Related Articles
There are two primary levels of control of the expression of the fructanase gene (fruA) of Streptococcus mutans: induction by levan, inulin, or sucrose and repression in the presence of glucose and other readily metabolized sugars. The goals of this study were to assess the functionality of putative cis-acting regulatory elements and to begin to identify the trans-acting factors involved in induction and catabolite repression of fruA. The fruA promoter and its derivatives generated by deletions and/or site-directed mutagenesis were fused to a promoterless chloramphenicol acetyltransferase (CAT) gene as a reporter, and strains carrying the transcriptional fusions were then analyzed for CAT activities in response to growth on various carbon sources. A dyadic sequence, ATGACA(TC)TGTCAT, located at −72 to −59 relative to the transcription initiation site was shown to be essential for expression of fruA. Inactivation of the genes that encode fructose-specific enzymes II resulted in elevated expression from the fruA promoter, suggesting negative regulation of fruA expression by the fructose phosphotransferase system. Mutagenesis of a terminator-like structure located in the 165-base 5′ untranslated region of the fruA mRNA or insertional inactivation of antiterminator genes revealed that antitermination was not a mechanism controlling induction or repression of fruA, although the untranslated leader mRNA may play a role in optimal expression of fructanase. Deletion or mutation of a consensus catabolite response element alleviated glucose repression of fruA, but interestingly, inactivation of the ccpA gene had no discernible effect on catabolite repression of fruA. Accumulating data suggest that expression of fruA is regulated by a mechanism that has several unique features that distinguish it from archetypical polysaccharide catabolic operons of other gram-positive bacteria.
doi:10.1128/JB.184.1.126-133.2002
PMCID: PMC134753
PMID: 11741852
A genetic library of Streptococcus mutans GS-5, constructed in an Escherichia coli plasmid vector, was screened for cells which could utilize sucrose as the sole carbon and energy source. The recombinant plasmid pFRU1, containing a 4.2-kilobase pair insert of S. mutans DNA, was shown to confer this phenotype. Further characterization of the gene product encoded by pFRU1 revealed that the enzyme was a beta-D-fructosidase with the highest specificity for the beta (2----6)-linked fructan polymer levan. The enzyme could also hydrolyze inulin [beta (2----1)-linked fructan], sucrose, and raffinose with 34, 21, and 12%, respectively, of the activity observed for levan. The gene (designated fruA) appeared to be expressed under its own control in E. coli, as judged by the lack of influence on gene product activity of induction or repression of the beta-galactosidase promoter adjacent to the insertion site on the cloning vector. The protein was purified to homogeneity, as judged by silver staining of purified protein in denaturing and reducing conditions in polyacrylamide gels, from sonic lysate of E. coli, as well as from culture supernatants of S. mutans GS-5 grown in a chemostat at low dilution rate with fructose as the sole carbohydrate source. Both purified proteins had an apparent molecular mass of 140,000 daltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, were immunologically related and comigrated in sodium dodecyl sulfate-polyacrylamide gel electrophoresis as determined by Western blotting with antisera raised against the cloned gene product, and were identical in all physical and biochemical properties tested. The pH optimum of the enzyme acting on fructan polymers was 5.5, with a significant amount of activity remaining at pH 4.0. The optimum pH for sucrose degradation was broader and lower, with a peak at approximately 4.5. Enzyme activity was inhibited almost completely by Hg2+ and Ag2+, inhibited partially by Cu2+, not inhibited by fluoride ion or Tris, and slightly stimulated by Mn2+ and Co2+. Fructan polymers were attacked exohydrolytically by the enzyme, fructose being the only product released. With sufficient time, both levan and inulin were degraded to completion, with no evidence of product inhibition.
Images
PMCID: PMC213815
PMID: 3308844
Summary
Streptococcus mutans is particularly well-adapted for high-affinity, high-capacity catabolism of multiple carbohydrate sources. S. mutans EIILev, a fructose/mannose permease encoded by the levDEFG genes, and fruA, which encodes a hydrolase that releases fructose from fructan polymers, are transcriptionally regulated by the LevQRST four-component signal transduction system. Here, we demonstrate that (1) levDEFGX are co-transcribed and the levE/F intergenic region is required for optimal expression of levFGX; (2) D-mannose is a potent inducer of the levD and fruA operons; (3) CcpA regulates levD expression in a carbohydrate-specific manner; (4) deletion of the genes for the fructose/mannose-EII enzymes of S. mutans (manL, fruI, and levD) enhances levD expression; (5) repression of the LevQRST regulon by EII enzymes depends on the presence of their substrates and requires LevR, but not LevQST; and (6) CcpA inhibits expression of the manL and frul genes to indirectly control the LevQRST regulon. Further, the manL, ccpA, frul/fruCD and levD gene products differentially exert control over the cellobiose and lactose operons. Collectively, the results reveal the existence of a global regulatory network in S. mutans that governs the utilization of non-preferred carbohydrates in response to the availability and source of multiple preferred carbohydrates.
doi:10.1111/j.1365-2958.2008.06403.x
PMCID: PMC2583961
PMID: 18699864
Sugar:phosphotransferase system; β-D-fructosidase; Catabolite repression; CcpA; Gene regulation
Transcription of the genes for a fructan hydrolase (fruA) and a
fructose/mannose sugar:phosphotransferase permease (levDEFG) in
Streptococcus mutans is activated by a four-component
regulatory system consisting of a histidine kinase (LevS), a response regulator
(LevR) and two carbohydrate-binding proteins (LevQT). The expression of the
fruA and levD operons was at baseline in a
levQ mutant and substantially decreased in a
levT null mutant, with lower expression with the cognate
inducers fructose or mannose, but slightly higher expression in glucose or
galactose. A strain expressing levQ with two point mutations
(E170A/F292S) did not require inducers to activate gene expression and displayed
altered levD expression when growing on various carbohydrates,
including cellobiose. Linker-scanning (LS) mutagenesis was used to generate
three libraries of mutants of levQ, levS and
levT that displayed various levels of altered substrate
specificity and of fruA/levD gene expression. The data support
that LevQ and LevT are intimately involved in the sensing of carbohydrate
signals, and that LevQ appears to be required for the integrity of the signal
transduction complex, apparently by interacting with the sensor kinase LevS.
doi:10.1371/journal.pone.0017335
PMCID: PMC3043104
PMID: 21364902
Polymers of D-fructose produced by a variety of oral bacteria are believed to function as extracellular carbohydrate reserves. Degradation of these polysaccharides in plaque following exhaustion of dietary carbohydrates is thought to contribute to the extent and duration of the acid challenge to the tooth surface and thus to the initiation and progression of dental caries. Streptococcus mutans produces a fructanase, the product of the fruA gene, which is capable of degrading beta(2,6)- and beta(2,1)-linked fructans that are commonly synthesized by dental plaque microorganisms. To evaluate the role of the FruA protein in exopolysaccharide metabolism and to assess the contribution of this enzyme to the pathogenic potential of S. mutans, a fructanase-deficient strain of S. mutans was constructed. Inactivation of a cloned fruA gene was accomplished in Escherichia coli by using a mini-Mu dE transposon, and then an isogenic mutant of S. mutans UA159 was constructed by allelic exchange. Successful inactivation of fruA was confirmed through the use of biochemical assays, Western blotting (immunoblotting) with anti-recombinant FruA antisera, and Southern hybridization. The data indicated that FruA was the only fructan hydrolase produced by S. mutans UA159. Inactivation of fruA had no significant effects on glucosyltransferase or fructosyltransferase activity. In the rat caries model using animals fed a high-sucrose diet and ad libitum, there were no significant differences in the number or severity of smooth surface, sulcal, or root caries elicited by the fruA mutant and the wild-type organism.
Images
PMCID: PMC257376
PMID: 1500176
Commensal oral streptococci play critical roles in oral biofilm formation and promote dental health by competing with, and antagonizing the growth of, pathogenic organisms, such as Streptococcus mutans. Efficient utilization of the spectrum of carbohydrates in the oral cavity by commensal streptococci is essential for their persistence, and yet very little is known about the regulation of carbohydrate catabolism by these organisms. Carbohydrate catabolite repression (CCR) in the abundant oral commensal Streptococcus gordonii strain DL-1 was investigated using the exo-β-d-fructosidase gene (fruA) and a fructose/mannose sugar:phosphotransferase (PTS) enzyme II operon (levDEFG) as model systems. Functional studies confirmed the predicted roles of FruA and LevD in S. gordonii. ManL, the AB domain of a fructose/mannose-type enzyme II PTS permease, contributed to utilization of glucose, mannose, galactose, and fructose and exerted primary control over CCR of the fruA and levD operons. Unlike in S. mutans, ManL-dependent CCR was not sugar specific, and galactose was very effective at eliciting CCR in S. gordonii. Inactivation of the apparent ccpA homologue of S. gordonii actually enhanced CCR of fruA and levD, an effect likely due to its demonstrated role in repression of manL expression. Thus, there are some similarities and fundamental differences in CCR control mechanisms between the oral pathogen S. mutans and the oral commensal S. gordonii that may eventually be exploited to enhance the competitiveness of health-associated commensals in oral biofilms.
doi:10.1128/AEM.02385-10
PMCID: PMC3067331
PMID: 21239541
CcpA globally regulates transcription in response to carbohydrate availability in many gram-positive bacteria, but its role in Streptococcus mutans remains enigmatic. Using the fructan hydrolase (fruA) gene of S. mutans as a model, we demonstrated that CcpA plays a direct role in carbon catabolite repression (CCR). Subsequently, the expression of 170 genes was shown to be differently expressed (≥2-fold) in glucose-grown wild-type (UA159) and CcpA-deficient (TW1) strains (P ≤ 0.001). However, there were differences in expression of only 96 genes between UA159 and TW1 when cells were cultivated with the poorly repressing substrate galactose. Interestingly, 90 genes were expressed differently in wild-type S. mutans when glucose- and galactose-grown cells were compared, but the expression of 515 genes was altered in the CcpA-deficient strain in a similar comparison. Overall, our results supported the hypothesis that CcpA has a major role in CCR and regulation of gene expression but revealed that in S. mutans there is a substantial CcpA-independent network that regulates gene expression in response to the carbohydrate source. Based on the genetic studies, biochemical and physiological experiments demonstrated that loss of CcpA impacts the ability of S. mutans to transport and grow on selected sugars. Also, the CcpA-deficient strain displayed an enhanced capacity to produce acid from intracellular stores of polysaccharides, could grow faster at pH 5.5, and could acidify the environment more rapidly and to a greater extent than the parental strain. Thus, CcpA directly modulates the pathogenic potential of S. mutans through global control of gene expression.
doi:10.1128/JB.01237-07
PMCID: PMC2293215
PMID: 18223086
The phosphoenolpyruvate:sugar phosphotransferase system (PTS) is the major carbohydrate transport system in oral streptococci. The mannose-PTS of Streptococcus mutans, which transports mannose and glucose, is involved in carbon catabolite repression (CCR) and regulates the expression of known virulence genes. In this study, we investigated the role of EIIGlc and EIIABMan in sugar metabolism, gene regulation, biofilm formation, and competence. The results demonstrate that the inactivation of ptsG, encoding a putative EIIGlc, did not lead to major changes in sugar metabolism or affect the phenotypes of interest. However, the loss of EIIGlc was shown to have a significant impact on the proteome and to affect the expression of a known virulence factor, fructan hydrolase (fruA). JAM1, a mutant strain lacking EIIABMan, had an impaired capacity to form biofilms in the presence of glucose and displayed a decreased ability to be transformed with exogenous DNA. Also, the lactose- and cellobiose-PTSs were positively and negatively regulated by EIIABMan, respectively. Microarrays were used to investigate the profound phenotypic changes displayed by JAM1, revealing that EIIABMan of S. mutans has a key regulatory role in energy metabolism, possibly by sensing the energy levels of the cells or the carbohydrate availability and, in response, regulating the activity of transcription factors and carbohydrate transporters.
doi:10.1128/JB.00169-06
PMCID: PMC1482907
PMID: 16707667
The complete nucleotide sequence (5,010 bp) of the fructanase gene (fruA) and flanking regions of the chromosome of Streptococcus mutans GS-5 was determined. The fruA gene appears to be the sole transcript arising from a proximal promoter. The presumed precursor of the secreted FruA protein consists of 1,423 amino acids, and it has an M(r) of 158,656 and a pI of 4.82. The N terminus of FruA has characteristics in common with signal peptides of gram-positive organisms. The C terminus consists of a serine- and threonine-rich region, followed by the peptide LPDTGD, 4 charged amino acids, 21 amino acids with a strongly hydrophobic character, and a charged pentapeptide tail, which are proposed to correspond to the wall-spanning region, the LPXTGX consensus sequence, and the membrane-spanning domains of surface-associated proteins of gram-positive cocci. The FruA protein has significant homology with the Bacillus subtilis levanase (SacC), the Bacteroides fragilis levanase (ScrL), yeast invertases, and a number of other beta-fructosidases but not with fructosyltransferase, glucosyltransferases, or glucan-binding proteins of oral streptococci. Genes with homology to fruA were detected in S. mutans serotype c, e, and f strains, Streptococcus rattus, Streptococcus salivarius, and Streptococcus sanguis. A deletion derivative of FruA lacking the C-terminal 437 amino acids was still functional and could hydrolyze beta-(2,6)- and beta-(2,1)-linked sugars, but with altered preference for substrates. The data begin to define functional domains of the FruA protein and potential regulatory sites for induction, repression, growth rate control, and posttranslational localization of this multifunctional enzyme.
Images
PMCID: PMC258211
PMID: 1398976
Myxococcus xanthus uses extracellular signals during development to regulate gene expression. C-signaling regulates the expression of many genes induced after 6 h into development. FruA is a protein that is necessary for cells to respond to C-signaling, but expression of the fruA gene does not depend on C-signaling. Yet the fruA promoter region has a C box and a 5-bp element, similar to the promoter regions of several C-signal-dependent genes, where these sequences are crucial. Here, we show that the C box and 5-bp elements are important for expression of fruA, demonstrating for the first time that these sequences play a role in the expression of a gene that does not depend on C-signaling and is required for M. xanthus development.
doi:10.1128/JB.186.17.5961-5967.2004
PMCID: PMC516827
PMID: 15317804
The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain.
doi:10.1128/JB.00318-06
PMCID: PMC1539954
PMID: 16816188
Oral streptococci, such as Streptococcus gordonii, are the predominant early colonizers that initiate biofilm formation on tooth surfaces. Investigation of an S. gordonii::Tn917-lac biofilm-defective mutant isolated by using an in vitro biofilm formation assay showed that the transposon insertion is near the 3′ end of an open reading frame (ORF) encoding a protein homologous to Streptococcus mutans FruK. Three genes, fruR, fruK, and fruI, were predicted to encode polypeptides that are part of the fructose phosphotransferase system (PTS) in S. gordonii. These proteins, FruR, FruK, and FruI, are homologous to proteins encoded by the inducible fruRKI operon of S. mutans. In S. mutans, FruR is a transcriptional repressor, FruK is a fructose-1-phosphate kinase, and FruI is the fructose-specific enzyme II (fructose permease) of the phosphoenolpyruvate-dependent sugar PTS. Reverse transcription-PCR confirmed that fruR, fruK, and fruI are cotranscribed as an operon in S. gordonii, and the transposon insertion in S. gordonii fruK::Tn917-lac resulted in a nonpolar mutation. Nonpolar inactivation of either fruK or fruI generated by allelic replacement resulted in a biofilm-defective phenotype, whereas a nonpolar mutant with an inactivated fruR gene retained the ability to form a biofilm. Expression of fruK, as measured by the β-galactosidase activity of the fruK::Tn917-lac mutant, was observed to be growth phase dependent and was enhanced when the mutant was grown in media with high levels of fructose, sucrose, xylitol, and human serum, indicating that the fructose PTS operon was fructose and xylitol inducible, similar to the S. mutans fructose PTS. The induction by fructose was inhibited by the presence of glucose, indicating that glucose is able to catabolite repress fruK expression. Nonpolar inactivation of the fruR gene in the fruK::Tn917-lac mutant resulted in a greater increase in β-galactosidase activity when the organism was grown in media supplemented with fructose, confirming that fruR is a transcriptional repressor of the fructose PTS operon. These results suggest that the regulation of fructose transport and metabolism in S. gordonii is intricately tied to carbon catabolite control and the ability to form biofilms. Carbon catabolite control, which modulates carbon flux in response to environmental nutritional levels, appears to be important in the regulation of bacterial biofilms.
doi:10.1128/JB.185.21.6241-6254.2003
PMCID: PMC219402
PMID: 14563858
In silico analysis of the Bifidobacterium breve UCC2003 genome allowed identification of four genetic loci, each of which specifies a putative enzyme II (EII) protein of a phosphoenolpyruvate:sugar phosphotransferase system. The EII encoded by fruA, a clear homologue of the unique EIIBCA enzyme encoded by the Bifidobacterium longum NCC2705 genome, was studied in more detail. The fruA gene is part of an operon which contains fruT, which is predicted to encode a homologue of the Bacillus subtilis antiterminator LicT. Transcriptional analysis showed that the fru operon is induced by fructose. The genetic structure, complementation studies, and the observed transcription pattern of the fru operon suggest that the EII encoded in B. breve is involved in fructose transport and that its expression is controlled by an antiterminator mechanism. Biochemical studies unequivocally demonstrated that FruA phosphorylates fructose at the C-6 position.
doi:10.1128/AEM.01496-06
PMCID: PMC1796965
PMID: 17098914
The phosphoenolpyruvate:sugar phosphotransferase system (PTS) is the major sugar uptake system in oral streptococci. The role of EIIABMan (encoded by manL) in gene regulation and sugar transport was investigated in Streptococcus mutans UA159. The manL knockout strain, JAM1, grew more slowly than the wild-type strain in glucose but grew faster in mannose and did not display diauxic growth, indicating that EIIABMan is involved in sugar uptake and in carbohydrate catabolite repression. PTS assays of JAM1, and of strains lacking the inducible (fruI) and constitutive (fruCD) EII fructose, revealed that S. mutans EIIABMan transported mannose and glucose and provided evidence that there was also a mannose-inducible or glucose-repressible mannose PTS. Additionally, there appears to be a fructose PTS that is different than FruI and FruCD. To determine whether EIIABMan controlled expression of the known virulence genes, glucosyltransferases (gtfBC) and fructosyltransferase (ftf) promoter fusions of these genes were established in the wild-type and EIIABMan-deficient strains. In the manL mutant, the level of chloramphenicol acetyltransferase activity expressed from the gtfBC promoter was up to threefold lower than that seen with the wild-type strain at pH 6 and 7, indicating that EIIABMan is required for optimal expression of gtfBC. No significant differences were observed between the mutant and the wild-type background in ftf regulation, with the exception that under glucose-limiting conditions at pH 7, the mutant exhibited a 2.1-fold increase in ftf expression. Two-dimensional gel analysis of batch-grown cells of the EIIABMan-deficient strain indicated that the expression of at least 38 proteins was altered compared to that seen with the wild-type strain, revealing that EIIABMan has a pleiotropic effect on gene expression.
doi:10.1128/AEM.69.8.4760-4769.2003
PMCID: PMC169087
PMID: 12902269
Mutants of Salmonella typhimurium defective in the proteins of the fructose operon [fruB(MH)KA], the fructose repressor (fruR), the energy-coupling enzymes of the phosphoenolpyruvate:sugar phosphotransferase system (PTS) (ptsH and ptsI), and the proteins of cyclic AMP action (cya and crp) were analyzed for their effects on cellular physiological processes and expression of the fructose operon. The fru operon consists of three structural genes: fruB(MH), which encodes the enzyme IIIFru-modulator-FPr tridomain fusion protein of the PTS; fruK, which encodes fructose-1-phosphate kinase; and fruA, which encodes enzyme IIFru of the PTS. Among the mutants analyzed were Tn10 insertion mutants and lacZ transcriptional fusion mutants. It was found that whereas a fruR::Tn10 insertion mutant, several fruB(MH)::Mu dJ and fruK::Mu dJ fusion mutants, and several ptsHI deletion mutants expressed the fru operon and beta-galactosidase at high constitutive levels, ptsH point mutants and fruA::Mu dJ fusion mutants retained inducibility. Inclusion of the wild-type fru operon in trans did not restore fructose-inducible beta-galactosidase expression in the fru::Mu dJ fusion mutants. cya and crp mutants exhibited reduced basal activities of all fru regulon enzymes, but inducibility was not impaired. Surprisingly, fruB::Mu dJ crp or cya double mutants showed over 10-fold inducibility of the depressed beta-galactosidase activity upon addition of fructose, even though this activity in the fruB::Mu dJ fusion mutants that contained the wild-type cya and crp alleles was only slightly inducible. By contrast, beta-galactosidase activity in a fruK::Mu dJ fusion mutant, which was similarly depressed by introduction of a crp or cya mutation, remained constitutive. Other experiments indicated that sugar uptake via the PTS can utilize either FPr-P or HPr-P as the phosphoryl donor, but that FPr is preferred for fructose uptake whereas HPr is preferred for uptake of the other sugars. Double mutants lacking both proteins were negative for the utilization of all sugar substrates of the PTS, were negative for the utilization of several gluconeogenic carbon sources, exhibited greatly reduced adenylate cyclase activity, and were largely nonmotile. These phenotypic properties are more extreme than those observed for tight ptsH and ptsI mutants, including mutants deleted for these genes. A biochemical explanation for this fact is proposed.
PMCID: PMC213213
PMID: 2203752
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
doi:10.1128/JB.187.24.8504-8506.2005
PMCID: PMC1317004
PMID: 16321956
Upon starvation, a dense population of rod-shaped Myxococcus xanthus bacteria coordinate their movements to construct mounds in which some of the cells differentiate to spherical spores. During this process of fruiting body formation, short-range C-signaling between cells regulates their movements and the expression of genes important for sporulation. C-signaling activates FruA, a transcription factor that binds cooperatively with another transcription factor, MrpC2, upstream of the fmgA and fmgBC promoters, activating transcription. We have found that a third C-signal-dependent gene, herein named fmgD, is subject to combinatorial control by FruA and MrpC2. The two proteins appear to bind cooperatively upstream of the fmgD promoter and activate transcription. FruA binds proximal to the fmgD promoter, as in the fmgBC promoter region, whereas MrpC2 binds proximal to the fmgA promoter. A novel feature of the fmgD promoter region is the presence of a second MrpC2 binding site partially overlapping the promoter and therefore likely to mediate repression. The downstream MrpC2 site appears to overlap the FruA site, so the two transcription factors may compete for binding, which in both cases appears to be cooperative with MrpC2 at the upstream site. We propose that binding of MrpC2 to the downstream site represses fmgD transcription until C-signaling causes the concentration of active FruA to increase sufficiently to outcompete the downstream MrpC2 for cooperative binding with the upstream MrpC2. This would explain why fmgD transcription begins later during development and is more dependent on C-signaling than transcription of fmgA and fmgBC.
doi:10.1128/JB.01541-10
PMCID: PMC3067673
PMID: 21257775
Starvation causes cells in a dense population of Myxococcus xanthus to change their gliding movements and construct mounds. Short-range C-signaling between rod-shaped cells within mounds induces gene expression that promotes differentiation into spherical spores. Several C-signal-dependent genes have been shown to be regulated by cooperative binding of two transcription factors to the promoter region. These FruA- and MrpC2-regulated genes (designated fmg) each exhibit a different arrangement of binding sites. Here, we describe fmgE, which appears to be regulated by three sites for cooperative binding of FruA and MrpC2. Chromatin immunoprecipitation analysis showed that association of MrpC2 and/or its longer form, MrpC with the fmgE promoter region, depends on FruA, consistent with cooperative binding of the two proteins in vivo. Electrophoretic mobility shift assays with purified His10-MrpC2 and FruA-His6 indicated cooperative binding in vitro to three sites in the fmgE promoter region. The effects of mutations on binding in vitro and on expression of fmgE-lacZ fusions correlated site 1 (at about position −100 relative to the transcriptional start site) with negative regulation and site 2 (just upstream of the promoter) and site 3 (at about position +100) with positive regulation. Site 3 was bound by His10-MrpC2 alone, or the combination of His10-MrpC2 and FruA-His6, with the highest affinity, followed by site 1 and then site 2, supporting a model in which site 3 recruits MrpC2 and FruA to the fmgE promoter region, site 1 competes with site 2 for transcription factor binding, and site 2 occupancy is required to activate the promoter but only occurs when C-signaling produces a high concentration of active FruA.
doi:10.1128/JB.00205-11
PMCID: PMC3133106
PMID: 21441502
Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient limitation. Intercellular signals control cell movements and regulate gene expression during the developmental process. C-signal is a short-range signal essential for aggregation and sporulation. C-signaling regulates the fmgA gene by a novel mechanism involving cooperative binding of the response regulator FruA and the transcription factor/antitoxin MrpC2. Here, we demonstrate that regulation of the C-signal-dependent fmgBC operon is under similar combinatorial control by FruA and MrpC2, but the arrangement of binding sites is different than in the fmgA promoter region. MrpC2 was shown to bind to a crucial cis-regulatory sequence in the fmgBC promoter region. FruA was required for MrpC and/or MrpC2 to associate with the fmgBC promoter region in vivo, and expression of an fmgB-lacZ fusion was abolished in a fruA mutant. Recombinant FruA was shown to bind to an essential regulatory sequence located slightly downstream of the MrpC2-binding site in the fmgBC promoter region. Full-length FruA, but not its C-terminal DNA-binding domain, enhanced the formation of complexes with fmgBC promoter region DNA, when combined with MrpC2. This effect was nearly abolished with fmgBC DNA fragments having a mutation in either the MrpC2- or FruA-binding site, indicating that binding of both proteins to DNA is important for enhancement of complex formation. These results are similar to those observed for fmgA, where FruA and MrpC2 bind cooperatively upstream of the promoter, except that in the fmgA promoter region the FruA-binding site is located slightly upstream of the MrpC2-binding site. Cooperative binding of FruA and MrpC2 appears to be a conserved mechanism of gene regulation that allows a flexible arrangement of binding sites and coordinates multiple signaling pathways.
doi:10.1128/JB.01818-08
PMCID: PMC2668394
PMID: 19201804
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
doi:10.1128/JB.184.24.6803-6810.2002
PMCID: PMC135454
PMID: 12446630
The Bacteroides fragilis BF-1 fructanase-encoding gene (fruA) was cloned and expressed in Escherichia coli from the recombinant plasmid pBS100. The fruA gene consisted of 1,866 bp encoding a protein of 622 amino acids with a calculated M(r) of 70,286. The apparent M(r) of the fructanase, determined by in vitro cell-free transcription-translation and sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis, was approximately 71,500. An alignment of the amino acid sequences of the B. fragilis BF-1 fructanase and the Bacillus subtilis levanase revealed that 45.5% of the amino acids were identical. The fruA gene was expressed in E. coli from its own promoter; however, no E. coli promoter-like sequence was evident upstream from the gene. A major E. coli transcription start point and a single B. fragilis BF-1 transcription start point were located. Expression of the fruA gene was constitutive in E. coli(pBS100) and B. fragilis BF-1. The ratio of sucrase activity to inulinase activity (S/I ratio) was constant for enzyme preparations from E. coli (pBS100), indicating that both activities were associated with the fructanase. For B. fragilis BF-1, the S/I ratio varied considerably depending on the carbon source used for growth, suggesting that a separate sucrase is produced in addition to the fructanase in B. fragilis BF-1. Localization experiments and TnphoA mutagenesis indicated that the fructanase was exported to the periplasm. Sequence analysis of the N-terminal region of the fructanase revealed a putative 30-amino-acid signal peptide. The enzymatic properties of the purified fructanase were investigated. The enzyme was able to hydrolyze sucrose, raffinose, inulin, and levan but not melezitose, indicating that it was a beta-D-fructofuranosidase which was able to hydrolyze beta(2-->6)-linked fructans.
Images
PMCID: PMC204626
PMID: 8491724
In order to examine gene function in Streptococcus mutans, we have recently initiated an antisense RNA strategy. Toward this end, we have now constructed and evaluated three Escherichia coli-S. mutans shuttle expression vectors with the fruA and scrB promoters from S. mutans, as well as the tetR-controlled tetO promoter from Staphylococcus aureus. Among these, the tetO/tetR system proved to be the most tightly controlled promoter. By using this shuttle plasmid system, modulation of gene function by inducible antisense RNA expression was demonstrated for comC antisense fragments of different sizes as well as for distinct gtfB antisense fragments. It was demonstrated that the size, but not the relative position, of an antisense DNA fragment is important in mediating the antisense phenomenon. Furthermore, by constructing and screening random DNA libraries with the tet expression shuttle system, 78 growth-retarded transformants harboring antisense DNA fragments were also identified. Almost all of them corresponded to homologous essential genes in other bacteria. In addition, a novel essential gene, the coaE gene, encoding dephospho-coenzyme A kinase, which is involved in the final step of coenzyme A catabolism in S. mutans, was identified and characterized. These results suggest that the antisense RNA strategy can be useful for identifying novel essential genes in S. mutans bacteria as well as further characterizing the physiology (including potential virulence factors) of these organisms.
doi:10.1128/IAI.73.6.3568-3576.2005
PMCID: PMC1111864
PMID: 15908386
Streptococcus mutans, the primary etiological agent of human dental caries, possesses at least two fructose phosphotransferase systems (PTSs), encoded by fruI and fruCD. fruI is also responsible for xylitol transport. We hypothesized that fructose and xylitol transport systems do not affect virulence. Thus, colonization and cariogenicity of fruI− and fruCD− single and double mutants, their WT (UA159), and xylitol resistance (Xr) of S. mutans were studied in rats fed a high-sucrose diet. A sucrose phosphorylase (gtfA−) mutant and a reference strain (NCTC-10449S) were additional controls. Recoveries of fruI mutant from the teeth were decreased, unlike those for the other strains. The fruCD mutation was associated with a slight loss of cariogenicity on enamel, whereas mutation of fruI was associated with a loss of cariogenicity in dentin. These results also suggest why xylitol inhibition of caries is paradoxically associated with spontaneous emergence of so-called Xr S. mutans in habitual human xylitol users.
PMCID: PMC2254530
PMID: 16567561
Streptococcus mutans; PTS; xylitol; sucrose phosphorylase; caries
C signaling plays a key role in coordinating cell movement and differentiation during the multicellular developmental process of Myxococcus xanthus. C signaling regulates expression of genes induced after about 6 h into development, when cells are forming mounds. One gene whose expression depends absolutely on C signaling was identified by insertion of a transposable element at site Ω4406 which generated a transcriptional fusion between lacZ and an upstream promoter. We have investigated regulation of the Ω4406 promoter. A 5′ deletion revealed a negative regulatory element located between bp −533 and −100 relative to the transcriptional start site. In the absence of this element, the promoter was still developmentally regulated but about fourfold more active. Also, the truncated promoter region retained normal dependence on two developmental regulators, FruA and DevS, but lost its dependence on the C-signaling protein CsgA. We infer that C signaling partially overcomes the negative effect of the upstream element on activity of the Ω4406 promoter. Deletion of downstream DNA between bp 50 and 140 caused a threefold loss in expression, suggesting that a positive regulatory element lies in this region. Additional positive and negative regulatory elements are present in the region from bp −69 to −49, based on the effects of multiple-base-pair mutations. Within this region, a 5-bp element and a C-box-like sequence resemble sequences found in other developmentally regulated M. xanthus promoter regions, but the effects of single-base-pair changes in these sequences suggest that each functions uniquely. We conclude that regulation of the Ω4406 promoter involves multiple positive and negative regulatory elements located upstream and downstream of the region typically bound by RNA polymerase.
doi:10.1128/JB.188.2.515-524.2006
PMCID: PMC1347317
PMID: 16385042
Regulatory evolution has frequently been proposed as the primary mechanism driving morphological evolution. This is because regulatory changes may be less likely to cause deleterious pleiotropic effects than changes in protein structure, and consequently have a higher likelihood to be beneficial. We examined the potential for mutations in trans acting regulatory elements to drive phenotypic change, and the predictability of such change. We approach these questions by the study of the phenotypic scope and size of controlled alteration in the developmental network of the bacterium Myxococcus xanthus. We perturbed the expression of a key regulatory gene (fruA) by constructing independent in-frame deletions of four trans acting regulatory loci that modify its expression. While mutants retained developmental capability, the deletions caused changes in the expression of fruA and a dramatic shortening of time required for completion of development. We found phenotypic changes in the majority of traits measured, indicating pleiotropic effects of changes in regulation. The magnitude of the change for different traits was variable but the extent of differences between the mutants and parental type were consistent with changes in fruA expression. We conclude that changes in the expression of essential regulatory regions of developmental networks may simultaneously lead to modest as well as dramatic morphological changes upon which selection may subsequently act.
doi:10.1371/journal.pone.0043413
PMCID: PMC3427377
PMID: 22937047