PMCC PMCC

Search tips
Search criteria

Advanced
Results 1-25 (469056)

Clipboard (0)
None

Related Articles

1.  Versatile Transformation System That Is Applicable to both Multiple Transgene Expression and Gene Targeting for Thraustochytrids 
A versatile transformation system for thraustochytrids, a promising producer for polyunsaturated fatty acids and fatty acid-derived fuels, was established. G418, hygromycin B, blasticidin, and zeocin inhibited the growth of thraustochytrids, indicating that multiple selectable marker genes could be used in the transformation system. A neomycin resistance gene (neor), driven with an ubiquitin or an EF-1α promoter-terminator from Thraustochytrium aureum ATCC 34304, was introduced into representatives of two thraustochytrid genera, Aurantiochytrium and Thraustochytrium. The neor marker was integrated into the chromosomal DNA by random recombination and then functionally translated into neor mRNA. Additionally, we confirmed that another two genera, Parietichytrium and Schizochytrium, could be transformed by the same method. By this method, the enhanced green fluorescent protein was functionally expressed in thraustochytrids. Meanwhile, T. aureum ATCC 34304 could be transformed by two 18S ribosomal DNA-targeting vectors, designed to cause single- or double-crossover homologous recombination. Finally, the fatty acid Δ5 desaturase gene was disrupted by double-crossover homologous recombination in T. aureum ATCC 34304, resulting in an increase of dihomo-γ-linolenic acid (C20:3n-6) and eicosatetraenoic acid (C20:4n-3), substrates for Δ5 desaturase, and a decrease of arachidonic acid (C20:4n-6) and eicosapentaenoic acid (C20:5n-3), products for the enzyme. These results clearly indicate that a versatile transformation system which could be applicable to both multiple transgene expression and gene targeting was established for thraustochytrids.
doi:10.1128/AEM.07129-11
PMCID: PMC3346472  PMID: 22344656
2.  A thraustochytrid diacylglycerol acyltransferase 2 with broad substrate specificity strongly increases oleic acid content in engineered Arabidopsis thaliana seeds 
Journal of Experimental Botany  2013;64(11):3189-3200.
Diacylglycerol acyltransferase (DGAT) catalyses the last step in acyl-CoA-dependent triacylglycerol (TAG) biosynthesis and is an important determinant of cellular oil content and quality. In this study, a gene, designated TaDGAT2, encoding a type 2 DGAT (DGAT2)-related enzyme was identified from the oleaginous marine protist Thraustochytrium aureum. The deduced TaDGAT2 sequence contains a ~460 amino acid domain most closely related to DGAT2s from Dictyostelium sp. (45–50% identity). Recombinant TaDGAT2 restored TAG biosynthesis to the Saccharomyces cerevisiae H1246 TAG-deficient mutant, and microsomes from the complemented mutant displayed DGAT activity with C16 and C18 saturated and unsaturated fatty acyl-CoA and diacylglycerol substrates. To examine its biotechnological potential, TaDGAT2 was expressed under control of a strong seed-specific promoter in wild-type Arabidopsis thaliana and the high linoleic acid fad3fae1 mutant. In both backgrounds, little change was detected in seed oil content, but a striking increase in oleic acid content of seeds was observed. This increase was greatest in fad3fae1 seeds, where relative amounts of oleic acid increased nearly 2-fold to >50% of total fatty acids. In addition, >2-fold increase in oleic acid levels was detected in the triacylglycerol sn-2 position and in the major seed phospholipid phosphatidylcholine. These results suggest that increased seed oleic acid content mediated by TaDGAT2 is influenced in part by the fatty acid composition of host cells and occurs not by enhancing oleic acid content at the TAG sn-3 position directly but by increasing total oleic acid levels in seeds, presumably by limiting flux through phosphatidylcholine-based desaturation reactions.
doi:10.1093/jxb/ert156
PMCID: PMC3733143  PMID: 23814277
Arabidopsis; diacylglycerol acyltransferase; fatty acid; oilseed; oleic acid; Thraustochytrium aureum; triacylglycerol
3.  A More Desirable Balanced Polyunsaturated Fatty Acid Composition Achieved by Heterologous Expression of Δ15/Δ4 Desaturases in Mammalian Cells 
PLoS ONE  2013;8(12):e84871.
Arachidonic (ARA), eicosapentaenoic (EPA) and docosahexaenoic (DHA) acids are the most biologically active polyunsaturated fatty acids, but their biosyntheses in mammals are very limited. The biosynthesis of DHA is the most difficult, because this undergoes the Sprecher pathway–a further elongation step from docosapentaenoic acid (DPA), a Δ6-desaturase acting on a C24 fatty acid substrate followed by a peroxisomal chain shortening step. This paper reports the successful heterologous expression of two non-mammalian genes (with modification of codon usage), coding for Euglena gracilis Δ4-desaturase and Siganus canaliculatus Δ4-desaturase respectively, in mammalian cells (HEK293 cell line). Both of the Δ4-desaturases can efficiently function, directly converting DPA into DHA. Moreover, the cooperation of the E. gracilis Δ4-desaturase with C. elegans Δ15-desaturase (able to convert a number of n-6 PUFAs to their corresponding n-3 PUFAs) in transgenic HEK293 cells made a more desirable fatty acid composition – a drastically reduced n-6/n-3 PUFAs ratio and a high level of DHA as well as EPA and ARA. Our findings provide a basis for potential applications of the gene constructs for expression of Δ15/Δ4-desaturases in transgenic livestock to produce such a fatty acid profile in the related products, which certainly will bring benefit to human health.
doi:10.1371/journal.pone.0084871
PMCID: PMC3877351  PMID: 24391980
4.  Arachidonic acid increases matrix metalloproteinase 9 secretion and expression in human monocytic MonoMac 6 cells 
Background
Dietary fatty acids may modulate inflammation in macrophages of the atherosclerotic plaque, affecting its stability. The n-6 polyunsaturated fatty acid (PUFA) arachidonic acid (AA) generally promotes inflammation, while the PUFAs of the n-3 series eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA) and docosahexaenoic acid (DHA) are considered anti-inflammatory. We determined how these PUFAs influence MMP-9 expression and secretion by the human monocytic cell line (MonoMac 6) at baseline and after 24-hour exposure. MMP-9 protein was measured by zymography and relative levels of MMP-9 mRNA were determined using quantitative real time PCR.
Results
Supplementation with AA (but not the n-3 fatty acids) increased, in a dose-dependent manner, expression of MMP-9 protein. This stimulation was regulated at the mRNA level. MMP-9 secretion started after 1 h of incubation and could not be prevented by simultaneous presence of n-3 series fatty acids. Finally, the secretion could be attenuated by LY 294002, a specific phosphatidylinositol-3-kinase (PI3K) inhibitor and by SH-5, a selective Akt inhibitor, suggesting that activation of PI3K by AA leads to augmented and sustained MMP-9 production.
Conclusion
This study shows that of the PUFA studied, AA alone influences the expression of MMP-9, which might have implications in MMP-9 induced plaque rupture.
doi:10.1186/1476-511X-8-11
PMCID: PMC2667508  PMID: 19331685
5.  Development of Genomic Resources for a thraustochytrid Pathogen and Investigation of Temperature Influences on Gene Expression 
PLoS ONE  2013;8(9):e74196.
Understanding how environmental changes influence the pathogenicity and virulence of infectious agents is critical for predicting epidemiological patterns of disease. Thraustochytrids, part of the larger taxonomic class Labyrinthulomycetes, contain several highly pathogenic species, including the hard clam pathogen quahog parasite unknown (QPX). QPX has been associated with large-scale mortality events along the northeastern coast of North America. Growth and physiology of QPX is temperature-dependent, and changes in local temperature profiles influence pathogenicity. In this study we characterize the partial genome of QPX and examine the influence of temperature on gene expression. Genes involved in several biological processes are differentially expressed upon temperature change, including those associated with altered growth and metabolism and virulence. The genomic and transcriptomic resources developed in this study provide a foundation for better understanding virulence, pathogenicity and life history of thraustochytrid pathogens.
doi:10.1371/journal.pone.0074196
PMCID: PMC3775781  PMID: 24069279
6.  Functional Desaturase Fads1 (Δ5) and Fads2 (Δ6) Orthologues Evolved before the Origin of Jawed Vertebrates 
PLoS ONE  2012;7(2):e31950.
Long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic (ARA), eicosapentaenoic (EPA) and docosahexaenoic (DHA) acids are essential components of biomembranes, particularly in neural tissues. Endogenous synthesis of ARA, EPA and DHA occurs from precursor dietary essential fatty acids such as linoleic and α-linolenic acid through elongation and Δ5 and Δ6 desaturations. With respect to desaturation activities some noteworthy differences have been noted in vertebrate classes. In mammals, the Δ5 activity is allocated to the Fads1 gene, while Fads2 is a Δ6 desaturase. In contrast, teleosts show distinct combinations of desaturase activities (e.g. bifunctional or separate Δ5 and Δ6 desaturases) apparently allocated to Fads2-type genes. To determine the timing of Fads1-Δ5 and Fads2-Δ6 evolution in vertebrates we used a combination of comparative and functional genomics with the analysis of key phylogenetic species. Our data show that Fads1 and Fads2 genes with Δ5 and Δ6 activities respectively, evolved before gnathostome radiation, since the catshark Scyliorhinus canicula has functional orthologues of both gene families. Consequently, the loss of Fads1 in teleosts is a secondary episode, while the existence of Δ5 activities in the same group most likely occurred through independent mutations into Fads2 type genes. Unexpectedly, we also establish that events of Fads1 gene expansion have taken place in birds and reptiles. Finally, a fourth Fads gene (Fads4) was found with an exclusive occurrence in mammalian genomes. Our findings enlighten the history of a crucially important gene family in vertebrate fatty acid metabolism and physiology and provide an explanation of how observed lineage-specific gene duplications, losses and diversifications might be linked to habitat-specific food web structures in different environments and over geological timescales.
doi:10.1371/journal.pone.0031950
PMCID: PMC3285190  PMID: 22384110
7.  Plasma Phospholipid Long-Chain Omega-3 Fatty Acids and Total and Cause-Specific Mortality in Older Adults: the Cardiovascular Health Study 
Annals of internal medicine  2013;158(7):515-525.
Background
Long-chain n-3 polyunsaturated fatty acids (n3-PUFA), including eicosapentaenoic acid (EPA/20:5n-3), docosapentaenoic acid (DPA/22:5n-3), and docosahexaenoic acid (DHA/22:6n-3), experimentally reduce cardiovascular risk. Yet, effects on cause-specific and total mortality and potential dose-responses remain controversial. Most observational studies have assessed self-reported dietary intakes, rather than objective biomarkers; while most randomized trials have tested effects of adding supplements to background dietary intake and evaluated secondary prevention, limiting inference for dietary n3-PUFA or primary prevention.
Objective
We investigated associations of plasma phospholipid EPA, DPA, DHA, and total n-3 PUFA with total and cause-specific mortality among generally healthy older adults not taking fish oil supplements.
Design
Prospective cohort, 1992–2008.
Setting
Four U.S. communities.
Participants
2,692 U.S. adults age 75±5 years, free of prevalent coronary heart disease (CHD), stroke, or heart failure.
Measurements
Phospholipid fatty acids and cardiovascular risk factors were measured in 1992 using standardized methods. Relationships with total and cause-specific mortality through 2008, and incident total (fatal+nonfatal) CHD and stroke, were assessed using Cox proportional-hazards.
Results
During 30,829 person-years, 1,625 deaths (including 570 cardiovascular deaths), 359 fatal and 371 nonfatal CHD events, and 130 fatal and 276 nonfatal strokes occurred. After multivariable-adjustment, n3-PUFA biomarkers associated with lower total mortality, with extreme-quintile hazard ratios (95% CI) of 0.83 for EPA (0.71–0.98), 0.77 for DPA (0.66–0.90), 0.80 for DHA (0.67–0.94), and 0.73 for total n3-PUFA (0.61–0.86) (P-trend≤0.008 each). Lower risk was largely attributable to fewer cardiovascular, rather than noncardiovascular, deaths, in particular fewer arrhythmic cardiac deaths (total n3-PUFA: hazard ratio=0.52, 95%CI=0.31–0.86; P-trend=0.008). Based on relations with total mortality, individuals in the highest quintile of phospholipid n3-PUFA, versus the lowest, experienced 2.22 greater years of life (95%CI=0.75–3.13) after age 65.
Limitations
Temporal changes in fatty acid levels and misclassification of death causes may cause underestimated associations; and unmeasured/imperfectly measured covariates, residual confounding.
Conclusions
Circulating individual and total n3-PUFA are associated with lower total mortality, especially CHD death, in older adults.
Primary Funding Source
National Institutes of Health.
doi:10.7326/0003-4819-158-7-201304020-00003
PMCID: PMC3698844  PMID: 23546563
8.  Metabolic Engineering of Saccharomyces cerevisiae for Production of Eicosapentaenoic Acid, Using a Novel Δ5-Desaturase from Paramecium tetraurelia▿  
Very-long-chain polyunsaturated fatty acids, such as arachidonic acid (ARA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA), have well-documented importance in human health and nutrition. Sustainable production in robust host organisms that do not synthesize them naturally requires the coordinated expression of several heterologous desaturases and elongases. In the present study we show production of EPA in Saccharomyces cerevisiae using glucose as the sole carbon source through expression of five heterologous fatty acid desaturases and an elongase. Novel Δ5-desaturases from the ciliate protozoan Paramecium tetraurelia and from the microalgae Ostreococcus tauri and Ostreococcus lucimarinus were identified via a BLAST search, and their substrate preferences and desaturation efficiencies were assayed in a yeast strain producing the ω6 and ω3 fatty acid substrates for Δ5-desaturation. The Δ5-desaturase from P. tetraurelia was up-to-2-fold more efficient than the microalgal desaturases and was also more efficient than Δ5-desaturases from Mortierella alpina and Leishmania major. In vivo investigation of acyl carrier substrate specificities showed that the Δ5-desaturases from P. tetraurelia, O. lucimarinus, O. tauri, and M. alpina are promiscuous toward the acyl carrier substrate but prefer phospholipid-bound substrates. In contrast, the Δ5-desaturase from L. major showed no activity on phospholipid-bound substrate and thus appears to be an exclusively acyl coenzyme A-dependent desaturase.
doi:10.1128/AEM.01935-10
PMCID: PMC3067290  PMID: 21193673
9.  Effects of arachidonic acid on the concentration of hydroxyeicosatetraenoic acids in culture media of mesenchymal stromal cells differentiating into adipocytes or osteoblasts 
Genes & Nutrition  2013;9(1):375.
Metabolites derived from the polyunsaturated fatty acids (PUFA) may modulate the mesenchymal stromal cell (MSC) differentiation. Such cells can differentiate into different cellular types, including adipocytes and osteoblasts. Aging favors the bone marrow MSC differentiation toward the former, causing a loss of bone density associated with pathologies like osteoporosis. The omega-6 arachidonic acid (AA) favors MSC adipogenesis to a greater extent than omega-3 eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). In this work, we study the joint action of both PUFA. Thus, not induced and induced to adipocyte or osteoblast MSC were treated with 20 μM of each PUFA (either AA, AA + DHA or AA + EPA). The expression of osteogenic and adipogenic molecular markers, the alox15b lipoxygenase gene expression and the 5-, 8-, 11-, 12- and 15-hydroxyeicosatetraenoic acids (HETE) derived from the AA metabolism in the culture media were determined. The results show that the adipogenesis induction of AA is not suppressed by the joint presence of EPA and DHA. In fact, both increased the adipogenic effect of AA on MSC differentiated into osteoblasts. The different HETE concentrations increased in cultures supplemented with AA, albeit such concentrations were lower in the cultures induced to differentiate, mainly at day 21 after the induction. Furthermore, the reduction in the HETE concentration was correlated with a higher expression of the alox15b gene. These results highlight the PUFA metabolism differences between uninduced and induced MSC to differentiate into adipocytes and osteoblasts, besides the relevant role of the lipoxygenase gene expression in adipogenesis induction.
doi:10.1007/s12263-013-0375-1
PMCID: PMC3896622  PMID: 24338342
Omega-6; Omega-3; Lipoxygenase; Osteogenesis; Adipogenesis; Hydroxyeicosatetraenoic acid
10.  Effects of perilla oil on plasma concentrations of cardioprotective (n-3) fatty acids and lipid profiles in mice 
Nutrition Research and Practice  2013;7(4):256-261.
The aim of this study was to examine the effects of perilla oil as well as several vegetable oils, including flaxseed oil, canola oil, and rice bran oil on plasma levels of cardioprotective (n-3) polyunsaturated fatty acids in mice by feeding each vegetable oil for a period of eight weeks. Concentrations of docosapentaenoic acid (DHA) and eicosapentaenoic acid (EPA), fish-based (n-3) polyunsaturated fatty acids, showed an increase in the plasma of mice fed perilla and flaxseed oils compared to those of mice in the control group (P < 0.05), whereas rice bran and canola oils did not alter plasma DPA and EPA concentrations. Arachidonic acid concentration was increased by feeding rice bran oil (P < 0.05), but not canola, flaxseed, or perilla oil. In addition, oleic acid, linoleic acid, and docosahexaenoic acid concentrations were altered by feeding dietary rice bran, canola, perilla, and flaxseed oils. Findings of this study showed that perilla oil, similar to flaxseed oil, is cardioprotective and could be used as an alternative to fish oil or even flaxseed oil in animal models.
doi:10.4162/nrp.2013.7.4.256
PMCID: PMC3746158  PMID: 23964311
Perilla oil; flaxseed oil; (n-3) polyunsaturated fatty acids; DPA; EPA
11.  Elongase Reactions as Control Points in Long-Chain Polyunsaturated Fatty Acid Synthesis 
PLoS ONE  2011;6(12):e29662.
Background
Δ6-Desaturase (Fads2) is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA) to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA). However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA), increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA) and docosapentaenoic acid (22:5n-3; DPA), but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA.
Methodology/Principal Findings
The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C20 and C22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3.
Conclusions
The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be critical in understanding if DHA synthesis can be increased by dietary means.
doi:10.1371/journal.pone.0029662
PMCID: PMC3245304  PMID: 22216341
12.  Induction of lipid oxidation by polyunsaturated fatty acids of marine origin in small intestine of mice fed a high-fat diet 
BMC Genomics  2009;10:110.
Background
Dietary polyunsaturated fatty acids (PUFA), in particular the long chain marine fatty acids docosahexaenoic (DHA) and eicosapentaenoic (EPA), are linked to many health benefits in humans and in animal models. Little is known of the molecular response to DHA and EPA of the small intestine, and the potential contribution of this organ to the beneficial effects of these fatty acids. Here, we assessed gene expression changes induced by DHA and EPA in the wildtype C57BL/6J murine small intestine using whole genome microarrays and functionally characterized the most prominent biological process.
Results
The main biological process affected based on gene expression analysis was lipid metabolism. Fatty acid uptake, peroxisomal and mitochondrial beta-oxidation, and omega-oxidation of fatty acids were all increased. Quantitative real time PCR, and -in a second animal experiment- intestinal fatty acid oxidation measurements confirmed significant gene expression differences and showed in a dose-dependent manner significant changes at biological functional level. Furthermore, no major changes in the expression of lipid metabolism genes were observed in the colon.
Conclusion
We show that marine n-3 fatty acids regulate small intestinal gene expression and increase fatty acid oxidation. Since this organ contributes significantly to whole organism energy use, this effect on the small intestine may well contribute to the beneficial physiological effects of marine PUFAs under conditions that will normally lead to development of obesity, insulin resistance and diabetes.
doi:10.1186/1471-2164-10-110
PMCID: PMC2662879  PMID: 19284886
13.  Association of Plasma Phospholipid Long-Chain Omega-3 Fatty Acids with Incident Atrial Fibrillation in Older Adults: The Cardiovascular Health Study 
Circulation  2012;125(9):1084-1093.
Background
Experimental studies suggest long-chain n-3 polyunsaturated fatty acids (n-3 PUFA) may reduce risk of atrial fibrillation (AF). Prior studies evaluating fish or n-3 PUFA consumption from dietary questionnaires and incident AF have been conflicting. Circulating levels of n-3 PUFA provide an objective measurement of exposure.
Methods and Results
Among 3,326 US men and women age≥65y and free of AF or heart failure at baseline, plasma phospholipid levels of eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), and docosahexaenoic acid (DHA) were measured at baseline using standardized methods. Incident AF (789 cases) was prospectively identified from hospital discharge records and study visit electrocardiograms during 31,169 person-years of follow-up (1992-2006). In multivariable Cox models adjusted for other risk factors, the RR in the top versus lowest quartile of total n-3 PUFA (EPA+DPA+DHA) levels was 0.71 (95%CI=0.57-0.89, P-trend=0.004); and of DHA levels, 0.77 (95%CI=0.62-0.96, P-trend=0.01). EPA and DPA levels were not significantly associated with incident AF. Evaluated non-parametrically, both total n-3 PUFA and DHA showed graded and linear inverse associations with incidence of AF. Adjustment for intervening events such as heart failure or myocardial infarction during follow-up did not appreciably alter results.
Conclusions
In older adults, higher circulating total long-chain n-3 PUFA and DHA levels were associated with lower risk of incident AF. These results highlight the need to evaluate whether increased dietary intake of these fatty acids could be effective for primary prevention of AF.
doi:10.1161/CIRCULATIONAHA.111.062653
PMCID: PMC3302663  PMID: 22282329
atrial fibrillation; biomarkers; epidemiology; fatty acids
14.  Plasma Phospholipid Omega‐3 Fatty Acids and Incidence of Postoperative Atrial Fibrillation in the OPERA Trial 
Background
Long‐chain polyunsaturated omega‐3 fatty acids (n‐3 PUFA) demonstrated antiarrhythmic potential in experimental studies. In a large multinational randomized trial (OPERA), perioperative fish oil supplementation did not reduce the risk of postoperative atrial fibrillation (PoAF) in cardiac surgery patients. However, whether presupplementation habitual plasma phospholipid n‐3 PUFA, or achieved or change in n‐3 PUFA level postsupplementation are associated with lower risk of PoAF is unknown.
Methods and Results
In 564 subjects undergoing cardiac surgery between August 2010 and June 2012 in 28 centers across 3 countries, plasma phospholipid levels of eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), and docosahexaenoic acid (DHA) were measured at enrollment and again on the morning of cardiac surgery following fish oil or placebo supplementation (10 g over 3 to 5 days, or 8 g over 2 days). The primary endpoint was incident PoAF lasting ≥30 seconds, centrally adjudicated, and confirmed by rhythm strip or ECG. Secondary endpoints included sustained (≥1 hour), symptomatic, or treated PoAF; the time to first PoAF; and the number of PoAF episodes per patient. PoAF outcomes were assessed until hospital discharge or postoperative day 10, whichever occurred first. Relative to the baseline, fish oil supplementation increased phospholipid concentrations of EPA (+142%), DPA (+13%), and DHA (+22%) (P<0.001 each). Substantial interindividual variability was observed for change in total n‐3 PUFA (range=−0.7% to 7.5% after 5 days of supplementation). Neither individual nor total circulating n‐3 PUFA levels at enrollment, morning of surgery, or change between these time points were associated with risk of PoAF. The multivariable‐adjusted OR (95% CI) across increasing quartiles of total n‐3 PUFA at enrollment were 1.0, 1.06 (0.60 to 1.90), 1.35 (0.76 to 2.38), and 1.19 (0.64 to 2.20); and for changes in n‐3 PUFA between enrollment and the morning of surgery were 1.0, 0.78 (0.44 to 1.39), 0.89 (0.51 to 1.55), and 1.01 (0.58 to 1.75). In stratified analysis, demographic, medication, and cardiac parameters did not significantly modify these associations. Findings were similar for secondary PoAF endpoints.
Conclusions
Among patients undergoing cardiac surgery, neither higher habitual circulating n‐3 PUFA levels, nor achieved levels or changes following short‐term fish oil supplementation are associated with risk of PoAF.
Clinical Trial Registration
URL: Clinicaltrials.gov Unique identifier: NCT00970489
doi:10.1161/JAHA.113.000397
PMCID: PMC3835252  PMID: 24145742
biomarker; cardiac surgery; omega‐3 fatty acids; postoperative atrial fibrillation; randomized controlled trial
15.  Dietary fish oil modulates macrophage fatty acids and decreases arthritis susceptibility in mice 
The Journal of Experimental Medicine  1985;162(4):1336-1349.
B10.RIII and B10.G mice were transferred from a diet of laboratory rodent chow to a standard diet in which all the fat (5% by weight) was supplied as either fish oil (17% eicosapentaenoic acid [EPA], 12% docosahexaenoic acid [DHA], 0% arachidonic acid [AA], and 2% linoleic acid) or corn oil (0% EPA, 0% DHA, 0% AA, and 65% linoleic acid). The fatty acid composition of the macrophage phospholipids from mice on the chow diet was similar to that of mice on a corn oil diet. Mice fed the fish oil diet for only 1 wk showed substantial increases in macrophage phospholipid levels of the omega-3 fatty acids (of total fatty acid 4% was EPA, 10% docosapentaenoic acid [DPA], and 10% DHA), and decreases in omega-6 fatty acids (12% was AA, 2% docosatetraenoic acid [DTA], and 4% linoleic acid) compared to corn oil-fed mice (0% EPA, 0% DPA, 6% DHA, 20% AA, 9% DTA, and 8% linoleic acid). After 5 wk this difference between the fish oil-fed and corn oil-fed mice was even more pronounced. Further small changes occurred at 5-9 wk. We studied the prostaglandin (PG) and thromboxane (TX) profile of macrophages prepared from mice fed the two diets just before being immunized with collagen. Irrespective of diet, macrophages prepared from female mice and incubated for 24 h had significantly more PG and TX in the medium than similarly prepared macrophages from male mice. The increased percentage of EPA and decreased percentage of AA in the phospholipids of the macrophages prepared from the fish oil-fed mice was reflected in a reduction in the amount of PGE2 and PGI2 in the medium relative to identically incubated macrophages prepared from corn oil-fed mice. When this same fish oil diet was fed to B10.RIII mice for 26 d before immunization with type II collagen, the time of onset of arthritis was increased, and the incidence and severity of arthritis was reduced compared to arthritis induced in corn oil-fed mice. The females, especially those on the fish oil diet, tended to have less arthritis than the males. These alterations in the fatty acid pool available for PG and leukotriene synthesis suggest a pivotal role for the macrophage and PG in the immune and/or inflammatory response to type II collagen.
PMCID: PMC2187871  PMID: 3930652
16.  N-3 Polyunsaturated Fatty Acids Suppress Insulin-induced SREBP-1c Transcription via Reduced Trans-activating Capacity of LXRα 
Biochimica et biophysica acta  2009;1791(12):1190-1196.
Insulin coordinately up-regulates lipogenic gene transcription via induction of sterol regulatory element binding protein-1c (SREBP-1c). Conversely, polyunsaturated fatty acids (PUFA) decrease lipogenic gene transcription via suppression of SREBP-1c. We therefore examined the ability of n-3 PUFA to mitigate induction of SREBP-1c and its downstream lipogenic targets by insulin in primary rat hepatocyte cultures. Insulin induced expression of SREBP-1c mRNA 5–6 fold as well as rat SREBP-1c promoter activity. These effects were prevented by the n-3 fatty acids eicosapentaenoic acid (20:5 n-3; EPA) and docosahexaenoic acid (22:6 n-3, DHA), but not by the monounsaturated fatty acid oleic acid (18:1 n-6, OLA). N-3 fatty acids also effectively prevented insulin induction of the downstream lipogenic enzyme targets fatty acid synthase (FAS) and acetyl carboxyl coenzyme acetyltransferase-1 (ACC-1), and reduced de novo lipogenesis. The SREBP-1c promoter contains an insulin response unit consisting of tandem LXRα response elements (LXREs) as well as sites for NF-Y, Sp1, and SREBP-1c itself. The LXREs were identified as a primary site mediating suppression of SREBP-1c transcription by n-3 PUFA. DHA effectively prevented LXRα-dependent activation of both the wild type SREBP-1c promoter and the synthetic LXRE-driven promoter, and significantly blunted LXRα-dependent activation of a Gal4-LXRα chimeric protein thus demonstrating that n-3 PUFA effectively mitigate induction of SREBP-1c by insulin via reduced trans-activation of LXRα.
doi:10.1016/j.bbalip.2009.08.008
PMCID: PMC2783506  PMID: 19716432
Sterol response element binding protein-1c; insulin; polyunsaturated fatty acids; docosahexaenoic acid; eicosapentaenoic acid; liver x receptor alpha
17.  Polyunsaturated fatty acids stimulate phosphatidylcholine synthesis in PC12 cells 
Biochimica et biophysica acta  2007;1771(4):558-563.
The synthesis of phospholipids in mammalian cells is regulated by the availability of three critical precursor pools: those of choline, cytidine triphosphate and diacylglycerol. Diacylglycerols containing polyunsaturated fatty acids (PUFAs) apparently are preferentially utilized for phosphatide synthesis. PUFAs are known to play an important role in the development and function of mammalian brains. We therefore studied the effects of unsaturated, monounsaturated and polyunsaturated fatty acids on the overall rates of phospholipid biosynthesis in PC12 rat pheochromocytoma cells. Docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (AA, 20:4n-6) all significantly stimulated the incorporation of 14C-choline into total cellular phospholipids. In contrast, monounsaturated oleic acid (OA) and the unsaturated palmitic (PA) and stearic (SA) acids did not have this effect. The action of DHA was concentration-dependent between 5 and 50 μM; it became statistically significant by 3 hrs after DHA treatment and then increased over the ensuing 3 hours. DHA was preferentially incorporated into phosphatidylethanolamine (PE) and phosphatidylserine (PS), while AA predominated in phosphatidylcholine (PC).
doi:10.1016/j.bbalip.2007.01.016
PMCID: PMC1935022  PMID: 17350887
membrane metabolism; phospholipids; docosahexaenoic acid; eicosapentaenoic acid; arachidonic acid; PC12 cells
18.  Genetic Loci Associated with Plasma Phospholipid n-3 Fatty Acids: A Meta-Analysis of Genome-Wide Association Studies from the CHARGE Consortium 
PLoS Genetics  2011;7(7):e1002193.
Long-chain n-3 polyunsaturated fatty acids (PUFAs) can derive from diet or from α-linolenic acid (ALA) by elongation and desaturation. We investigated the association of common genetic variation with plasma phospholipid levels of the four major n-3 PUFAs by performing genome-wide association studies in five population-based cohorts comprising 8,866 subjects of European ancestry. Minor alleles of SNPs in FADS1 and FADS2 (desaturases) were associated with higher levels of ALA (p = 3×10−64) and lower levels of eicosapentaenoic acid (EPA, p = 5×10−58) and docosapentaenoic acid (DPA, p = 4×10−154). Minor alleles of SNPs in ELOVL2 (elongase) were associated with higher EPA (p = 2×10−12) and DPA (p = 1×10−43) and lower docosahexaenoic acid (DHA, p = 1×10−15). In addition to genes in the n-3 pathway, we identified a novel association of DPA with several SNPs in GCKR (glucokinase regulator, p = 1×10−8). We observed a weaker association between ALA and EPA among carriers of the minor allele of a representative SNP in FADS2 (rs1535), suggesting a lower rate of ALA-to-EPA conversion in these subjects. In samples of African, Chinese, and Hispanic ancestry, associations of n-3 PUFAs were similar with a representative SNP in FADS1 but less consistent with a representative SNP in ELOVL2. Our findings show that common variation in n-3 metabolic pathway genes and in GCKR influences plasma phospholipid levels of n-3 PUFAs in populations of European ancestry and, for FADS1, in other ancestries.
Author Summary
Circulating long-chain n-3 polyunsaturated fatty acids (PUFAs) derive from fatty fish or from the conversion of the plant n-3 PUFA by elongation and desaturation. We looked for common genetic markers throughout the genome that might influence plasma phospholipid levels of the four major n-3 PUFAs in five large studies and pooled the results. We found that levels of all four n-3 PUFAs were associated with genetic markers in known desaturation and elongation genes. We also found evidence that conversion of the plant n-3 PUFA to longer chain n-3 PUFAs is less effective in people with certain desaturation-gene markers, which could be important for people who do not eat fish. We also found a marker in a gene involved in glucose metabolism, called the glucokinase regulator, to be associated with one intermediate n-3 PUFA. Some of these findings were seen across multiple race/ethnicities. Overall, these results have implications for how genes and the environment interact to influence circulating levels of fatty acids.
doi:10.1371/journal.pgen.1002193
PMCID: PMC3145614  PMID: 21829377
19.  Changes in plasma and erythrocyte omega-6 and omega-3 fatty acids in response to intravenous supply of omega-3 fatty acids in patients with hepatic colorectal metastases 
Background
Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are functionally the most important omega-3 polyunsaturated fatty acids (PUFAs). Oral supply of these fatty acids increases their levels in plasma and cell membranes, often at the expense of the omega-6 PUFAs arachidonic acid (ARA) and linoleic acid. This results in an altered pattern of lipid mediator production to one which is less pro-inflammatory. We investigated whether short term intravenous supply of omega-3 PUFAs could change the levels of EPA, DHA, ARA and linoleic acid in plasma and erythrocytes in patients with hepatic colorectal metastases.
Methods
Twenty patients were randomised to receive a 72 hour infusion of total parenteral nutrition with (treatment group) or without (control group) omega-3 PUFAs. EPA, DHA, ARA and linoleic acid were measured in plasma phosphatidylcholine (PC) and erythrocytes at several times points up to the end of infusion and 5 to 12 days (mean 9 days) after stopping the infusion.
Results
The treatment group showed increases in plasma PC EPA and DHA and erythrocyte EPA and decreases in plasma PC and erythrocyte linoleic acid, with effects most evident late in the infusion period. Plasma PC and erythrocyte EPA and linoleic acid all returned to baseline levels after the 5–12 day washout. Plasma PC DHA remained elevated above baseline after washout.
Conclusions
Intravenous supply of omega-3 PUFAs results in a rapid increase of EPA and DHA in plasma PC and of EPA in erythrocytes. These findings suggest that infusion of omega-3 PUFAs could be used to induce a rapid effect especially in targeting inflammation.
Trial registration
http://www.clinicaltrials.gov identifier NCT00942292
doi:10.1186/1476-511X-12-64
PMCID: PMC3659039  PMID: 23648075
Parenteral nutrition; Fish oil; Omega-3 fatty acids; Eicosapentaenoic acid; Docosahexaenoic acid; Arachidonic acid; Liver metastases
20.  Impact of Docosahexaenoic Acid on Gene Expression during Osteoclastogenesis in Vitro—A Comprehensive Analysis 
Nutrients  2013;5(8):3151-3162.
Polyunsaturated fatty acids (PUFAs), especially n-3 polyunsaturated fatty acids, docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), are known to protect against inflammation-induced bone loss in chronic inflammatory diseases, such as rheumatoid arthritis, periodontitis and osteoporosis. We previously reported that DHA, not EPA, inhibited osteoclastogenesis induced by the receptor activator of nuclear factor-κB ligand (sRANKL) in vitro. In this study, we performed gene expression analysis using microarrays to identify genes affected by the DHA treatment during osteoclastogenesis. DHA strongly inhibited osteoclastogenesis at the late stage. Among the genes upregulated by the sRANKL treatment, 4779 genes were downregulated by DHA and upregulated by the EPA treatment. Gene ontology analysis identified sets of genes related to cell motility, cell adhesion, cell-cell signaling and cell morphogenesis. Quantitative PCR analysis confirmed that DC-STAMP, an essential gene for the cell fusion process in osteoclastogenesis, and other osteoclast-related genes, such as Siglec-15, Tspan7 and Mst1r, were inhibited by DHA.
doi:10.3390/nu5083151
PMCID: PMC3775247  PMID: 23945674
polyunsaturated fatty acid; docosahexaenoic acid; osteoclast
21.  Two thraustochytrid 5S ribosomal RNAs. 
Nucleic Acids Research  1982;10(24):8307-8310.
The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.
PMCID: PMC327087  PMID: 7162992
22.  Inhibitory effects of docosahexaenoic acid on colon carcinoma 26 metastasis to the lung. 
British Journal of Cancer  1997;75(5):650-655.
Unsaturated fatty acids, including n-3 polyunsaturated fatty acids (PUFAs) such as docosahexaenoic acid (C22:6, DHA) and eicosapentaenoic acid (C20:5, EPA), and a series of n-6 PUFAs were investigated for their anti-tumour and antimetastatic effects in a subcutaneous (s.c.) implanted highly metastatic colon carcinoma 26 (Co 26Lu) model. EPA and DHA exerted significant inhibitory effects on tumour growth at the implantation site and significantly decreased the numbers of lung metastatic nodules. Oleic acid also significantly inhibited lung metastatic nodules. Treatment with arachidonic acid showed a tendency for reduction in colonization. However, treatment with high doses of fatty acids, especially linoleic acid, increased the numbers of lung metastatic nodules. DHA and EPA only inhibited lung colonizations when administered together with the tumour cells, suggesting that their incorporation is necessary for an influence to be exerted. Chromatography confirmed that contents of fatty acids in both tumour tissues and plasma were indeed affected by the treatments. Tumour cells pretreated with fatty acids in vivo, in particular DHA, also showed a low potential for lung colony formation when transferred to new hosts. Thus, DHA treatment exerted marked antimetastatic activity associated with pronounced change in the fatty acid component of tumour cells. The results indicate that uptake of DHA into tumour cells results in altered tumour cell membrane characteristics and a decreased ability to metastasize.
PMCID: PMC2063338  PMID: 9043019
23.  The Influence of Polyunsaturated Fatty Acids on the Phospholipase D Isoforms Trafficking and Activity in Mast Cells 
The impact of polyunsaturated fatty acid (PUFA) supplementation on phospholipase D (PLD) trafficking and activity in mast cells was investigated. The enrichment of mast cells with different PUFA including α-linolenic acid (LNA), eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), linoleic acid (LA) or arachidonic acid (AA) revealed a PUFA-mediated modulation of the mastoparan-stimulated PLD trafficking and activity. All PUFA examined, except AA, prevented the migration of the PLD1 to the plasma membrane. For PLD2 no PUFA effects on trafficking could be observed. Moreover, PUFA supplementation resulted in an increase of mastoparan-stimulated total PLD activity, which correlated with the number of double bonds of the supplemented fatty acids. To investigate, which PLD isoform was affected by PUFA, stimulated mast cells were supplemented with DHA or AA in the presence of specific PLD-isoform inhibitors. It was found that both DHA and AA diminished the inhibition of PLD activity in the presence of a PLD1 inhibitor. By contrast, only AA diminished the inhibition of PLD activity in the presence of a PLD2 inhibitor. Thus, PUFA modulate the trafficking and activity of PLD isoforms in mast cells differently. This may, in part, account for the immunomodulatory effect of unsaturated fatty acids and contributes to our understanding of the modulation of mast cell activity by PUFA.
doi:10.3390/ijms14059005
PMCID: PMC3676769  PMID: 23698760
phospholipase D; polyunsaturated fatty acids; mast cells; exocytosis
24.  A mechanism underlying the effects of polyunsaturated fatty acids on breast cancer 
Breast cancer is the most frequent cancer in women. Evidence suggests that the polyunsaturated fatty acids (PUFAs), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) affect breast cancer proliferation, differentiation and prognosis. However, the mechanism still remains unclear. In this study, the expression of transient receptor potential canonical (TRPC)3 was detected throughout the cell cytoplasm and at the cell surface of MCF-7 cells. Ca2+ entry was induced in these cells via activated TRPC3 by either the diacylglycerol analogue (OAG) or by intracellular Ca2+ store depletion. TRPC-mediated Ca2+ entry was inhibited by PUFAs including arachidonic acid (AA) and linolenic acid (LA) but not saturated fatty acids. Overexpression of the PUFA degradation enzyme, cyclooxygenase 2 (COX2), enhanced capacitative Ca2+ entry. In addition, inhibition of COX2 reduced [Ca2+]i. Nevertheless, inhibition of TRPC reduced the cell cycle S phase and cell migration, implicating a functional role for TRP-mediated Ca2+ entry in cell proliferation and invasion. Exogenous PUFA as well as a TRPC3 antagonist consistently attenuated breast cancer cell proliferation and migration, suggesting a mechanism in which PUFA restrains the breast cancer partly via its inhibition of TRPC channels. Additionally, our results also suggest that TRPC3 appears as a new mediator of breast cancer cell migration/invasion and represents a potential target for a new class of anticancer agent.
doi:10.3892/ijmm.2012.1022
PMCID: PMC3573739  PMID: 22692672
MCF-7; TRP channel; arachidonic acid; metabolites; proliferation; migration
25.  Current Evidence Linking Polyunsaturated Fatty Acids with Cancer Risk and Progression 
Frontiers in Oncology  2013;3:224.
There is increasing evidence that polyunsaturated fatty acids (PUFAs) play a role in cancer risk and progression. The n-3 family of PUFAs includes alpha-linolenic acid (ALA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) while the n-6 family includes linolenic acid (LA) and arachidonic acid (AA). EPA and DHA are precursors for anti-inflammatory lipid mediators while AA is a precursor for pro-inflammatory lipid mediators. Collectively, PUFAs play crucial roles in maintaining cellular homeostasis, and perturbations in dietary intake or PUFA metabolism could result in cellular dysfunction and contribute to cancer risk and progression. Epidemiologic studies provide an inconsistent picture of the associations between dietary PUFAs and cancer. This discrepancy may reflect the difficulties in collecting accurate dietary data; however, it also may reflect genetic variation in PUFA metabolism which has been shown to modify physiological levels of PUFAs and cancer risk. Also, host-specific mutations as a result of cellular transformation could modify metabolism of PUFAs in the target-tissue. Clinical trials have shown that supplementation with PUFAs or foods high in PUFAs can affect markers of inflammation, immune function, tumor biology, and prognosis. Pre-clinical investigations have begun to elucidate how PUFAs may mediate cell proliferation, apoptosis and angiogenesis, and the signaling pathways involved in these processes. The purpose of this review is to summarize the current evidence linking PUFAs and their metabolites with cancer and the molecular mechanisms that underlie this association. Identifying the molecular mechanism(s) through which PUFAs affect cancer risk and progression will provide an opportunity to pursue focused dietary interventions that could translate into the development of personalized diets for cancer control.
doi:10.3389/fonc.2013.00224
PMCID: PMC3761560  PMID: 24027672
polyunsaturated fatty acids; cancer; pre-clinical testing; epidemiologic studies; clinical trials as topic; clinical trials; phase II as topic; review of literature

Results 1-25 (469056)