PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (932783)

Clipboard (0)
None

Related Articles

1.  A Gene Transfer Agent and a Dynamic Repertoire of Secretion Systems Hold the Keys to the Explosive Radiation of the Emerging Pathogen Bartonella 
PLoS Genetics  2013;9(3):e1003393.
Gene transfer agents (GTAs) randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes.
Author Summary
Viruses are selfish genetic elements that replicate and transfer their own DNA, often killing the host cell in the process. Unlike viruses, gene transfer agents (GTAs) transfer random pieces of the bacterial genome rather than their own DNA. GTAs are widespread in bacterial genomes, but it is not known whether they are beneficial to the bacterium. In this study, we have used the emerging pathogen Bartonella as our model to study the evolution of GTAs. We sequenced the genomes of six isolates of Bartonella, including two new strains isolated from wild moose in Sweden. Using a comparative genomics approach, we searched for innovations in the last common ancestor that could help explain the explosive radiation of the genus. Surprisingly, we found that a gene cluster for a GTA and a phage-derived origin of replication was the most conserved innovation, indicative of strong selective constraints. We argue that the reason for the remarkable stability of the GTA is that it provides a mechanism to duplicate and recombine genes for secretion systems. This leads to adaptability to a broad range of hosts.
doi:10.1371/journal.pgen.1003393
PMCID: PMC3610622  PMID: 23555299
2.  Phosphate Concentration and the Putative Sensor Kinase Protein CckA Modulate Cell Lysis and Release of the Rhodobacter capsulatus Gene Transfer Agent 
Journal of Bacteriology  2013;195(22):5025-5040.
The gene transfer agent of Rhodobacter capsulatus (RcGTA) is a bacteriophage-like genetic element with the sole known function of horizontal gene transfer. Homologues of RcGTA genes are present in many members of the alphaproteobacteria and may serve an important role in microbial evolution. Transcription of RcGTA genes is induced as cultures enter the stationary phase; however, little is known about cis-active sequences. In this work, we identify the promoter of the first gene in the RcGTA structural gene cluster. Additionally, gene transduction frequency depends on the growth medium, and the reason for this is not known. We report that millimolar concentrations of phosphate posttranslationally inhibit the lysis-dependent release of RcGTA from cells in both a complex medium and a defined medium. Furthermore, we found that cell lysis requires the genes rcc00555 and rcc00556, which were expressed and studied in Escherichia coli to determine their predicted functions as an endolysin and holin, respectively. Production of RcGTA is regulated by host systems, including a putative histidine kinase, CckA, and we found that CckA is required for maximal expression of rcc00555 and for maturation of RcGTA to yield gene transduction-functional particles.
doi:10.1128/JB.00669-13
PMCID: PMC3811591  PMID: 23995641
3.  Identification of a predicted partner-switching system that affects production of the gene transfer agent RcGTA and stationary phase viability in Rhodobacter capsulatus 
BMC Microbiology  2014;14:71.
Background
Production of the gene transfer agent RcGTA in the α-proteobacterium Rhodobacter capsulatus is dependent upon the response regulator protein CtrA. Loss of this regulator has widespread effects on transcription in R. capsulatus, including the dysregulation of numerous genes encoding other predicted regulators. This includes a set of putative components of a partner-switching signaling pathway with sequence homology to the σ-regulating proteins RsbV, RsbW, and RsbY that have been extensively characterized for their role in stress responses in gram-positive bacteria. These R. capsulatus homologues, RbaV, RbaW, and RbaY, have been investigated for their possible role in controlling RcGTA gene expression.
Results
A mutant strain lacking rbaW showed a significant increase in RcGTA gene expression and production. Mutation of rbaV or rbaY led to a decrease in RcGTA gene expression and production, and these mutants also showed decreased viability in the stationary phase and produced unusual colony morphologies. In vitro and in vivo protein interaction assays demonstrated that RbaW and RbaV interact. A combination of gene disruptions and protein-protein interaction assays were unsuccessful in attempts to identify a cognate σ factor, and the genetic data support a model where the RbaV protein that is the determinant regulator of RcGTA gene expression in this system.
Conclusions
These findings provide new information about RcGTA regulation by a putative partner-switching system and further illustrate the integration of RcGTA production into R. capsulatus physiology.
doi:10.1186/1471-2180-14-71
PMCID: PMC3999984  PMID: 24645667
Gene expression; Protein-protein interactions; Partner-switching; Gene exchange
4.  One for All or All for One: Heterogeneous Expression and Host Cell Lysis Are Key to Gene Transfer Agent Activity in Rhodobacter capsulatus 
PLoS ONE  2012;7(8):e43772.
The gene transfer agent (RcGTA) of Rhodobacter capsulatus is the model for a family of novel bacteriophage-related genetic elements that carry out lateral transfer of essentially random host DNA. Genuine and putative gene transfer agents have been discovered in diverse genera and are becoming recognized as potentially an important source of genetic exchange and microbial evolution in the oceans. Despite being discovered over 30 years ago, little is known about many essential aspects of RcGTA biology. Here, we validate the use of direct fluorescence reporter constructs, which express the red fluorescent protein mCherry in R. capsulatus. A construct containing the RcGTA promoter fused to mCherry was used to examine the single-cell expression profiles of wild type and RcGTA overproducer R. capsulatus populations, under different growth conditions and growth phases. The majority of RcGTA production clearly arises from a small, distinct sub-set of the population in the wild type strain and a larger sub-set in the overproducer. The most likely RcGTA release mechanism concomitant with this expression pattern is host cell lysis and we present direct evidence for the release of an intracellular enzyme accompanying RcGTA release. RcGTA ORF s is annotated as a ‘cell wall peptidase’ but we rule out a role in host lysis and propose an alternative function as a key contributor to RcGTA invasion of a target cell during infection.
doi:10.1371/journal.pone.0043772
PMCID: PMC3423380  PMID: 22916305
5.  Draft Genome Sequences of Six Rhodobacter capsulatus Strains, YW1, YW2, B6, Y262, R121, and DE442 
Genome Announcements  2014;2(1):e00050-14.
Rhodobacter capsulatus is a model organism for studying a novel type of horizontal gene transfer mediated by a phage-like gene transfer agent (RcGTA). Here we report the draft genome sequences of six R. capsulatus strains that exhibit different RcGTA properties, including RcGTA overproducers, RcGTA nonproducers, and/or RcGTA nonreceivers.
doi:10.1128/genomeA.00050-14
PMCID: PMC3924369  PMID: 24526637
6.  Occurrence and Expression of Gene Transfer Agent Genes in Marine Bacterioplankton▿  
Applied and Environmental Microbiology  2008;74(10):2933-2939.
Genes with homology to the transduction-like gene transfer agent (GTA) were observed in genome sequences of three cultured members of the marine Roseobacter clade. A broader search for homologs for this host-controlled virus-like gene transfer system identified likely GTA systems in cultured Alphaproteobacteria, and particularly in marine bacterioplankton representatives. Expression of GTA genes and extracellular release of GTA particles (∼50 to 70 nm) was demonstrated experimentally for the Roseobacter clade member Silicibacter pomeroyi DSS-3, and intraspecific gene transfer was documented. GTA homologs are surprisingly infrequent in marine metagenomic sequence data, however, and the role of this lateral gene transfer mechanism in ocean bacterioplankton communities remains unclear.
doi:10.1128/AEM.02129-07
PMCID: PMC2394915  PMID: 18359833
7.  Searching for a “Hidden” Prophage in a Marine Bacterium▿  
Prophages are common in many bacterial genomes. Distinguishing putatively viable prophages from nonviable sequences can be a challenge, since some prophages are remnants of once-functional prophages that have been rendered inactive by mutational changes. In some cases, a putative prophage may be missed due to the lack of recognizable prophage loci. The genome of a marine roseobacter, Roseovarius nubinhibens ISM (hereinafter referred to as ISM), was recently sequenced and was reported to contain no intact prophage based on customary bioinformatic analysis. However, prophage induction experiments performed with this organism led to a different conclusion. In the laboratory, virus-like particles in the ISM culture increased more than 3 orders of magnitude following induction with mitomycin C. After careful examination of the ISM genome sequence, a putative prophage (ISM-pro1) was identified. Although this prophage contains only minimal phage-like genes, we demonstrated that this “hidden” prophage is inducible. Genomic analysis and reannotation showed that most of the ISM-pro1 open reading frames (ORFs) display the highest sequence similarity with Rhodobacterales bacterial genes and some ORFs are only distantly related to genes of other known phages or prophages. Comparative genomic analyses indicated that ISM-pro1-like prophages or prophage remnants are also present in other Rhodobacterales genomes. In addition, the lysis of ISM by this previously unrecognized prophage appeared to increase the production of gene transfer agents (GTAs). Our study suggests that a combination of in silico genomic analyses and experimental laboratory work is needed to fully understand the lysogenic features of a given bacterium.
doi:10.1128/AEM.01450-09
PMCID: PMC2805234  PMID: 19948862
8.  Identification of Genes of VSH-1, a Prophage-Like Gene Transfer Agent of Brachyspira hyodysenteriae 
Journal of Bacteriology  2005;187(17):5885-5892.
VSH-1 is a mitomycin C-inducible prophage of the anaerobic spirochete Brachyspira hyodysenteriae. Purified VSH-1 virions are noninfectious, contain random 7.5-kb fragments of the bacterial genome, and mediate generalized transduction of B. hyodysenteriae cells. In order to identify and sequence genes of this novel gene transfer agent (GTA), proteins associated either with VSH-1 capsids or with tails were purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequences of 11 proteins were determined. Degenerate PCR primers were designed from the amino acid sequences and used to amplify several VSH-1 genes from B. hyodysenteriae strain B204 DNA. A λ clone library of B. hyodysenteriae B204 DNA was subsequently screened by Southern hybridization methods and used to identify and sequence overlapping DNA inserts containing additional VSH-1 genes. VSH-1 genes spanned 16.3 kb of the B. hyodysenteriae chromosome and were flanked by bacterial genes. VSH-1 identified genes and unidentified, intervening open reading frames were consecutively organized in head (seven genes), tail (seven genes), and lysis (four genes) clusters in the same transcriptional direction. Putative lysis genes encoding endolysin (Lys) and holin proteins were identified from sequence and structural similarities of their translated protein products with GenBank bacteriophage proteins. Recombinant Lys protein hydrolyzed peptidoglycan purified from B. hyodysenteriae cells. The identified VSH-1 genes exceed the DNA capacity of VSH-1 virions and do not encode traditional bacteriophage early functions involved in DNA replication. These genome properties explain the noninfectious nature of VSH-1 virions and further confirm its resemblance to known prophage-like, GTAs of other bacterial species, such as the GTA from Rhodobacter capsulatus. The identification of VSH-1 genes will enable analysis of the regulation of this GTA and should facilitate investigations of VSH-1-like prophages from other Brachyspira species.
doi:10.1128/JB.187.17.5885-5892.2005
PMCID: PMC1196157  PMID: 16109929
9.  Release and uptake of gene transfer agent by Rhodopseudomonas capsulata. 
Journal of Bacteriology  1975;123(2):651-657.
Many strains of Rhodopseudomonas capsulata are capable of exchanging genetic information via a recently discovered gene transfer process involving the release and subsequent uptake from the medium of particles containing genetic information (gene transfer agents, GTAs). No viral activities are observed to be associated with this system. An assay has been developed to quantitate gene transfer in R. capsulata. Conditions are described for which the number of cells acquiring a new genetic trait is direcly proportional to the number of GTAs and independent of the number of receipient cells. These conditions were used for the assay of the uptake and release of GTAs by cells. The maximum fraction of recipients that acquire a given genetic marker is approximately 4 X 10(-4). Free GTA appears in a growing culture in one or two abrupt waves near the time of transition from exponential to stationary phase. During these waves, the titer of GTA for a given marker may reach 2 X 103/ml. A comparison of the frequency of single- and double-marker transfers suggests that most of the cells in early-stationary-phase cultures are active recipients. The ultraviolet inactivation spectrum of GTA resembles that of the small ribonucleic acid phages. The inactivation cross section section beta, for GTA was calculated to be 1.7 X 10(-16) cm2/photon at 265 nm.
PMCID: PMC235772  PMID: 1150627
10.  Complete genome sequence of a marine roseophage provides evidence into the evolution of gene transfer agents in alphaproteobacteria 
Virology Journal  2011;8:124.
Roseophage RDJLΦ1 is a siphovirus isolated from South China Sea on Roseobacter denitrificans OCh114. Its virion encapsulates 62.7 kb genome that encodes 87 gene products. RDJLΦ1 shares similar genome organization and gene content with the marine bacteriophage ΦJL001 and Pseudomonas phages YuA and M6, which are different from those of typical λ- or Mu-like phages. Four hallmark genes (ORFs 81 to 84) of RDJLΦ1 were highly homologous to RcGTA-like genes 12 to 15. The largest gene (ORF 84) was predicted to encode a tail fibre protein that could be involved in host recognition. Extended phylogenetic and comparative genomic analyses based on 77 RcGTA-like element-containing bacterial genomes revealed that RcGTA-like genes 12 to 15 together appear to be a conserved modular element that could also be found in some phage or prophage genomes. Our study suggests that RcGTA-like genes-containing phages and prophages and complete RcGTAs possibly descended from a same prophage ancestor that had diverged and then evolved vertically. The complete genome of RDJLΦ1 provides evidence into the hypothesis that extant RcGTA may be a prophage remnant.
doi:10.1186/1743-422X-8-124
PMCID: PMC3070671  PMID: 21414219
11.  Proteomic Analysis and Identification of the Structural and Regulatory Proteins of the Rhodobacter capsulatus Gene Transfer Agent 
Journal of proteome research  2009;8(2):967-973.
The gene transfer agent of Rhodobacter capsulatus (GTA) is a unique phage-like particle that exchanges genetic information between members of this same species of bacterium. Besides being an excellent tool for genetic mapping, the GTA has a number of advantages for biotechnological and nanoengineering purposes. To facilitate the GTA purification and identify the proteins involved in GTA expression, assembly and regulation, in the present work we construct and transform into R. capsulatus Y262 a gene coding for a C-terminally His-tagged capsid protein. The constructed protein was expressed in the cells, assembled into chimeric GTA particles inside the cells and excreted from the cells into surrounding medium. Transmission electron micrographs of phosphotungstate-stained, NiNTA-purified chimeric GTA confirm that its structure is similar to normal GTA particles, with many particles composed both of a head and a tail. The mass spectrometric proteomic analysis of polypeptides present in the GTA recovered outside the cells shows that GTA is composed of at least 9 proteins represented in the GTA gene cluster including proteins coded for by Orf’s 3, 5, 6–9, 11, 13, and 15.
doi:10.1021/pr8006045
PMCID: PMC2850816  PMID: 19105630
Gene transfer agent; Rhodobacter capsulatus; proteome
12.  A Bacterial Signal Transduction System Controls Genetic Exchange and Motility 
Journal of Bacteriology  2002;184(4):913-918.
The bacterium Rhodobacter capsulatus is capable of an unusual form of genetic exchange, mediated by a transducing bacteriophage-like particle called the gene transfer agent (GTA). GTA production by R. capsulatus is controlled at the level of transcription by a cellular two-component signal transduction system that includes a putative histidine kinase (CckA) and response regulator (CtrA). We found that, in addition to regulating genetic exchange by R. capsulatus, this signal transduction system controls motility. As with the regulation of GTA production, the control of motility by CckA and CtrA occurs through modulation of gene transcription. Disruptions of the cckA and ctrA genes resulted in a loss of class II, class III, and class IV flagellar gene transcripts, suggesting that cckA and ctrA function in motility as class I flagellar genes. We also found that, analogous to the GTA genes, transcription of R. capsulatus flagellar genes appears to be growth phase dependent: class II flagellar gene transcripts are maximal in the mid-log phase of the culture growth cycle, whereas class III gene transcripts are maximal in the late-log phase of growth. We speculate that coordinate regulation of motility and GTA-mediated genetic exchange in R. capsulatus exists because these two processes are complementary mechanisms for cells to cope with unfavorable conditions in natural environments.
doi:10.1128/jb.184.4.913-918.2002
PMCID: PMC134786  PMID: 11807050
13.  Bacillus subtilis gtaB encodes UDP-glucose pyrophosphorylase and is controlled by stationary-phase transcription factor sigma B. 
Journal of Bacteriology  1993;175(13):3964-3971.
Transcription factor sigma B of Bacillus subtilis controls a large stationary-phase regulon, but in no case has the physiological function of any gene in this regulon been identified. Here we show that transcription of gtaB is partly dependent on sigma B in vivo and that gtaB encodes UDP-glucose pyrophosphorylase. The gtaB reading frame was initially identified by a sigma B-dependent Tn917lacZ fusion, csb42. We cloned the region surrounding the csb42 insertion, identified the reading frame containing the transposon, and found that this frame encoded a predicted 292-residue product that shared 45% identical residues with the UDP-glucose pyrophosphorylase of Acetobacter xylinum. The identified reading frame appeared to lie in a monocistronic transcriptional unit. Primer extension and promoter activity experiments identified tandem promoters, one sigma B dependent and the other sigma B independent, immediately upstream from the proposed coding region. A sequence resembling a factor-independent terminator closely followed the coding region. By polymerase chain reaction amplification of a B. subtilis genomic library carried in yeast artificial chromosomes, we located the UDP-glucose pyrophosphorylase coding region near gtaB, mutations in which confer phage resistance due to decreased glycosylation of cell wall teichoic acids. Restriction mapping showed that the coding region overlapped the known location of gtaB. Sequence analysis of a strain carrying the gtaB290 allele found an alteration that would change the proposed initiation codon from AUG to AUA, and an insertion-deletion mutation in this frame conferred phage resistance indistinguishable from that elicited by the gtaB290 mutation. We conclude that gtaB encodes UDP-glucose pyrophosphorylase and is partly controlled by sigma B. Because this enzyme is important for thermotolerance and osmotolerance in stationary-phase Escherichia coli cells, our results suggest that some genes controlled by sigma B may play a role in stationary-phase survival of B. subtilis.
Images
PMCID: PMC204824  PMID: 8320212
14.  Comparative sensitivity of the echovirus type 25 JV-4 prototype strain and two recent isolates to glutaraldehyde at low concentrations. 
The sensitivity of two recently isolated antigenic variants of echovirus type 25 (Montpellier 76-1262 and Thionville 86-222) to glutaraldehyde (GTA) at low concentrations was compared with that of the JV-4 prototype strain. The purified viruses were treated under the same conditions with GTA at concentrations ranging from 0.002 to 0.10%. The wild strains exhibited significantly lower sensitivity to GTA than did the prototype strain; with 0.10% GTA, a 2 log10 unit reduction was obtained in 5 min for JV-4 and in 60 and 80 min for Montpellier 76-1262 and Thionville 86-222, respectively. A comparison with previous results obtained with poliovirus type 1 showed that the inactivation rates of echovirus type 25 wild strains were fivefold lower than those of the poliovirus type 1 Sabin strain. The comparative electrophoretic and immunoblot analyses showed differences in the results of GTA binding with capsid proteins of the viruses. Unlike in the poliovirus type 1 Mahoney strain and in the echovirus type 25 JV-4 reference strain, GTA produced only minor intermolecular cross-linkings in the viral particles of the two wild strains of echovirus type 25. Our results suggest that there are both intertypic and intratypic differences in the GTA sensitivities of enterovirus strains. They are of relevance to disinfection procedures in digestive endoscopy and to the choice of the enterovirus strain used for evaluating the efficacy of disinfectants.
Images
PMCID: PMC201324  PMID: 8135510
15.  Isolation and Characterization of a Psychropiezophilic Alphaproteobacterium▿† 
Applied and Environmental Microbiology  2011;77(22):8145-8153.
Cultivated psychropiezophilic (low-temperature- and high-pressure-adapted) bacteria are currently restricted to phylogenetically narrow groupings capable of growth under nutrient-replete conditions, limiting current knowledge of the extant functional attributes and evolutionary constraints of diverse microorganisms inhabiting the cold, deep ocean. This study documents the isolation of a deep-sea bacterium following dilution-to-extinction cultivation using a natural seawater medium at high hydrostatic pressure and low temperature. To our knowledge, this isolate, designated PRT1, is the slowest-growing (minimal doubling time, 36 h) and lowest cell density-producing (maximal densities of 5.0 × 106 cells ml−1) piezophile yet obtained. Optimal growth was at 80 MPa, correlating with the depth of capture (8,350 m), and 10°C, with average cell sizes of 1.46 μm in length and 0.59 μm in width. Through detailed growth studies, we provide further evidence for the temperature-pressure dependence of the growth rate for deep-ocean bacteria. PRT1 was phylogenetically placed within the Roseobacter clade, a bacterial lineage known for widespread geographic distribution and assorted lifestyle strategies in the marine environment. Additionally, the gene transfer agent (GTA) g5 capsid protein gene was amplified from PRT1, indicating a potential mechanism for increased genetic diversification through horizontal gene transfer within the hadopelagic environment. This study provides a phylogenetically novel isolate for future investigations of high-pressure adaptation, expands the known physiological traits of cultivated members of the Roseobacter lineage, and demonstrates the feasibility of cultivating novel microbial members from the deep ocean using natural seawater.
doi:10.1128/AEM.05204-11
PMCID: PMC3208983  PMID: 21948832
16.  Gene co-expression network analysis in Rhodobacter capsulatus and application to comparative expression analysis of Rhodobacter sphaeroides 
BMC Genomics  2014;15(1):730.
Background
The genus Rhodobacter contains purple nonsulfur bacteria found mostly in freshwater environments. Representative strains of two Rhodobacter species, R. capsulatus and R. sphaeroides, have had their genomes fully sequenced and both have been the subject of transcriptional profiling studies. Gene co-expression networks can be used to identify modules of genes with similar expression profiles. Functional analysis of gene modules can then associate co-expressed genes with biological pathways, and network statistics can determine the degree of module preservation in related networks. In this paper, we constructed an R. capsulatus gene co-expression network, performed functional analysis of identified gene modules, and investigated preservation of these modules in R. capsulatus proteomics data and in R. sphaeroides transcriptomics data.
Results
The analysis identified 40 gene co-expression modules in R. capsulatus. Investigation of the module gene contents and expression profiles revealed patterns that were validated based on previous studies supporting the biological relevance of these modules. We identified two R. capsulatus gene modules preserved in the protein abundance data. We also identified several gene modules preserved between both Rhodobacter species, which indicate that these cellular processes are conserved between the species and are candidates for functional information transfer between species. Many gene modules were non-preserved, providing insight into processes that differentiate the two species. In addition, using Local Network Similarity (LNS), a recently proposed metric for expression divergence, we assessed the expression conservation of between-species pairs of orthologs, and within-species gene-protein expression profiles.
Conclusions
Our analyses provide new sources of information for functional annotation in R. capsulatus because uncharacterized genes in modules are now connected with groups of genes that constitute a joint functional annotation. We identified R. capsulatus modules enriched with genes for ribosomal proteins, porphyrin and bacteriochlorophyll anabolism, and biosynthesis of secondary metabolites to be preserved in R. sphaeroides whereas modules related to RcGTA production and signalling showed lack of preservation in R. sphaeroides. In addition, we demonstrated that network statistics may also be applied within-species to identify congruence between mRNA expression and protein abundance data for which simple correlation measurements have previously had mixed results.
Electronic supplementary material
The online version of this article (doi:10.1186/1471-2164-15-730) contains supplementary material, which is available to authorized users.
doi:10.1186/1471-2164-15-730
PMCID: PMC4158056  PMID: 25164283
Comparative transcriptomics; Module preservation; Gene-protein expression conservation; Rhodobacter capsulatus; Rhodobacter sphaeroides
17.  Glutaraldehyde cross-linking of amniotic membranes affects their nanofibrous structures and limbal epithelial cell culture characteristics 
Given that the cells can sense nanometer dimensions, the chemical cross-linking-mediated alteration in fibrillar structure of collagenous tissue scaffolds is critical to determining their cell culture performances. This article explores, for the first time, the effect of nanofibrous structure of glutaraldehyde (GTA) cross-linked amniotic membrane (AM) on limbal epithelial cell (LEC) cultivation. Results of ninhydrin assays demonstrated that the amount of new cross-links formed between the collagen chains is significantly increased with increasing the cross-linking time from 1 to 24 hours. By transmission electron microscopy, the AM treated with GTA for a longer duration exhibited a greater extent of molecular aggregation, thereby leading to a considerable increase in nanofiber diameter and resistance against collagenase degradation. In vitro biocompatibility studies showed that the samples cross-linked with GTA for 24 hours are not well-tolerated by the human corneal epithelial cell cultures. When the treatment duration is less than 6 hours, the biological tissues cross-linked with GTA for a longer time may cause slight reductions in 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt, and anti-inflammatory activities. Nevertheless, significant collagen molecular aggregation also enhances the stemness gene expression, indicating a high ability of these AM matrices to preserve the progenitors of LECs in vitro. It is concluded that GTA cross-linking of collagenous tissue materials may affect their nanofibrous structures and corneal epithelial stem cell culture characteristics. The AM treated with GTA for 6 hours holds promise for use as a niche for the expansion and transplantation of limbal epithelial progenitor cells.
doi:10.2147/IJN.S52731
PMCID: PMC3817029  PMID: 24204144
glutaraldehyde; amniotic membrane; nanofibrous structure; limbal epithelial cell; stemness
18.  Immunosuppression of anti-sheep erythrocyte responses by glycerol teichoic acid immune complexes. 
Infection and Immunity  1980;30(3):723-727.
Sprague-Dawley rats which produce "naturally occurring" antibodies to glycerol teichoic acid (GTA) displayed immunosuppression of anti-sheep erythrocyte plaque-forming cell and serum antibody responses when a single dose of lipid-free GTA was administered 24 h before immunization. Such suppression was enhanced by administering GTA complexed with anti-GTA immunoglobulin G. Animals fed a GTA-free diet produced no anti-GTA immunoglobulins and failed to show GTA-mediated immunosuppression under similar experimental conditions. However, when those animals were given GTA-anti-GTA complexes, suppression was evident. The results suggested antigenic competition mediated by immune complex-activated suppressor T cells. Lipid-free GTA did not stimulate serum antibody responses under the experimental conditions employed.
PMCID: PMC551375  PMID: 7194866
19.  Genome sequence of the phage-gene rich marine Phaeobacter arcticus type strain DSM 23566T 
Standards in Genomic Sciences  2013;8(3):450-464.
Phaeobacter arcticus Zhang et al. 2008 belongs to the marine Roseobacter clade whose members are phylogenetically and physiologically diverse. In contrast to the type species of this genus, Phaeobacter gallaeciensis, which is well characterized, relatively little is known about the characteristics of P. arcticus. Here, we describe the features of this organism including the annotated high-quality draft genome sequence and highlight some particular traits. The 5,049,232 bp long genome with its 4,828 protein-coding and 81 RNA genes consists of one chromosome and five extrachromosomal elements. Prophage sequences identified via PHAST constitute nearly 5% of the bacterial chromosome and included a potential Mu-like phage as well as a gene-transfer agent (GTA). In addition, the genome of strain DSM 23566T encodes all of the genes necessary for assimilatory nitrate reduction. Phylogenetic analysis and intergenomic distances indicate that the classification of the species might need to be reconsidered.
doi:10.4056/sigs.383362
PMCID: PMC3910698  PMID: 24501630
aerobic; psychrophilic; motile; high-quality draft; prophage-like structures; extrachromosomal elements; assimilatory nitrate reduction; Alphaproteobacteria; Roseobacter clade
20.  Gene transfer agents: phage-like elements of genetic exchange 
Nature reviews. Microbiology  2012;10(7):472-482.
Horizontal gene transfer is important in the evolution of bacterial and archaeal genomes. An interesting genetic exchange process is carried out by diverse phage-like gene transfer agents (GTAs) that are found in a wide range of prokaryotes. Although GTAs resemble phages, they lack the hallmark capabilities that define typical phages, and they package random pieces of the producing cell’s genome. In this Review, we discuss the defining characteristics of the GTAs that have been identified to date, along with potential functions for these agents and the possible evolutionary forces that act on the genes involved in their production.
doi:10.1038/nrmicro2802
PMCID: PMC3626599  PMID: 22683880 CAMSID: cams2872
21.  Morphological and genetic characterization of a bacteriophage-resistant Bacillus subtilis macrofiber-producing strain. 
Journal of Bacteriology  1984;157(1):109-114.
Bacillus subtilis C6 phi R4 is an SPO1-resistant derivative of strain C6D, a left-hand macrofiber-producing strain described previously (N. H. Mendelson, Proc. Natl. Acad. Sci. U.S.A. 75:2478-2482, 1978). In addition to the phage resistance property, strain C6 phi R4 differs from its parent in macrofiber organization and formation of aggregates in liquid shake cultures. The phage resistance mutation was located in the gtaC gene. The macrofiber organization and aggregation phenotypes also appear to be controlled by the gtaC locus. Strains constructed by introduction of the gtaC mutation into C6D appear to be identical to the original C6 phi R4 strain in all phenotypic properties. In contrast, other constructs carrying either gtaA or gtaB that are resistant to SPO1 do not display the characteristic C6 phi R4 morphological phenotypes.
Images
PMCID: PMC215137  PMID: 6418716
22.  Vitamin D Receptor Gene Polymorphisms Are Associated with Obesity and Inflammosome Activity 
PLoS ONE  2014;9(7):e102141.
To explore the mechanisms underlying the suggested role of the vitamin D/vitamin D receptor (VDR) complex in the pathogenesis of obesity we performed genetic and immunologic analyses in obese and non-obese Saudi individuals without other concomitant chronic diseases. Genomic DNA was genotyped for gene single nucleotide polymorphisms (SNPs) of VDR by allelic discrimination in 402 obese (body mass index –BMI≥30 kg/m2) and 489 non-obese (BMI<30 kg/m2) Saudis. Q-PCR analyses were performed using an ABI Prism 7000 Sequence Detection System. The inflammosome pathway was analysed by PCR, cytokines and plasma lipopolysaccaride (LPS) concentrations with ELISA assays. Results showed that the VDR SNPs rs731236 (G) (TaqI) and rs1544410 (T) (Bsm-I) minor allele polymorphisms are significantly more frequent in obese individuals (p = 0.009, β = 0.086 and p = 0.028, β = 0.072, respectively). VDR haplotypes identified are positively (GTA) (p = 0.008, β = 1.560); or negatively (ACC) (p = 0.044, β = 0.766) associated with obesity and higher BMI scores. The GTA "risk" haplotype was characterized by an up-regulation of inflammosome components, a higher production of proinflammatory cytokines (p<0.05) and a lower VDR expression. Plasma LPS concentration was also increased in GTA obese individuals (p<0.05), suggesting an alteration of gut permeability leading to microbial translocation. Data herein indicate that polymorphisms affecting the vitamin D/VDR axis play a role in obesity that is associated with an ongoing degree of inflammation, possibly resulting from alterations of gut permeability and microbial translocation. These results could help the definition of VDR fingerprints that predict an increased risk of developing obesity and might contribute to the identification of novel therapeutic strategies for this metabolic condition.
doi:10.1371/journal.pone.0102141
PMCID: PMC4096505  PMID: 25020064
23.  Proton exchange and local stability in a DNA triple helix containing a G.TA triad 
Nucleic Acids Research  2001;29(20):4231-4237.
Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C+.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.
PMCID: PMC60212  PMID: 11600712
24.  Virucidal Efficacy of Glutaraldehyde against Enteroviruses Is Related to the Location of Lysine Residues in Exposed Structures of the VP1 Capsid Protein 
Glutaraldehyde (GTA) is a potent virucidal disinfectant whose exact mode of action against enteroviruses is not understood. Earlier reports showed that GTA reacts preferentially with the VP1 capsid protein of echovirus 25 and poliovirus 1 and that GTA has affinity for exposed lysine residues on proteins. To investigate further the inactivation of enteroviruses by GTA, seven strains were selected on the basis of differences in their overall number and the positions of lysine residues in the amino acid sequences of the VP1 polypeptide. Inactivation kinetics experiments were performed with 0.10% GTA. The viruses grouped into three clusters and exhibited significantly different levels of sensitivity to GTA. The results were analyzed in the light of current knowledge of the three-dimensional structure of enteroviruses and the viral life cycle. The differences observed in sensitivity to GTA were related to the number of lysine residues and their locations in the VP1 protein. The overall findings suggest that the BC and DE loops, which cluster at the fivefold axis of symmetry and are the most exposed on the outer surface of the virions, are primary reactive sites for GTA.
doi:10.1128/AEM.70.3.1717-1722.2004
PMCID: PMC368296  PMID: 15006797
25.  Loss of the Response Regulator CtrA Causes Pleiotropic Effects on Gene Expression but Does Not Affect Growth Phase Regulation in Rhodobacter capsulatus▿ †  
Journal of Bacteriology  2010;192(11):2701-2710.
The purple nonsulfur photosynthetic bacterium Rhodobacter capsulatus has been extensively studied for its metabolic versatility as well as for production of a gene transfer agent called RcGTA. Production of RcGTA is highest in the stationary phase of growth and requires the response regulator protein CtrA. The CtrA protein in Caulobacter crescentus has been thoroughly studied for its role as an essential, master regulator of the cell cycle. Although the CtrA protein in R. capsulatus shares a high degree of sequence similarity with the C. crescentus protein, it is nonessential and clearly plays a different role in this bacterium. We have used transcriptomic and proteomic analyses of wild-type and ctrA mutant cultures to identify the genes dysregulated by the loss of CtrA in R. capsulatus. We have also characterized gene expression differences between the logarithmic and stationary phases of growth. Loss of CtrA has pleiotropic effects, with dysregulation of expression of ∼6% of genes in the R. capsulatus genome. This includes all flagellar motility genes and a number of other putative regulatory proteins but does not appear to include any genes involved in the cell cycle. Quantitative proteomic data supported 88% of the CtrA transcriptome results. Phylogenetic analysis of CtrA sequences supports the hypothesis of an ancestral ctrA gene within the alphaproteobacteria, with subsequent diversification of function in the major alphaproteobacterial lineages.
doi:10.1128/JB.00160-10
PMCID: PMC2876497  PMID: 20363938

Results 1-25 (932783)