Most work on trehalose metabolism in
yeast concerns factors governing its endogenous level (
6,
14,
15). Trehalose synthase is a multimeric protein composed of four
subunits encoded by
TPS1,
TPS2,
TSL1,
and
TPS3 (
2,
18), of which only Tps1p catalyzing
the formation of trehalose-6-phosphate from UDP-Glc and
glucose-6-phosphate is essential for growth on rapidly fermentable
carbon sources like glucose and fructose (
8,
22). The
molecular mechanism underlying this defect is not yet understood
(
21). The deletion of
TPS1 in principle results
in the loss of trehalose accumulation. However, the existence of
another functional pathway for trehalose synthesis in yeast has been
postulated, based on data showing that trehalose accumulation is
somehow related to maltose metabolism or constitutive maltose gene
expression (
5,
15) and on one report of a putative
ADP-Glc-dependent trehalose synthase activity (
17). However,
most demonstrations in wild-type and
tps1 mutant strains
have employed an enriched medium such as yeast extract-peptone (YEP),
and our analysis of yeast extract from various commercial sources
(Difco and BIOKAR Diagnostic) by using ionic exchange chromatography
with pulsed amperometric detection (
4) shows it to contain
ca. 1.5% trehalose by weight, which would result in a yield of 150
μg of free trehalose per ml of YEP medium. Since
Saccharomyces
cerevisiae is known to show both a high- and a low-affinity
trehalose uptake (
13,
19,
20), we speculated that the
trehalose accumulation of
tps1 mutant cells might be related
to uptake from the medium, perhaps involving
AGT1, a
maltose-controlled gene encoding a transporter with broad specificity
for α-glucosides, including trehalose (
10).
Yeast mutant strains used in this work were derived from the
prototrophic CEN.PK113-7D strain (the kind gift of K.-D. Entian and P.
Kötter, Frankfurt, Germany), which possesses a
MAL2-8c dominant mutation. Culturing was carried
out at 30°C in YEP medium (10 g of yeast extract and 10 g of
Bacto Peptone per liter) or in mineral medium (MIN) prepared according
to the method described in reference
23 and buffered
at pH 5.8 by the addition of 10 g of succinic acid and 6 g of
NaOH per liter. The carbon source was added to the media at a final
concentration of 10 g · liter
−1, and auxotrophic
requirements, when required, were added at 100 mg ·
liter
−1. The deletion of
TPS1 and
AGT1 was performed according to the PCR and short homolog
fragment procedure of Wach et al. (
24) by using the pUG6
plasmid bearing the
loxP-kanMX4-loxP module (
9)
for
TPS1 and pUG6lacZ bearing
lacZ-kanMX4
(
3) for
AGT1. The oligonucleotides used to
construct the deletion cassette were as follows: d-TPS1
(5′-ATGACTACGGATAA CGCTAAGGCGCAACTGACCTCGTCTT
CAGCTGAAGC TTCGTACGC-3′),
containing the sequence from nucleotide +1 (A of the start codon) to
+40 of the
TPS1 open reading frame (ORF), and f-TPS1
(5′-TCAGTTTTTGGTGGCAGA GGAGCTTGTTGAGCTGATGAT
GCATAGGCCACTAG TGGATCTG-3′),
containing the complementary sequence from nucleotide +1445
to +1488 of the
TPS1 ORF, and S1-LAGT1
(5′-ATGAAAAATATCATTTCATTGGTAAGCAA GAAGAAGGCTGCCTCAAAA
TTCGTACGCTGCAGGT CGAC-3′),
containing the sequence from nucleotide +1 (A of the start codon)
to +48 of the
AGT1 ORF, and
S2-AGT1 (5′-TAATTCTCGCTGTTTTATGCTTGAGGACTGACT GATACTCTCATCAGCG
CATAGGCCACTAGTGGATC TG-3′),
containing the complementary sequence from nucleotide +1783 to +1830 of
the
AGT1 ORF.
Amplifications were carried out with Expand high-fidelity polymerase
(Boehringer, Mannheim, Germany) according to standard procedures, and
the amplified fragments (5 μg) were used for gene disruption as
described in reference
9. For the deletion of
ATH1, a 4.4-kb fragment bearing the full gene was amplified
by using a pair of primers (ATH1-250
[5′-CGTATCACGACAAACCAACAGCC-3] and ATH1-500
[5′-CAAACCCTACTGACGAGAGAAG]) and genomic DNA from
CEN.PK113-7D as a template. The PCR fragment cloned into the pGEM-T
vector (Promega) was digested with
EcoRV-
HpaI,
which was replaced by a 1.5-kb
EcoRV-
SmaI
kanMX4 fragment from pFAkanMX4 (
24). This
construct was cut with
ScaII and
SpeI, and the
3.45-kb fragment was gel purified and used for transformation
(
7). For the deletion of
NTH1, a 1.2-kb
StuI-
SnaBI of plasmid pTZ18RNTH1 (
12)
was replaced by a 1.4-kb
EcoRV-
SmaI
kanMX module from pFAKanMX4 to yield pΔATH1. This plasmid
was cut with
PvuII-
AlfII, and the 3.6-kb fragment
was used for transformation. Gene disruption was verified either by PCR
(
24) or by Southern blotting. The Δ
agt1
Δ
tps1 and Δ
nth1 Δ
ath1 double
mutants were obtained by the crossing of haploid mutant strains. The
correct Δ
agt1 Δ
tps1 mutant was characterized
by its inability to grow on YEP-dextrose and its ability to turn dark
blue on maltose due to the expression of
AGT1-lacZ. The
correct Δ
nth1 Δ
ath1 mutant was obtained from
a typical tetrad as the only one lacking both acid and neutral
trehalase activity. The level of intracellular trehalose was determined
by the procedure described previously (
16).
In agreement with the idea that the trehalose content can be
manipulated by including trehalose in the growth medium, Fig.
A shows that although there was a barely
detectable level of trehalose in a wild-type strain (with a
MALc mutation) cultivated on galactose-MIN, this
level was significantly increased when the medium also contained
0.15 g of trehalose · liter−1 (Fig. B), but
this accumulation was prevented by the deletion of AGT1
(Fig. C). Table shows that the maximal
content of trehalose during the growth of a wild-type strain on
YEP-galactose was about 10% of the dry mass and that this level
dropped to 3.2% in the tps1 isogenic strain. By contrast,
in galactose-MIN, the content of the disaccharide in the wild-type
strain reached ca. 1% and was not detectable in the tps1
mutant. Both strains, however, were able to accumulate about 2%
trehalose when the medium was initially supplemented with 0.15 g
of trehalose · liter−1.
| TABLE 1Levels of trehalose in wild-type and isogenic mutant
strains with AGT1, TPS1, NTH1, or
ATH1 deleted during growth on different media |
The use of varying exogenous trehalose concentrations shows that with 1
g · liter
−1 (ca. 3 mM), a 9% intracellular
concentration of trehalose can be attained even in galactose-MIN.
For a cell sap of 2.4 ml per g of cell dry mass (
1,
11),
this content corresponds to 110 mM, suggesting an active uptake of
trehalose. The accumulation of trehalose was largely abolished by the
deletion of
AGT1, with a residual internal trehalose
concentration probably contributed by trehalose synthase activity, as
indicated by its loss in the
agt1 tps1 double mutant.
However, at a much higher exogenous trehalose concentration (10 g
· liter
−1 or 30 mM), its endogenous level was on the
order of 1% in both the single (
agt1) and the double
(
agt1 tps1) mutants. This latter result is in agreement with
previous work showing the existence of a nonconcentrative low-level
Km uptake system for trehalose (
13,
19). Since acid and neutral trehalases counteract the
endogenous formation of trehalose (
14), their
influence on intracellular trehalose content was investigated by
deleting the corresponding
NTH1 and
ATH1 genes.
It is shown in Table that the content of trehalose determined at the
end of growth on glucose-MIN increased from 0.39% in a wild-type
strain to 2% in cells lacking both trehalases. However, their absence
had much less influence on the level of intracellular trehalose as its
external concentration was increased, suggesting that yeast cells have
a limiting capacity to store a maximum of 12 to 13% trehalose. Taken
together, these results conclusively demonstrate that the accumulation
of trehalose in yeast is mediated by at least two pathways: the first
is via the endogenous UDP-Glc-linked trehalose synthase complex and the
second is the uptake of exogenous trehalose via the
high-affinity α-glucoside transporter encoded by
AGT1.
This article has been 
