this organism using traditional antimicrobial agents, while antigenic diversity hampers disease prevention by classical vaccines. Thus, insight into its pathogenesis and knowledge about important virulence factors is urgently required. A key event during the colonization and invasion of mucosal surfaces is adherence, and recently, at least three F17-like fimbrial gene clusters were identified in the genomes of several G. anatis strains. The objective of this study was to characterize the putative F17-like fimbrial subunit protein FlfA from G. anatis 12656-12 and determine its importance for virulence. In vitro expression and surface exposure of FlfA was demonstrated by flow cytometry and immunofluorescence microscopy. The predicted function of FlfA as a fimbrial subunit protein was confirmed by immunogold electron microscopy. An flfA deletion mutant (ΔflfA) was generated in G. anatis 12656-12, and importantly, this mutant was significantly attenuated in the natural chicken host. Furthermore, protection against G. anatis 12656-12 could be induced by immunizing chickens with recombinant FlfA. Finally, in vitro expression of FlfA homologs was observed in a genetically diverse set of G. anatis strains, suggesting the potential of FlfA as a serotype-independent vaccine candidate This is the first study describing a fimbrial subunit protein of G. anatis with a clear potential as a vaccine antigen.
doi:10.1128/IAI.00059-13
PMCID: PMC3676021  PMID: 23509151
20.  Cell surface hydrophobicity of colistin-susceptible versus -resistant Acinetobacter baumannii determined by contact angles: methodological considerations and implications 
Journal of applied microbiology  2012;113(4):940-951.
AIMS
Contact angle analysis of cell surface hydrophobicity (CSH) describes the tendency of a water droplet to spread across a lawn of filtered bacterial cells. Colistin-induced disruption of the Gram-negative outer membrane necessitates hydrophobic contacts with lipopolysaccharide (LPS). We aimed to characterize the CSH of Acinetobacter baumannii using contact angles, to provide insight into the mechanism of colistin resistance.
METHODS AND RESULTS
Contact angles were analysed for five paired colistin-susceptible and -resistant A. baumannii strains. Drainage of the water droplet through bacterial layers was demonstrated to influence results. Consequently, measurements were performed 0.66-sec after droplet deposition. Colistin-resistant cells exhibited lower contact angles (38.8±2.8° to 46.8±1.3°) compared to their paired-susceptible strains (40.7±3.0° to 48.0±1.4°; ANOVA; p<0.05). Contact angles increased at stationary phase (50.3±2.9° to 61.5±2.5° and 47.4±2.0° to 50.8±3.2°, susceptible and resistant, respectively, ANOVA; p<0.05), and in response to colistin 32-mgL−1 exposure (44.5±1.5° to 50.6±2.8° and 43.5±2.2° to 48.0±2.2°, susceptible and resistant, respectively; ANOVA; p<0.05). Analysis of complemented strains constructed with an intact lpxA gene, or empty vector, highlighted the contribution of LPS to CSH.
CONCLUSIONS
Compositional outer-membrane variations likely account for CSH differences between A. baumannii phenotypes, which influence the hydrophobic colistin-bacterium interaction.
SIGNIFICANCE AND IMPACT OF STUDY
Important insight into the mechanism of colistin resistance has been provided. Greater consideration of contact angle mehodology is nescessary to ensure accurate analyses are performed.
doi:10.1111/j.1365-2672.2012.05337.x
PMCID: PMC3434258  PMID: 22574702
Antimicrobials; Lipopolysaccharide; Mechanism of Action
21.  Lipopolysaccharide-Deficient Acinetobacter baumannii Shows Altered Signaling through Host Toll-Like Receptors and Increased Susceptibility to the Host Antimicrobial Peptide LL-37 
Infection and Immunity  2013;81(3):684-689.
Infections caused by multidrug-resistant Acinetobacter baumannii have emerged as a serious global health problem. We have shown previously that A. baumannii can become resistant to the last-line antibiotic colistin via the loss of lipopolysaccharide (LPS), including the lipid A anchor, from the outer membrane (J. H. Moffatt, M. Harper, P. Harrison, J. D. Hale, E. Vinogradov, T. Seemann, R. Henry, B. Crane, F. St. Michael, A. D. Cox, B. Adler, R. L. Nation, J. Li, and J. D. Boyce, Antimicrob. Agents Chemother. 54:4971–4977, 2010). Here, we show how these LPS-deficient bacteria interact with components of the host innate immune system. LPS-deficient A. baumannii stimulated 2- to 4-fold lower levels of NF-κB activation and tumor necrosis factor alpha (TNF-α) secretion from immortalized murine macrophages, but it still elicited low levels of TNF-α secretion via a Toll-like receptor 2-dependent mechanism. Furthermore, we show that while LPS-deficient A. baumannii was not altered in its resistance to human serum, it showed increased susceptibility to the human antimicrobial peptide LL-37. Thus, LPS-deficient, colistin-resistant A. baumannii shows significantly altered activation of the host innate immune inflammatory response.
doi:10.1128/IAI.01362-12
PMCID: PMC3584870  PMID: 23250952
22.  Mechanical signals as anabolic agents in bone 
Nature reviews. Rheumatology  2010;6(1):50-59.
Aging and a sedentary lifestyle conspire to reduce bone quantity and quality, decrease muscle mass and strength, and undermine postural stability, culminating in an elevated risk of skeletal fracture. Concurrently, a marked reduction in the available bone-marrow-derived population of mesenchymal stem cells (MSCs) jeopardizes the regenerative potential that is critical to recovery from musculoskeletal injury and disease. A potential way to combat the deterioration involves harnessing the sensitivity of bone to mechanical signals, which is crucial in defining, maintaining and recovering bone mass. To effectively utilize mechanical signals in the clinic as a non-drug-based intervention for osteoporosis, it is essential to identify the components of the mechanical challenge that are critical to the anabolic process. Large, intense challenges to the skeleton are generally presumed to be the most osteogenic, but brief exposure to mechanical signals of high frequency and extremely low intensity, several orders of magnitude below those that arise during strenuous activity, have been shown to provide a significant anabolic stimulus to bone. Along with positively influencing osteoblast and osteocyte activity, these low-magnitude mechanical signals bias MSC differentiation towards osteoblastogenesis and away from adipogenesis. Mechanical targeting of the bone marrow stem-cell pool might, therefore, represent a novel, drug-free means of slowing the age-related decline of the musculoskeletal system.
doi:10.1038/nrrheum.2009.239
PMCID: PMC3743048  PMID: 20046206
23.  Beclin 1 Is Required for Starvation-Enhanced, but Not Rapamycin-Enhanced, LC3-Associated Phagocytosis of Burkholderia pseudomallei in RAW 264.7 Cells 
Infection and Immunity  2013;81(1):271-277.
LC3-associated phagocytosis (LAP) of Burkholderia pseudomallei by murine macrophage (RAW 264.7) cells is an intracellular innate defense mechanism. Beclin 1, a protein with several roles in autophagic processes, is known to be recruited to phagosomal membranes as a very early event in LAP. We sought to determine whether knockdown of Beclin 1 by small interfering RNA (siRNA) would affect recruitment of LC3 and subsequent LAP of infecting B. pseudomallei. Both starvation and rapamycin treatment can induce Beclin 1-dependent autophagy. Therefore, we analyzed the consequences of Beclin 1 knockdown for LAP in infected cells that had been either starved or treated with rapamycin by determining the levels of bacterial colocalization with LC3 and intracellular survival. Concurrently, we confirmed the location of bacteria as either contained in phagosomes or free in the cytoplasm. We found that both rapamycin and starvation treatment enhanced LAP of B. pseudomallei but that the rapamycin response is Beclin 1 independent whereas the starvation response is Beclin 1 dependent.
doi:10.1128/IAI.00834-12
PMCID: PMC3536138  PMID: 23115045
24.  Leptospira interrogans Catalase Is Required for Resistance to H2O2 and for Virulence 
Infection and Immunity  2012;80(11):3892-3899.
Pathogenic Leptospira spp. are likely to encounter higher concentrations of reactive oxygen species induced by the host innate immune response. In this study, we characterized Leptospira interrogans catalase (KatE), the only annotated catalase found within pathogenic Leptospira species, by assessing its role in resistance to H2O2-induced oxidative stress and during infection in hamsters. Pathogenic L. interrogans bacteria had a 50-fold-higher survival rate under H2O2-induced oxidative stress than did saprophytic L. biflexa bacteria, and this was predominantly catalase dependent. We also characterized KatE, the only annotated catalase found within pathogenic Leptospira species. Catalase assays performed with recombinant KatE confirmed specific catalase activity, while protein fractionation experiments localized KatE to the bacterial periplasmic space. The insertional inactivation of katE in pathogenic Leptospira bacteria drastically diminished leptospiral viability in the presence of extracellular H2O2 and reduced virulence in an acute-infection model. Combined, these results suggest that L. interrogans KatE confers in vivo resistance to reactive oxygen species induced by the host innate immune response.
doi:10.1128/IAI.00466-12
PMCID: PMC3486042  PMID: 22927050
25.  Application of protein purification methods for the enrichment of a cytotoxin from Campylobacter jejuni 
BMC Microbiology  2012;12:303.
Background
Campylobater jejuni, a major foodborne diarrhoeal pathogen is reported to produce a number of cytotoxins of which only a cytolethal distending toxin (CDT) has been characterised so far. One or more additional cytotoxins other than CDT, including a Chinese hamster ovary (CHO) cell active, Vero cell inactive cytotoxin, may mediate inflammatory diarrhoea. Our objective was to develop a method to enrich and thus partially characterise this cytotoxin, as a pathway to the eventual identification and characterisation of the toxin.
Results
A number of biochemical methods including cation- and anion-exchange chromatography were evaluated to enrich the cytotoxin from a cell lysate of a known cytotoxin-producing C. jejuni, C31. The cytotoxin in crude lysate was initially prepared by size-exclusion desalting and then subjected to high pressure liquid chromatography (HPLC) ion-exchange fractionation. One pooled fraction (pool B) was cytotoxic for CHO cells equivalent to crude toxin (tissue culture infectivity dose 50 [TCID50] of 1–2 μg/ml). The proteins of pool B were identified by mass spectrometry (MS) after separation by SDS-PAGE and trypsin digestion. Also, pool B was directly digested with trypsin and then subjected to liquid chromatography tandem mass spectrometry (LCMS) analysis for identification of lesser abundant proteins in the fraction. A total of 41 proteins were found in the fraction, which included enzymes involved in metabolic and transport functions. Eighteen non-cytoplasmic proteins including 2 major antigenic peptide proteins (PEB2 and PEB3) and 3 proteins of unknown function were also identified in the screen. Cytotoxicity in pool B was trypsin-sensitive indicating its protein nature. The cytotoxic activity was heat-stable to 50°C, and partially inactivated at 60-70°C. The pool B fraction also induced fluid accumulation in the adult rabbit ileal loop assay with cytotoxicity for mucosa confirming the presence of the cytotoxin.
Conclusions
We report the enrichment and partial purification of C. jejuni cytotoxin by HPLC ion-exchange chromatography. Further purification may be achieved using additional complementary chromatographic techniques. A short-list of six candidate cytotoxin proteins was identified using an LCMS screen of pool B. Successful isolation of the cytotoxin will initiate steps for the determination of the role of this cytotoxin in the pathogenesis of C. jejuni diarrhoea.
doi:10.1186/1471-2180-12-303
PMCID: PMC3541203  PMID: 23259594
C. jejuni; Cytotoxin; Biochemical methods; HPLC ion-exchange chromatography

Results 1-25 (86)