PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (1295785)

Clipboard (0)
None

Related Articles

1.  Hedgehog Signaling Regulates MyoD Expression and Activity* 
The Journal of Biological Chemistry  2012;288(6):4389-4404.
Background: Hedgehog (Hh) signaling regulates skeletal myogenesis; however, the molecular mechanisms involved are not fully understood.
Results: Gli2, a transactivator of Hh signaling, associates with MyoD gene elements, regulating MyoD expression, and binds to MyoD protein, regulating its ability to induce myogenesis.
Conclusion: Hh signaling is linked to MyoD gene expression and MyoD protein function.
Significance: Novel mechanistic insight is gained into the Hh-regulated myogenesis.
The inhibition of MyoD expression is important for obtaining muscle progenitors that can replenish the satellite cell niche during muscle repair. Progenitors could be derived from either embryonic stem cells or satellite cells. Hedgehog (Hh) signaling is important for MyoD expression during embryogenesis and adult muscle regeneration. To date, the mechanistic understanding of MyoD regulation by Hh signaling is unclear. Here, we demonstrate that the Hh effector, Gli2, regulates MyoD expression and associates with MyoD gene elements. Gain- and loss-of-function experiments in pluripotent P19 cells show that Gli2 activity is sufficient and required for efficient MyoD expression during skeletal myogenesis. Inhibition of Hh signaling reduces MyoD expression during satellite cell activation in vitro. In addition to regulating MyoD expression, Hh signaling regulates MyoD transcriptional activity, and MyoD activates Hh signaling in myogenic conversion assays. Finally, Gli2, MyoD, and MEF2C form a protein complex, which enhances MyoD activity on skeletal muscle-related promoters. We therefore link Hh signaling to the function and expression of MyoD protein during myogenesis in stem cells.
doi:10.1074/jbc.M112.400184
PMCID: PMC3567689  PMID: 23266826
Development; Embryonic Stem Cell; Gene Expression; Myogenesis; Skeletal Muscle; Transcription; Gli; Hedgehog Signaling; MEF2; MyoD
2.  p57Kip2 Stabilizes the MyoD Protein by Inhibiting Cyclin E-Cdk2 Kinase Activity in Growing Myoblasts 
Molecular and Cellular Biology  1999;19(11):7621-7629.
We show that expression of p57Kip2, a potent tight-binding inhibitor of several G1 cyclin–cyclin-dependent kinase (Cdk) complexes, increases markedly during C2C12 myoblast differentiation. We examined the effect of p57Kip2 on the activity of the transcription factor MyoD. In transient transfection assays, transcriptional transactivation of the mouse muscle creatine kinase promoter by MyoD was enhanced by the Cdk inhibitors. In addition, p57Kip2, p21Cip1, and p27Kip1 but not p16Ink4a induced an increased level of MyoD protein, and we show that MyoD, an unstable nuclear protein, was stabilized by p57Kip2. Forced expression of p57Kip2 correlated with hypophosphorylation of MyoD in C2C12 myoblasts. A dominant-negative Cdk2 mutant arrested cells at the G1 phase transition and induced hypophosphorylation of MyoD. Furthermore, phosphorylation of MyoD by purified cyclin E-Cdk2 complexes was inhibited by p57Kip2. In addition, the NH2 domain of p57Kip2 necessary for inhibition of cyclin E-Cdk2 activity was sufficient to inhibit MyoD phosphorylation and to stabilize it, leading to its accumulation in proliferative myoblasts. Taken together, our data suggest that repression of cyclin E-Cdk2-mediated phosphorylation of MyoD by p57Kip2 could play an important role in the accumulation of MyoD at the onset of myoblast differentiation.
PMCID: PMC84790  PMID: 10523650
3.  The role of MyoD1 and histone modifications in the activation of muscle enhancers 
Epigenetics  2013;8(8):778-784.
MyoD1 is a key regulator that orchestrates skeletal muscle differentiation through the regulation of gene expression. Although many studies have focused on its role in transcriptional control at gene promoters, less is known regarding the role of MyoD1 in the assembly of active enhancers. Here, we discuss novel data that point to the ability of MyoD1 to mediate the assembly of active enhancers that augment the transcription of genes essential for muscle development and lineage specification. Based on genome-wide studies of epigenetic marks that typify active enhancers, we recently identified the compendium of distal regulatory elements that dictate transcriptional programs during myogenesis. Superimposition of MyoD1 binding sites upon the locations of muscle enhancers revealed its unequivocal binding to a core region of nearly a third of condition-specific muscle enhancers. Further studies exploring deposition of enhancer-related epigenetic marks in myoblasts lacking MyoD1 demonstrate the dependence of muscle enhancer assembly on the presence of MyoD1. We propose a model wherein MyoD1 mediates recruitment of Set7, H3K4me1, H3K27ac, p300, and RNAP II to MyoD1-bound enhancers to establish condition-specific activation of muscle genes. Moreover, muscle enhancers are modulated through coordinated binding of transcription factors, including c-Jun, Jdp2, Meis, and Runx1, which are recruited to muscle enhancers in a MyoD1-dependent manner. Thus, MyoD1 and enhancer-associated transcription factors function coordinately to assemble and regulate enhancers, thereby augmenting expression of muscle-related genes.
doi:10.4161/epi.25441
PMCID: PMC3883780  PMID: 23880568
muscle enhancers; transcriptional enhancers; ChIP-seq; skeletal muscle; differentiation; transcription; MyoD1; myogenesis
4.  DNA damage-activated ABL-MyoD signaling contributes to DNA repair in skeletal myoblasts 
Cell Death and Differentiation  2013;20(12):1664-1674.
Previous works have established a unique function of MyoD in the control of muscle gene expression during DNA damage response in myoblasts. Phosphorylation by DNA damage-activated ABL tyrosine kinase transiently inhibits MyoD-dependent activation of transcription in response to genotoxic stress. We show here that ABL-MyoD signaling is also an essential component of the DNA repair machinery in myoblasts exposed to genotoxic stress. DNA damage promoted the recruitment of MyoD to phosphorylated Nbs1 (pNbs1)-containing repair foci, and this effect was abrogated by either ABL knockdown or the ABL kinase inhibitor imatinib. Upon DNA damage, MyoD and pNbs1 were detected on the chromatin to MyoD target genes without activating transcription. DNA damage-mediated tyrosine phosphorylation was required for MyoD recruitment to target genes, as the ABL phosphorylation-resistant MyoD mutant (MyoD Y30F) failed to bind the chromatin following DNA damage, while retaining the ability to activate transcription in response to differentiation signals. Moreover, MyoD Y30F exhibited an impaired ability to promote repair in a heterologous system, as compared with MyoD wild type (WT). Consistently, MyoD-null satellite cells (SCs) displayed impaired DNA repair that was rescued by reintroduction of MyoD WT but not by MyoD Y30F. In addition, inhibition of ABL kinase prevented MyoD WT-mediated rescue of DNA repair in MyoD-null SCs. These results identify an unprecedented contribution of MyoD to DNA repair and suggest that ABL-MyoD signaling coordinates DNA repair and transcription in myoblasts.
doi:10.1038/cdd.2013.118
PMCID: PMC3824587  PMID: 24056763
MyoD; ABL; DNA damage; chromatin; DNA repair
5.  Mos activates myogenic differentiation by promoting heterodimerization of MyoD and E12 proteins. 
Molecular and Cellular Biology  1997;17(2):584-593.
The activities of myogenic basic helix-loop-helix (bHLH) factors are regulated by a number of different positive and negative signals. Extensive information has been published about the molecular mechanisms that interfere with the process of myogenic differentiation, but little is known about the positive signals. We previously showed that overexpression of rat Mos in C2C12 myoblasts increased the expression of myogenic markers whereas repression of Mos products by antisense RNAs inhibited myogenic differentiation. In the present work, our results show that the rat mos proto-oncogene activates transcriptional activity of MyoD protein. In transient transfection assays, Mos promotes transcriptional transactivation by MyoD of the muscle creatine kinase enhancer and/or a reporter gene linked to MyoD-DNA binding sites. Physical interaction between Mos and MyoD, but not with E12, is demonstrated in vivo by using the two-hybrid approach with C3H10T1/2 cells and in vitro by using the glutathione S-transferase (GST) pull-down assays. Unphosphorylated MyoD from myogenic cell lysates and/or bacterially expressed MyoD physically interacts with Mos. This interaction occurs via the helix 2 region of MyoD and a highly conserved region in Mos proteins with 40% similarity to the helix 2 domain of the E-protein class of bHLH factors. Phosphorylation of MyoD by activated GST-Mos protein inhibits the DNA-binding activity of MyoD homodimers and promotes MyoD-E12 heterodimer formation. These data support a novel function for Mos as a mediator (coregulator) of muscle-specific gene(s) expression.
PMCID: PMC231783  PMID: 9001211
6.  Retinoic acid induces myogenin synthesis and myogenic differentiation in the rat rhabdomyosarcoma cell line BA-Han-1C 
The Journal of Cell Biology  1992;118(4):877-887.
Two clonal rat rhabdomyosarcoma cell lines BA-Han-1B and BA-Han-1C with different capacities for myogenic differentiation have been examined for the expression of muscle regulatory basic helix-loop-helix (bHLH) proteins of the MyoD family. Whereas cells of the BA-Han-1C subpopulation constitutively expressed MyoD1 and could be induced to differentiate with retinoic acid (RA), BA-Han-1B cells did not express any of the myogenic control factors and appeared to be largely differentiation-defective. Upon induction with RA, BA-Han-1C cells expressed also myogenin, in contrast to BA-Han-1B cells which never activated any of the genes encoding muscle bHLH factors. The onset of myogenin transcription in BA-Han-1C cells required de novo protein synthesis and DNA replication suggesting that RA probably did not act directly on the myogenin gene. Although MyoD1 was expressed in proliferating BA-Han-1C myoblasts, muscle-specific reporter genes were not activated indicating that MyoD was biologically inactive. However, transfections with plasmid expressing additional MyoD1 protein resulted in the transactivation of muscle genes even in the absence of RA. mRNA encoding the negative regulatory HLH protein Id was expressed in proliferating BA-Han-1C cells and disappeared later after RA induction which suggested that it may be involved in the regulation of MyoD1 activity. The myogenic differentiation of malignant rhabdomyosarcoma cells strictly correlated with the activation of the myogenin gene. In fact, stable transfections of BA-Han-1C cells with myogenin expressing plasmids resulted in spontaneous differentiation. Together, our results suggest that the transformed and undifferentiated phenotype of BA-Han- 1C rhabdomyosarcoma cells is associated with the inactivation of the myogenic factor MyoD1 as well as lack of myogenin expression. RA alleviates the inhibition of myogenic differentiation, probably by activating MyoD protein and myogenin gene transcription. BA-Han-1B cells did not respond to RA and the differentiated phenotype could not be restored by overexpression of MyoD1 or myogenin.
PMCID: PMC2289575  PMID: 1323566
7.  Characterization of Muscle-Regulatory Gene, MyoD, from Flounder (Paralichthys olivaceus) and Analysis of Its Expression Patterns During Embryogenesis 
Specification and differentiation of skeletal muscle cells are driven by the activity of genes encoding members of the myogenic regulatory factors (MRFs). In vertebrates, the MRF family includes MyoD, Myf5, myogenin, and MRF4. The MRFs are capable of converting a variety of nonmuscle cells into myoblasts and myotubes. To better understand their roles in fish muscle development, we isolated the MyoD gene from flounder (Paralichthys olivaceus) and analyzed its structure and patterns of expression. Sequence analysis showed that flounder MyoD shared a structure similar to that of vertebrate MRFs with three exons and two introns, and its protein contained a highly conserved basic helix–loop–helix domain (bHLH). Comparison of sequences revealed that flounder MyoD was highly conserved with other fish MyoD genes. Sequence alignment and phylogenetic analysis indicated that flounder MyoD, seabream (Sparus aurata) MyoD1, takifugu (Takifugu rubripes) MyoD, and tilapia (Oreochromis aureus) MyoD were more likely to be homologous genes. Flounder MyoD expression was first detected as two rows of presomitic cells in the segmental plate. From somitogenesis, MyoD transcripts were present in the adaxial cells that give rise to slow muscles and the lateral somitic cells that give rise to fast muscles. After 30 somites formed, MyoD expression decreased in the somites except the caudal somites, coincident with somite maturation. In the hatching stage, MyoD was expressed in other muscle cells and caudal somites. It was detected only in muscle in the growing fish.
doi:10.1007/s10126-005-5042-0
PMCID: PMC4271811  PMID: 16362809
flounder; muscle; MyoD; myogenesis; somites
8.  p27Kip1 Acts Downstream of N-Cadherin-mediated Cell Adhesion to Promote Myogenesis beyond Cell Cycle RegulationD⃞ 
Molecular Biology of the Cell  2005;16(3):1469-1480.
It is widely acknowledged that cultured myoblasts can not differentiate at very low density. Here we analyzed the mechanism through which cell density influences myogenic differentiation in vitro. By comparing the behavior of C2C12 myoblasts at opposite cell densities, we found that, when cells are sparse, failure to undergo terminal differentiation is independent from cell cycle control and reflects the lack of p27Kip1 and MyoD in proliferating myoblasts. We show that inhibition of p27Kip1 expression impairs C2C12 cell differentiation at high density, while exogenous p27Kip1 allows low-density cultured C2C12 cells to enter the differentiative program by regulating MyoD levels in undifferentiated myoblasts. We also demonstrate that the early induction of p27Kip1 is a critical step of the N-cadherin-dependent signaling involved in myogenesis. Overall, our data support an active role of p27Kip1 in the decision of myoblasts to commit to terminal differentiation, distinct from the regulation of cell proliferation, and identify a pathway that, reasonably, operates in vivo during myogenesis and might be part of the phenomenon known as “community effect”.
doi:10.1091/mbc.E04-07-0612
PMCID: PMC551508  PMID: 15647380
9.  Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors. 
Nucleic Acids Research  1994;22(4):583-591.
Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.
Images
PMCID: PMC307847  PMID: 8127707
10.  Exogenous expression of a dominant negative RORalpha1 vector in muscle cells impairs differentiation: RORalpha1 directly interacts with p300 and myoD. 
Nucleic Acids Research  1999;27(2):411-420.
ROR/RZR is an orphan nuclear receptor that has no known ligand in the 'classical sense'. In the present study we demonstrate that RORalpha is constitutively expressed during the differentiation of proliferating myoblasts to post-mitotic multinucleated myotubes, that have acquired a contractile phenotype. Exogenous expression of dominant negative RORalpha1DeltaE mRNA in myogenic cells significantly reduces the endogenous expression of RORalpha1 mRNA, represses the accumu-lation and delays the activation of mRNAs encoding MyoD and myogenin [the muscle-specific basic helix-loop-helix (bHLH) proteins] and p21(Waf-1/Cip-1) (a cdk inhibitor). Immunohistochemistry demonstrates that morpho-logical differentiation is delayed in cells expressing the RORDeltaE transcript. Furthermore, the size and development of mutlinucleated myotubes is impaired. The E region of RORalpha1 interacts with p300, a cofactor that functions as a coactivator in nuclear receptor and MyoD-mediated transactivation. Consistent with the functional role of RORalpha1 in myogenesis, we observed that RORalpha1 directly interacts with the bHLH protein MyoD. This interaction was mediated by the N-terminal activation domain of the bHLH protein, MyoD, and the RORalpha1 DNA binding domain/C region. Furthermore, we demonstrated that p300, RORalpha1 and MyoD interact in a non-competitive manner. In conclusion, this study provides evidence for a biological role and positive influence of RORalpha1 in the cascade of events involved in the activation of myogenic-specific markers and cell cycle regulators and suggests that crosstalk between theretinoid-relatedorphan (ROR) nuclear receptors and the myogenic bHLH proteins has functional consequences for differentiation.
PMCID: PMC148194  PMID: 9862959
11.  Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD. 
Molecular and Cellular Biology  1997;17(8):4750-4760.
The muscle LIM protein (MLP) is a muscle-specific LIM-only factor that exhibits a dual subcellular localization, being present in both the nucleus and in the cytoplasm. Overexpression of MLP in C2C12 myoblasts enhances skeletal myogenesis, whereas inhibition of MLP activity blocks terminal differentiation. Thus, MLP functions as a positive developmental regulator, although the mechanism through which MLP promotes terminal differentiation events remains unknown. While examining the distinct roles associated with the nuclear and cytoplasmic forms of MLP, we found that nuclear MLP functions through a physical interaction with the muscle basic helix-loop-helix (bHLH) transcription factors MyoD, MRF4, and myogenin. This interaction is highly specific since MLP does not associate with nonmuscle bHLH proteins E12 or E47 or with the myocyte enhancer factor-2 (MEF2) protein, which acts cooperatively with the myogenic bHLH proteins to promote myogenesis. The first LIM motif in MLP and the highly conserved bHLH region of MyoD are responsible for mediating the association between these muscle-specific factors. MLP also interacts with MyoD-E47 heterodimers, leading to an increase in the DNA-binding activity associated with this active bHLH complex. Although MLP lacks a functional transcription activation domain, we propose that it serves as a cofactor for the myogenic bHLH proteins by increasing their interaction with specific DNA regulatory elements. Thus, the functional complex of MLP-MyoD-E protein reveals a novel mechanism for both initiating and maintaining the myogenic program and suggests a global strategy for how LIM-only proteins may control a variety of developmental pathways.
PMCID: PMC232327  PMID: 9234731
12.  Heterodimers of myogenic helix-loop-helix regulatory factors and E12 bind a complex element governing myogenic induction of the avian cardiac alpha-actin promoter. 
Molecular and Cellular Biology  1991;11(5):2439-2450.
Recent studies have shown that two genes regulating myogenesis (MyoD and myogenin) are coexpressed with cardiac alpha-actin during early stages of skeletal muscle development. Myogenin and MyoD are members of a family of regulatory proteins which share a helix-loop-helix (HLH) motif required for dimerization and DNA binding. Myogenin and MyoD form heterodimers with the ubiquitous HLH protein E12 which bind cis-acting DNA elements that have an E box (CANNTG) at their core. E boxes are present in the control regions of numerous muscle-specific genes, although their functional importance in regulating many of these genes has not yet been evaluated. In this report we examine the possibility that myogenin (or MyoD) directly transactivates the cardiac alpha-actin promoter. Heterodimers of myogenin and E12 (or MyoD and E12) specifically bound a restriction fragment extending from -200 to -103 relative to the start of cardiac alpha-actin transcription. Methylation interference footprints pinpointed the site of interaction to an E box immediately adjacent to a previously identified CArG box (CArG3). Site-directed mutations to the DNA-binding site revealed that either an intact E box or an intact CArG3 is required for induction of the cardiac alpha-actin promoter in myoblasts and for transactivation by myogenin in cotransfected fibroblasts. However, deletion and substitution experiments indicate that the complex E box/CArG3 element alone does not confer muscle-specific expression to a minimal promoter. These results suggest that direct and indirect pathways involving multiple cis-acting elements mediate the induction of the cardiac alpha-actin promoter by myogenin and MyoD.
Images
PMCID: PMC360005  PMID: 1850096
13.  RhoA GTPase and Serum Response Factor Control Selectively the Expression of MyoD without Affecting Myf5 in Mouse Myoblasts 
Molecular Biology of the Cell  1998;9(7):1891-1902.
MyoD and Myf5 belong to the family of basic helix-loop-helix transcription factors that are key operators in skeletal muscle differentiation. MyoD and Myf5 genes are selectively activated during development in a time and region-specific manner and in response to different stimuli. However, molecules that specifically regulate the expression of these two genes and the pathways involved remain to be determined. We have recently shown that the serum response factor (SRF), a transcription factor involved in activation of both mitogenic response and muscle differentiation, is required for MyoD gene expression. We have investigated here whether SRF is also involved in the control of Myf5 gene expression, and the potential role of upstream regulators of SRF activity, the Rho family G-proteins including Rho, Rac, and CDC42, in the regulation of MyoD and Myf5. We show that inactivation of SRF does not alter Myf5 gene expression, whereas it causes a rapid extinction of MyoD gene expression. Furthermore, we show that RhoA, but not Rac or CDC42, is also required for the expression of MyoD. Indeed, blocking the activity of G-proteins using the general inhibitor lovastatin, or more specific antagonists of Rho proteins such as C3-transferase or dominant negative RhoA protein, resulted in a dramatic decrease of MyoD protein levels and promoter activity without any effects on Myf5 expression. We further show that RhoA-dependent transcriptional activation required functional SRF in C2 muscle cells. These data illustrate that MyoD and Myf5 are regulated by different upstream activation pathways in which MyoD expression is specifically modulated by a RhoA/SRF signaling cascade. In addition, our results establish the first link between RhoA protein activity and the expression of a key muscle regulator.
PMCID: PMC25431  PMID: 9658178
14.  Six1 Regulates MyoD Expression in Adult Muscle Progenitor Cells 
PLoS ONE  2013;8(6):e67762.
Quiescent satellite cells are myogenic progenitors that enable regeneration of skeletal muscle. One of the early events of satellite cell activation following myotrauma is the induction of the myogenic regulatory factor MyoD, which eventually induces terminal differentiation and muscle function gene expression. The purpose of this study was to elucidate the mechanism by which MyoD is induced during activation of satellite cells in mouse muscle undergoing regeneration. We show that Six1, a transcription factor essential for embryonic myogenesis, also regulates MyoD expression in muscle progenitor cells. Six1 knock-down by RNA interference leads to decreased expression of MyoD in myoblasts. Chromatin immunoprecipitation assays reveal that Six1 binds the Core Enhancer Region of MyoD. Further, transcriptional reporter assays demonstrate that Core Enhancer Region reporter gene activity in myoblasts and in regenerating muscle depends on the expression of Six1 and on Six1 binding sites. Finally, we provide evidence indicating that Six1 is required for the proper chromatin structure at the Core Enhancer Region, as well as for MyoD binding at its own enhancer. Together, our results reveal that MyoD expression in satellite cells depends on Six1, supporting the idea that Six1 plays an important role in adult myogenesis, in addition to its role in embryonic muscle formation.
doi:10.1371/journal.pone.0067762
PMCID: PMC3695946  PMID: 23840772
15.  Epigenotype-phenotype correlations in Beckwith-Wiedemann syndrome 
Journal of Medical Genetics  2000;37(12):921-926.
Beckwith-Wiedemann syndrome (BWS) is a model imprinting disorder resulting from mutations or epigenetic events involving imprinted genes at chromosome 11p15.5. Thus, germline mutations in CDKN1C, uniparental disomy (UPD), and loss of imprinting of IGF2 and other imprinted genes have been implicated. Many familial BWS cases have germline CDKN1C mutations. However, most BWS cases are sporadic and UPD or putative imprinting errors predominate in this group. We have identified previously a subgroup of sporadic cases with loss of imprinting (LOI) of IGF2 and epigenetic silencing of H19 proposed to be caused by a defect in a distal 11p15.5 imprinting control element (designated BWSIC1). However, many sporadic BWS patients show biallelic IGF2 expression in the presence of normal H19 methylation and expression patterns. This and other evidence suggested the existence of a further imprinting control element (BWSIC2) at 11p15.5. Recently, we showed that a subgroup of BWS patients have loss of methylation (LOM) at a differentially methylated region (KvDMR1) within the KCNQ1 gene centromeric to the IGF2 and H19 genes. We have now analysed a large series of sporadic cases to define the frequency and phenotypic correlates of epigenetic abnormalities in BWS. LOM at KvDMR1 was detected by Southern analysis or a novel PCR based method in 35 of 69 (51%) sporadic BWS without UPD. LOM at KvDMR1 was often, but not invariably associated with LOI of IGF2. KvDMR1 LOM was not detected in BWS patients with putative BWSIC1 defects and cases with KvDMR1 LOM (that is, putative BWSIC2 defects) invariably had a normal H19 methylation pattern. The incidence of exomphalos in putative BWSIC2 defect patients was not significantly different from that in patients with germline CDKN1C mutations (20/29 and 13/15 respectively), but was significantly greater than that in patients with putative BWSIC1 defects (0/5, p=0.007) and UPD (0/22, p<0.0001). These findings are consistent with the hypothesis that LOM of KvDMR1 (BWSIC2 defect) results in epigenetic silencing of CDKN1C and variable LOI of IGF2. BWS patients with embryonal tumours have UPD or a BWSIC1 defect but not LOM of KvDMR1. This study has further shown how (1) variations in phenotypic expression of BWS may be linked to specific molecular subgroups and (2) molecular analysis of BWS can provide insights into mechanisms of imprinting regulation.


Keywords: Beckwith-Wiedemann syndrome; epigenotype-phenotype correlations; imprinting
doi:10.1136/jmg.37.12.921
PMCID: PMC1734494  PMID: 11106355
16.  Zac1 Regulates Cell Cycle Arrest in Neuronal Progenitors via Tcf4 
Molecular and Cellular Biology  2014;34(6):1020-1030.
Imprinted genes play a critical role in brain development and mental health, although the underlying molecular and cellular mechanisms remain incompletely understood. The family of basic helix-loop-helix (bHLH) proteins directs the proliferation, differentiation, and specification of distinct neuronal progenitor populations. Here, we identified the bHLH factor gene Tcf4 as a direct target gene of Zac1/Plagl1, a maternally imprinted transcriptional regulator, during early neurogenesis. Zac1 and Tcf4 expression levels concomitantly increased during neuronal progenitor differentiation; moreover, Zac1 interacts with two cis-regulatory elements in the Tcf4 gene locus, and these elements together confer synergistic activation of the Tcf4 gene. Tcf4 upregulation enhances the expression of the cyclin-dependent kinase inhibitor gene p57Kip2, a paternally imprinted Tcf4 target gene, and increases the number of cells in G1 phase. Overall, we show that Zac1 controls cell cycle arrest function in neuronal progenitors through induction of p57Kip2 via Tcf4 and provide evidence for cooperation between imprinted genes and a bHLH factor in early neurodevelopment.
doi:10.1128/MCB.01195-13
PMCID: PMC3958027  PMID: 24396065
17.  The orphan nuclear receptor, COUP-TF II, inhibits myogenesis by post-transcriptional regulation of MyoD function: COUP-TF II directly interacts with p300 and myoD. 
Nucleic Acids Research  1998;26(23):5501-5510.
COUP-TF II is an orphan nuclear receptor that has no known ligand in the 'classical sense'. COUP-TF interacts with the corepressors N-CoR, SMRT and RIP13, and silences transcription by active repression and trans-repression. Forced expression of the orphan nuclear receptor COUP-TF II in mouse C2 myogenic cells has been demonstrated to inhibit morphological differentiation, and to repress the expression of: (i) the myoD gene family which encodes myogenic basic helix-loop-helix (bHLH) proteins; and (ii) the cell cycle regulator, p21(Waf-1/Cip-1). In the present study, we show that COUP-TF II efficiently inhibits the myoD -mediated myogenic conversion of pluripotential C3H10T1/2 cells by post-transcriptional mechanisms. Furthermore, repression of MyoD-dependent transcription by COUP-TF II occurs in the absence of the nuclear receptor cognate binding motif. The inhibition of MyoD-mediated trans-activation involves the direct binding of the DNA binding domain/C-region and hinge/D-regions [i.e. amino acid (aa) residues 78-213] of COUP-TF II to the N-terminal activation domain of MyoD. Over-expression of the cofactor p300, which functions as a coactivator of myoD-mediated transcription, alleviated repression by COUP-TF II. Further binding analysis demonstrated that COUP-TF II interacted with the N-terminal 149 aa residues of p300 which encoded the receptor interaction domain of the coactivator. Finally we observed that COUP-TF II, MyoD and p300 interact in a competitive manner, and that increasing amounts of COUP-TF II have the ability to reduce the interaction between myoD and p300 invitro. The experiments presented herein suggest thatCOUP-TF II post-transcriptionally regulates myoD activity/function, and that crosstalk between orphan nuclear receptors and the myogenic bHLH proteins has functional consequences for differentiation.
PMCID: PMC147985  PMID: 9826778
18.  MyoD-expressing progenitors are essential for skeletal myogenesis and satellite cell development 
Developmental biology  2013;384(1):10.1016/j.ydbio.2013.09.012.
Skeletal myogenesis in the embryo is regulated by the coordinated expression of the MyoD family of muscle regulatory factors (MRFs). MyoD and Myf-5, which are the primary muscle lineage-determining factors, function in a partially redundant manner to establish muscle progenitor cell identity. Previous diphtheria toxin (DTA)-mediated ablation studies showed that MyoD+ progenitors rescue myogenesis in embryos in which Myf-5-expressing cells were targeted for ablation, raising the possibility that the regulative behavior of distinct, MRF-expressing populations explains the functional compensatory activities of these MRFs. Using MyoDiCre mice, we show that DTA-mediated ablation of MyoD-expressing cells results in the cessation of myogenesis by embryonic day 12.5 (E12.5), as assayed by myosin heavy chain (MyHC) and Myogenin staining. Importantly, MyoDiCre/+;R26DTA/+ embryos exhibited a concomitant loss of Myf-5+ progenitors, indicating that the vast majority of Myf-5+ progenitors express MyoD, a conclusion consistent with immunofluorescence analysis of Myf-5 protein expression in MyoDiCre lineage-labeled embryos. Surprisingly, staining for the paired box transcription factor, Pax7, which functions genetically upstream of MyoD in the trunk and is a marker for fetal myoblasts and satellite cell progenitors, was also lost by E12.5. Specific ablation of differentiating skeletal muscle in ACTA1Cre;R26DTA/+ embryos resulted in comparatively minor effects on MyoD+, Myf-5+ and Pax7+ progenitors, indicating that cell non-autonomous effects are unlikely to explain the rapid loss of myogenic progenitors in MyoDiCre/+;R26DTA/+ embryos. We conclude that the vast majority of myogenic populations transit through a MyoD+ state, and that MyoD+ progenitors are essential for myogenesis and stem cell development.
doi:10.1016/j.ydbio.2013.09.012
PMCID: PMC3838901  PMID: 24055173
MyoD; Myf-5; skeletal muscle; myoblasts; progenitors; myogenesis; mouse embryo; diphtheria toxin; DTA; lineage ablation; stem cells; satellite cells
19.  MyoD- and nerve-dependent maintenance of MyoD expression in mature muscle fibres acts through the DRR/PRR element 
Background
MyoD is a transcription factor implicated in the regulation of adult muscle gene expression. Distinguishing the expression of MyoD in satellite myoblasts and muscle fibres has proved difficult in vivo leading to controversy over the significance of MyoD expression within adult innervated muscle fibres. Here we employ the MD6.0-lacZ transgenic mouse, in which the 6 kb proximal enhancer/promoter (DRR/PRR) of MyoD drives lacZ, to show that MyoD is present and transcriptionally active in many adult muscle fibres.
Results
In culture, MD6.0-lacZ expresses in myotubes but not myogenic cells, unlike endogenous MyoD. Reporter expression in vivo is in muscle fibre nuclei and is reduced in MyoD null mice. The MD6.0-lacZ reporter is down-regulated both in adult muscle fibres by denervation or muscle disuse and in cultured myotubes by inhibition of activity. Activity induces and represses MyoD through the DRR and PRR, respectively. During the postnatal period, accumulation of β-galactosidase correlates with maturation of innervation. Strikingly, endogenous MyoD expression is up-regulated in fibres by complete denervation, arguing for a separate activity-dependent suppression of MyoD requiring regulatory elements outside the DRR/PRR.
Conclusion
The data show that MyoD regulation is more complex than previously supposed. Two factors, MyoD protein itself and fibre activity are required for essentially all expression of the 6 kb proximal enhancer/promoter (DRR/PRR) of MyoD in adult fibres. We propose that modulation of MyoD positive feedback by electrical activity determines the set point of MyoD expression in innervated fibres through the DRR/PRR element.
doi:10.1186/1471-213X-8-5
PMCID: PMC2259323  PMID: 18215268
20.  A novel myogenic regulatory circuit controls slow/cardiac troponin C gene transcription in skeletal muscle. 
Molecular and Cellular Biology  1994;14(3):1870-1885.
The slow/cardiac troponin C (cTnC) gene is expressed in three distinct striated muscle lineages: cardiac myocytes, embryonic fast skeletal myotubes, and adult slow skeletal myocytes. We have reported previously that cTnC gene expression in cardiac muscle is regulated by a cardiac-specific promoter/enhancer located in the 5' flanking region of the gene (bp -124 to +1). In this report, we demonstrate that the cTnC gene contains a second distinct and independent transcriptional enhancer which is located in the first intron. This second enhancer is skeletal myotube specific and is developmentally up-regulated during the differentiation of myoblasts to myotubes. This enhancer contains three functionally important nuclear protein binding sites: a CACCC box, a MEF-2 binding site, and a previously undescribed nuclear protein binding site, designated MEF-3, which is also present in a large number of skeletal muscle-specific transcriptional enhancers. Unlike most skeletal muscle-specific transcriptional regulatory elements, the cTnC enhancer does not contain a consensus binding site (CANNTG) for the basic helix-loop-helix (bHLH) family of transcription factors and does not directly bind MyoD-E12 protein complexes. Despite these findings, the cTnC enhancer can be transactivated by overexpression of the myogenic bHLH proteins, MyoD and myogenin, in C3H10T1/2 (10T1/2) cells. Electrophoretic mobility shift assays demonstrated changes in the patterns of MEF-2, CACCC, and MEF-3 DNA binding activities following the conversion of 10T1/2 cells into myoblasts and myotubes by stable transfection with a MyoD expression vector. In particular, MEF-2 binding activity was up-regulated in 10T1/2 cells stably transfected with a MyoD expression vector only after these cells fused and differentiated into skeletal myotubes. Taken together, these results demonstrated that distinct lineage-specific transcriptional regulatory elements control the expression of a single myofibrillar protein gene in fast skeletal and cardiac muscle. In addition, they show that bHLH transcription factors can indirectly transactivate the expression of some muscle-specific genes.
Images
PMCID: PMC358545  PMID: 8114720
21.  The basic domain of myogenic basic helix-loop-helix (bHLH) proteins is the novel target for direct inhibition by another bHLH protein, Twist. 
Molecular and Cellular Biology  1997;17(11):6563-6573.
In vertebrates, the basic helix-loop-helix (bHLH) protein Twist may be involved in the negative regulation of cellular determination and in the differentiation of several lineages, including myogenesis, osteogenesis, and neurogenesis. Although it has been shown that mouse twist (M-Twist) (i) sequesters E proteins, thus preventing formation of myogenic E protein-MyoD complexes and (ii) inhibits the MEF2 transcription factor, a cofactor of myogenic bHLH proteins, overexpression of E proteins and MEF2 failed to rescue the inhibitory effects of M-Twist on MyoD. We report here that M-Twist physically interacts with the myogenic bHLH proteins in vitro and in vivo and that this interaction is required for the inhibition of MyoD by M-Twist. In contrast to the conventional HLH-HLH domain interaction formed in the MyoD/E12 heterodimer, this novel type of interaction uses the basic domains of the two proteins. While the MyoD HLH domain without the basic domain failed to interact with M-Twist, a MyoD peptide containing only the basic and helix 1 regions was sufficient to interact with M-Twist, suggesting that the basic domain contacts M-Twist. The replacement of three arginine residues by alanines in the M-Twist basic domain was sufficient to abolish both the binding and inhibition of MyoD by M-Twist, while the domain retained other M-Twist functions such as heterodimerization with an E protein and inhibition of MEF2 transactivation. These findings demonstrate that M-Twist interacts with MyoD through the basic domains, thereby inhibiting MyoD.
PMCID: PMC232510  PMID: 9343420
22.  Identification of Novel MyoD Gene Targets in Proliferating Myogenic Stem Cells 
Molecular and Cellular Biology  2002;22(17):6199-6208.
A major control point for skeletal myogenesis revolves around the muscle basic helix-loop-helix gene family that includes MyoD, Myf-5, myogenin, and MRF4. Myogenin and MRF4 are thought to be essential to terminal differentiation events, whereas MyoD and Myf-5 are critical to establishing the myogenic cell lineage and producing committed, undifferentiated myogenic stem cells (myoblasts). Although mouse genetic studies have revealed the importance of MyoD and Myf-5 for myoblast development, the genetic targets of MyoD and Myf-5 activity in undifferentiated myoblasts remain unknown. In this study, we investigated the function of MyoD as a transcriptional activator in undifferentiated myoblasts. By using conditional expression of MyoD, in conjunction with suppression subtractive hybridizations, we show that the Id3 and NP1 (neuronal pentraxin 1) genes become transcriptionally active following MyoD induction in undifferentiated myoblasts. Activation of Id3 and NP1 represents a stable, heritable event that does not rely on continued MyoD activity and is not subject to negative regulation by an activated H-Ras G12V protein. These results are the first to demonstrate that MyoD functions as a transcriptional activator in myogenic stem cells and that this key myogenic regulatory factor exhibits different gene target specificities, depending upon the cellular environment.
doi:10.1128/MCB.22.17.6199-6208.2002
PMCID: PMC133998  PMID: 12167713
23.  Aberrant regulation of MyoD1 contributes to the partially defective myogenic phenotype of BC3H1 cells [published erratum appears in J Cell Biol 1990 Jun;110(6):2231] 
The Journal of Cell Biology  1990;110(4):929-937.
Two skeletal muscle-specific regulatory factors, myogenin and MyoD1, share extensive homology within a myc similarity region and have each been shown to activate the morphologic and molecular events associated with myogenesis after transfection into nonmyogenic cells. The BC3H1 muscle cell line expresses myogenin and other muscle-specific genes, but does not express MyoD1 during differentiation. BC3H1 cells also do not upregulate alpha-cardiac actin or fast myosin light chain, nor do they form multinucleate myotubes during differentiation. In this study, we examined the basis for the lack of MyoD1 expression in BC3H1 cells and investigated whether their failure to express MyoD1 is responsible for their defects in differentiation. We report that expression of an exogenous MyoD1 cDNA in BC3H1 cells was sufficient to elevate the expression of alpha-cardiac actin and fast myosin light chain, and to convert these cells to a phenotype that forms multinucleate myotubes during differentiation. Whereas myogenin and MyoD1 positively regulated their own expression in transfected 10T1/2 cells, they could not, either alone or in combination, activate MyoD1 expression in BC3H1 cells. Exposure of BC3H1 cells to 5-azacytidine also failed to activate MyoD1 expression or to rescue the cell's ability to fuse. These results suggest that BC3H1 cells may possess a defect that prevents activation of the MyoD1 gene by MyoD1 or myogenin. That an exogenous MyoD1 gene could rescue those aspects of the differentiation program that are defective in BC3H1 cells also suggests that the actions of MyoD1 and myogenin are not entirely redundant and that MyoD1 may be required for activation of the complete repertoire of events associated with myogenesis.
PMCID: PMC2116110  PMID: 1691195
24.  Allele-Specific Binding of CTCF to the Multipartite Imprinting Control Region KvDMR1▿  
Molecular and Cellular Biology  2007;27(7):2636-2647.
Paternal deletion of the imprinting control region (ICR) KvDMR1 results in loss of expression of the Kcnq1ot1 noncoding RNA and derepression of flanking paternally silenced genes. Truncation of Kcnq1ot1 also results in the loss of imprinted expression of these genes in most cases, demonstrating a role for the RNA or its transcription in gene silencing. However, enhancer-blocking studies indicate that KvDMR1 also contains chromatin insulator or silencer activity. In this report we demonstrate by electrophoretic mobility shift assays and chromatin immunoprecipitation the existence of two CTCF binding sites within KvDMR1 that are occupied in vivo only on the unmethylated paternally derived allele. Methylation interference and mutagenesis allowed the precise mapping of protein-DNA contact sites for CTCF within KvDMR1. Using a luciferase reporter assay, we mapped the putative transcriptional promoter for Kcnq1ot1 upstream and to a site functionally separable from enhancer-blocking activity and CTCF binding sites. Luciferase reporter assays also suggest the presence of an additional cis-acting element in KvDMR1 upstream of the putative promoter that can function as an enhancer. These results suggest that the KvDMR1 ICR consists of multiple, independent cis-acting modules. Dissection of KvDMR1 into its functional components should help elucidate the mechanism of its function in vivo.
doi:10.1128/MCB.02036-06
PMCID: PMC1899897  PMID: 17242189
25.  Identification of a regulatory function for an orphan receptor in muscle: COUP-TF II affects the expression of the myoD gene family during myogenesis. 
Nucleic Acids Research  1995;23(8):1311-1318.
COUP-TF II is an 'orphan steroid receptor' that binds a wide variety of AGGTCA repeats and represses thyroid hormone (T3) and retinoid dependent trans-activation; however, very little is known of its functional and/or developmental role during mammalian cell differentiation. T3 and retinoids have been demonstrated to promote terminal muscle differentiation via activation of the muscle specific myoD gene family (myoD, myogenin, myf-5 and MRF-4). The myoD gene family can direct the fate of mesodermal cell lineages, repress proliferation, activate differentiation and the contractile phenotype. Hence, we investigated the expression and functional role of COUP-TF II during muscle differentiation. Proliferating C2C12 myoblasts expressed COUP-TF II mRNA which was repressed when cells were induced to differentiate into post-mitotic multinucleated myotubes by serum withdrawal. Concomitant with the decrease of COUP-TF II mRNA was the appearance of muscle specific mRNAs (e.g. myogenin, alpha-actin). We show that Escherichia coli expressed full length and truncated COUP-TF II bound in a sequence specific manner to the T3 response elements (TREs) in the myoD and myogenin regulatory HLH genes [Olson (1992) Dev. Biol. 154, 261-272]; and the TRE in the skeletal alpha-actin contractile protein gene. COUP-TF II diminished the homodimeric binding of the thyroid hormone receptor and the heterodimeric binding of thyroid hormone and retinoid X receptor complexes to these TREs. Constitutive over-expression of COUP-TF II cDNA in mouse C2C12 myogenic cells suppressed the levels of myoD mRNA and blocked the induction of myogenin mRNA, whereas constitutive expression of anti-sense COUP-TF II cDNA significantly increased the steady state levels of myoD mRNA and hyper-induced myogenin mRNA. These studies demonstrate for the first time (i) that COUP-TF II, functions as a physiologically relevant antagonistic regulator of myogenesis via direct effects on the myoD gene family and (ii) direct evidence for the developmental role of COUP-TF II during mammalian cell differentiation.
Images
PMCID: PMC306855  PMID: 7753622

Results 1-25 (1295785)