PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of wopenresLink to Publisher's site
 
Version 1. Wellcome Open Res. 2017; 2: 106.
Published online 2017 November 2. doi:  10.12688/wellcomeopenres.12631.1
PMCID: PMC5717473

Rare variants of the 3’-5’ DNA exonuclease TREX1 in early onset small vessel stroke

Sarah McGlasson, Conceptualization, Formal Analysis, Investigation, Methodology, Writing – Original Draft Preparation, Writing – Review & Editing,1,2 Kristiina Rannikmäe, Conceptualization, Formal Analysis, Investigation, Writing – Original Draft Preparation, Writing – Review & Editing,1 Steven Bevan, Investigation, Methodology, Project Administration,3,4 Clare Logan, Investigation, Methodology, Supervision,2 Louise S. Bicknell, Investigation, Writing – Review & Editing,2 Alexa Jury, Investigation, Writing – Review & Editing,1,2 UK Young Lacunar Stroke Study, Andrew P. Jackson, Methodology, Supervision, Writing – Review & Editing,2 Hugh S. Markus, Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing,#3 Cathie Sudlow, Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing,#1,2 and David P.J. Hunt, Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Supervision, Writing – Original Draft Preparation, Writing – Review & Editing#a,1,2

Abstract

Background: Monoallelic and biallelic mutations in the exonuclease TREX1 cause monogenic small vessel diseases (SVD). Given recent evidence for genetic and pathophysiological overlap between monogenic and polygenic forms of SVD, evaluation of TREX1 in small vessel stroke is warranted.

Methods: We sequenced the TREX1 gene in an exploratory cohort of patients with lacunar stroke (Edinburgh Stroke Study, n=290 lacunar stroke cases). We subsequently performed a fully blinded case-control study of early onset MRI-confirmed small vessel stroke within the UK Young Lacunar Stroke Resource (990 cases, 939 controls).

Results: No patients with canonical disease-causing mutations of TREX1 were identified in cases or controls. Analysis of an exploratory cohort identified a potential association between rare variants of TREX1 and patients with lacunar stroke. However, subsequent controlled and blinded evaluation of TREX1 in a larger and MRI-confirmed patient cohort, the UK Young Lacunar Stroke Resource, identified heterozygous rare variants in 2.1% of cases and 2.3% of controls. No association was observed with stroke risk (odds ratio = 0.90; 95% confidence interval, 0.49-1.65 p=0.74). Similarly no association was seen with rare TREX1 variants with predicted deleterious effects on enzyme function (odds ratio = 1.05; 95% confidence interval, 0.43-2.61 p=0.91).

Conclusions: No patients with early-onset lacunar stroke had genetic evidence of a TREX1-associated monogenic microangiopathy. These results show no evidence of association between rare variants of TREX1 and early onset lacunar stroke. This includes rare variants that significantly affect protein and enzyme function. Routine sequencing of the TREX1 gene in patients with early onset lacunar stroke is therefore unlikely to be of diagnostic utility, in the absence of syndromic features or family history.

Keywords: TREX1, neuroinflammation, small vessel stroke, lacunar stroke

Introduction

Cerebral small vessel disease (SVD) causes a quarter of all strokes and is the most common pathology underlying vascular cognitive decline and dementia 1. The pathophysiological and genetic basis of SVD is poorly understood, in particular small vessel lacunar stroke 2, 3. Rare variants may make a significant contribution to the genetic basis of SVD 3, 4 and increasing evidence suggests that monogenic and polygenic forms of SVD share common pathophysiological mechanisms 5. For example, dominant missense mutations in COL4A1 and COL4A2 cause rare familial forms of cerebral SVD 6, and common variants in the same genes are associated with sporadic cerebral small vessel disease 3. Such findings demonstrate that genes causing monogenic microangiopathies may also contain variants conferring risk for common forms of cerebral SVD, such as lacunar stroke.

TREX1 is a human 3’-5’ exonuclease that can degrade single stranded DNA. Two monogenic small vessel diseases are caused by mutations in TREX1 ( Figure 1A). Heterozygous frameshift mutations in the C-terminus of TREX1, resulting in enzyme mislocalisation, cause retinal vasculopathy with cerebral leukodystrophy (RVCL), an adult-onset systemic microangiopathy with pronounced brain involvement 7. Biallelic mutations with loss of enzymatic function can cause Aicardi-Goutières’ Syndrome (AGS), a neonatal onset brain disorder with prominent microangiopathy 8, 9 and features of activated innate immunity 10. Both genetic cerebral microangiopathies are associated with aberrant innate immune pathways, in particular dysregulation of the type I interferon pathway 10, 11. Given the potential for therapeutic modulation of these pathways, evaluation of TREX1 in SVD phenotypes, such as lacunar stroke, warrants examination. The identification of patients with early-onset cerebral SVD and heterozygous rare TREX1 variants has led to the hypothesis that such variants might be causally related to early-onset SVD 12.

Figure 1.

An external file that holds a picture, illustration, etc.
Object name is wellcomeopenres-2-13676-g0000.jpg
Evaluation of TREX1 in lacunar stroke.

( A) Schematic representation of TREX1 protein, showing known associations with genetic microangiopathic diseases. Shown are monoallelic mutations associated with Retinal Vasculopathy with Cerebral Leukodystrophy (RVCL) and biallelic mutations associated with Aicardi-Goutieres’ Syndrome (AGS). ExoI = exonuclease domain I, ExoII = exonuclease domain II, ExoIII = exonuclease domain III, PII = polyproline domain. ( B) Overview of present study. An initial analysis was performed in an exploratory cohort, followed by a case-control study.

Here we evaluate TREX1 in patients with small vessel stroke. We perform an initial exploratory analysis in a relatively small cohort of patients with lacunar stroke, and subsequently perform a case-control study in a larger cohort of patients with early-onset lacunar stroke, where small vessel infarction has been confirmed by MRI.

Methods

Sanger sequencing

The entire coding sequence of TREX1 and part of the 5’UTR (-228bp) and 3’ UTR (+57 bp) were amplified by three overlapping amplicons using the following primers:

TREX1 AF: ACAGTCGAATGTGCTGGTCC, TREX1 AR: TCAGACCTGTGATCTCGCTG, TREX1 BF: ACCTCCCACAGTTCCTCCAC, TREX1 BR: TGGTCTCCACTGACAGATGC, TREX1 CF: CTCAGAACACGGCCCAAG, TREX1 CR: ACCACTCAGTGCTATGGGG.

Amplicons were amplified from genomic DNA isolated from peripheral lymphocytes by PCR and checked by agarose gel electrophoresis. Purified PCR products were sequenced in both directions using fluorescent dye terminator chemistry (ABI 3730 DNA analyzer). Sequence reads were analysed by Mutation Surveyor, Sequencher and 4 peaks, and compared to a reference sequence NM_033629 (RefSeq, NCBI).

Rare variants were defined as those with minor allele frequency (MAF) <0.05 (5%) in the Exome Aggregation Consortium ( ExAC) and those absent from ExAC. The presence of all identified variants was confirmed by resequencing.

Exploratory cohort: Edinburgh Stroke Study

The Edinburgh Stroke Study (Ethics Committee Approval, Lothian Research Ethics Committee LREC/2001/4/46) prospectively recruited consenting ≥18 years old patients with stroke, transient cerebral or monocular ischaemic attack or retinal artery occlusion, admitted to, or seen in outpatient clinics at the Western General Hospital, Edinburgh, between April 2002 and May 2005 13. Stroke was defined as the sudden onset of clinical signs of focal disturbance of cerebral function lasting more than 24 hours with no apparent cause other than that of vascular origin. All patients were of self-reported Caucasian ancestry. Lacunar ischaemic stroke was defined using the Oxfordshire Community Stroke Project (OCSP) lacunar stroke syndrome definition revised in light of site and size of any relevant infarct seen on CT or MRI scan 14.

Case-control cohort: UK Young Lacunar Stroke DNA Resource

The UK Young Lacunar Stroke Study recruited Caucasian patients with lacunar stroke, aged ≤70 years, from 72 specialist stroke services in the UK, between 2002 and 2012 15. The study was approved by the Multi-Centre Research Ethics Committee for Scotland (04/MRE00/36) and written informed consent was obtained from all participants. Lacunar stroke was defined as a clinical lacunar syndrome, with an anatomically compatible lesion on MRI (subcortical infarct ≤15 mm in diameter). All patients underwent full stroke investigation, including brain MRI, imaging of the carotid arteries and ECG. Echocardiography was performed when appropriate. All MRIs and clinical histories were reviewed centrally by one physician (HM). Exclusion criteria were: Any other defined cause, including the following: Stenosis > 50% in the extra- or intracranial cerebral vessels, or previous carotid endarterectomy; cardioembolic source of stroke, defined according to the TOAST (Trial of Org 10172 in Acute Stroke Treatment) criteria 16 as high or moderate probability; cortical infarct on MRI; subcortical infarct > 15 mm in diameter, as these can be caused by embolic mechanisms (striatocapsular infarcts); any other specific cause of stroke (e.g. lupus anticoagulant, cerebral vasculitis, dissection, monogenic cause of stroke).

Unrelated Caucasian controls, free of clinical cerebrovascular disease, were obtained by random sampling from general practice lists from the same geographical location as the patients. Sampling was stratified for age and sex. All patients and controls underwent a standardized clinical assessment and completed a standardized study questionnaire. MRI was not performed in controls.

Variant annotation

Variants were compared with the ExAC database 17 to determine a MAF and/or previously identified disease association (ClinVar, NCBI). Variants were sorted by Combined Annotation Dependent Depletion ( CADD). CADD provides a scaled C-score with a C-score of 10 meaning this variant is predicted to be in the top 1% of most deleterious changes in the genome, a score of 20 meaning it is in the top 0.1% 18.

Structural and functional analyses

3D rendering of the variants in a TREX1 dimer 19 (Protein DataBase ID: 2OA8, amino acids 5-234) was performed using PyMOL (The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC).

TREX1-EGFP vector construction

Gateway cloning was used to construct mammalian expression vectors. Briefly, the coding sequence of human TREX1 was amplified by PCR to include attB sites and cloned into pDONR221 (Invitrogen) via BP reaction (BP clonase II kit; Invitrogen). pEGFP-TREX1 was constructed by cloning the TREX1 coding sequence into a Gateway converted pEGFP-C2 destination vector (Clontech) via LR reaction (LR clonase II kit; Invitrogen). Minipreparations of plasmid DNA (Qiagen) were performed for verification. Midipreparations of plasmid DNA (ZymoResearch) were performed for mammalian cell transfection.

Site directed mutagenesis

Mutations were introduced into the mammalian expression construct by site-directed mutagenesis, as per manufacturer’s instructions (Q5 Site-Directed Mutagenesis Kit, NEB). Mutations were confirmed by Sanger sequencing.

TREX1 nuclease activity assay

TREX1 nuclease activity was assayed by transfecting Trex1 -/- mouse embryonic fibroblasts (MEFs; a kind gift from Martin Reijns) with pEGFP-TREX1 WT and mutant constructs using Lipofectamine 3000 (Invitrogen). Whole cell protein was extracted with lysis buffer (50 mM Tris, 280 mM NaCl, 0.5% Igepal, 0.2 mM EDTA, 0.2 mM EGTA, 10% glycerol) and protein concentration of the whole cell lysate was determined by Bradford assay (5 X Bradford Reagent, Serva).

Whole cell lysates (final concentration 100 ng/µl) were incubated with nucleic acid substrate (21-mer single stranded oligo with 3’ fluorescein and an internal DABCYL, 3’fl-intDABCYL-TREX1-21mer, sequence TAGACATTGCCCTCG5AGGTAC (Dabcyl dT at position marked 5, 3’ fluorescein); final concentration 200 nM) in reaction buffer (20 mM Tris-HCl, 5 mM MgCl 2, 2 mM DTT, 100 μg/ml BSA) at room temperature in an opaque 96 well plate. Fluorescent measurements (490 ex/525 em) were taken with a SpectraMax i3 (Molecular Devices) plate reader over a 90 minute time course with measurements taken every 2 minutes.

Statistical analyses

Sequencing, analysis and functional work was performed blind to case-control status. Fisher’s exact test was used to compare proportions of individuals with rare variants in cases versus controls, unless otherwise stated. Odds ratios were calculated using Cochrane RevMan 5. Mann-Whitney U test was used to compare CADD scores between groups. Statistical tests were performed in GraphPad Prism 7.

Results

Exploratory cohort: Rare TREX1 variants in the Edinburgh Stroke Study

We first performed an exploratory analysis of patients with lacunar stroke within the Edinburgh Stroke Study ( Figure 1B). This study of >2000 stroke patients includes a subset of 290 patients with a clinical diagnosis of a lacunar stroke. Sanger sequencing of TREX1 in these 290 patients identified no individuals with genetic results consistent with a diagnosis of RVCL (monoallelic C-terminal frameshift mutations) or AGS (biallelic hypomorphic mutations).

However, four patients with rare heterozygous TREX1 variants were identified (MAF<0.05, Table 1). The Edinburgh Stroke Study does not include population-matched controls, placing limitation on interpretation of these data. However, compared to published TREX1 sequencing control data from patients of European ancestry, this is significantly more than would be expected (p = 0.005 Fisher’s exact test) 20. Notably, 3 of these patients developed lacunar stroke under the age of 70 years. Recognising that to confirm any potential association between rare TREX1 variants and lacunar stroke would require more stringent testing, we analysed DNA from a larger independent lacunar stroke cohort with early onset disease (<70 years) together with a population-matched control cohort.

Table 1.

Rare TREX1 variants identified in the Edinburgh Stroke Study.

Positions of amino acid and nucleotide changes refer to RefSeq assession number NM_033629, the 314 amino acid isoform of TREX1. Combined Annotation Dependent Depletion (CADD) score is a scaled score of predicted pathogenicity. p = 0.005, Fishers Exact Test compared to published control cohort 20.

Amino acid
alteration
Nucleotide alteration
major>minor allele
TotalCADD
score
Age
5' UTR -113 A>G10.1358
C208S 623 G>C12466
R217R 651 G>A111.385
E266G 797 A>G10.0559

Case-control study: Rare TREX1 variants in the UK Young Lacunar Stroke Resource

The UK Young Lacunar Stroke Resource (UKYLSR) is a study of approximately 1,000 patients with MRI-confirmed lacunar stroke in patients under the age of 70, with matched population controls. As such this study allows more stringent evaluation of the hypothesis that rare TREX1 variants confer risk for lacunar stroke. We performed TREX1 sequencing in cases and controls, including functional annotation and enzymatic assays. We remained blind to case-control status throughout the study.

No individuals in either case or control group had genetic results consistent with a diagnosis of RVCL or AGS.

We next evaluated rare TREX1 variants (MAF<0.05). We identified 21 rare heterozygous variants in 990 cases (2.1%) and 22 in 939 controls (2.3%). There was no significant association between such variants and lacunar stroke (odds ratio = 0.90; 95% confidence interval, 0.49-1.65 p=0.74; Figure 2A, Table 2). This also held true when only considering non-synonymous variants (16/990 or 1.6% for cases versus 17/939 or 1.8% for controls).

Figure 2.

An external file that holds a picture, illustration, etc.
Object name is wellcomeopenres-2-13676-g0001.jpg
Rare TREX1 variants in UK Young Lacunar Stroke case and control cohorts.

( A) Rare variants in UK Young Lacunar Stroke case and control cohorts. 21 rare heterozygous variants in 990 cases (2.1%) and 22 in 939 controls (2.3%). No association with lacunar stroke was observed, for either rare variants (OR = 0.90; 95% confidence interval, 0.49-1.65 p=0.74) or rare variants with C-scores >10 (OR = 1.05; 95% confidence interval, 0.43-2.6 p>0.99). ( B) Distribution of Combined Annotation Dependent Depletion (CADD) scores assigned to rare variants: no significant difference was observed between cases and controls (p=0.72 Mann-Whitney U-test). ( C) Schematic representation of TREX1 protein domains showing non-synonymous variants identified in this study in cases or controls (coloured by CADD score).

Table 2.

Rare TREX1 variants identified in the UK Young Lacunar Stroke Resource.

Rare variants in TREX1 were identified in both cases and controls by Sanger sequencing. Minor allele frequency (MAF; %) of variants that are also present in Exome Aggregation Consortium (ExAC) are shown for comparison. 12/24 variants are novel (not in ExAC). One (P290_A295del) has been reported as a homozygous mutation in AGS1 but is not present in ExAC. The homozygous or compound heterozygous R114H mutation is a common AGS1 mutation (in 14/18 AGS1 families) 10. Positions of amino acid and nucleotide changes refer to RefSeq assession number NM_033629, the 314 amino acid isoform of TREX1. CADD, Combined Annotation Dependent Depletion.

Amino acid
alteration
Nucleotide alteration
major>minor allele
TotalCADD
score
ExAC
MAF (%)
Cases n=990
G2G 6 C>T115.7-
P61P 183 G>A10.960.07
P73P 219 G>A14.170.002
A139T 415 G>A119.3-
A139Vfs*21 416 GC>G1340.004
G142A 425 G>C124.8-
R174G 520 A>G1240.0008
K175N 525 G>T124.3-
R217R 651 G>A111.30.008
T250T 750 C>A111.3-
A252V 755 C>A12.15-
L254P 761 T>C112.1-
E266G 797 A>G80.050.1691
P290_A295del 867 CCCACTGGGTCTGCTGGCC>C115-
Total 21
Controls n=939
P61L 182 C>T1260.0008
P61P 183 G>A10.960.07
R114H 341 G>A128.10.015
P116A 346 C>G123.30.0016
H124H 372 C>T112-
F131I 391 T>A129.6-
A158V 473 C>T124.30.002
S190S 570 C>T113.8-
E266G 797 A>G100.050.1691
G286E 857 G>A111-
P290_A295del 867 CCCACTGGGTCTGCTGGCC>C115-
3' UTR +17 T>C16.78-
3' UTR +37 T>C11.331.23
Total 22

Variants differ in their capacity to reduce enzymatic function of TREX1. For example some mutations such as D18N can cause complete loss of function of exonuclease activity 7. We therefore next considered annotations of these variants which evaluated the potential pathogenicity of a given variant. CADD is a method for integrating diverse functional annotations into a single measure (CADD score, or C-score), which can predict the potential pathogenicity of a variant in silico 18. When rare variants with low CADD scores (<10) were excluded, functional rare variants were identified at a frequency of 10/990 in cases (1.0%) and 9/939 (0.96%) in controls (OR 1.05; 95% confidence interval, 0.43-2.61 p=0.91, Figure 2B). The CADD scores for rare variants did not differ significantly between groups ( Figure 2B, p=0.72 Mann-Whitney U test). The location of variants within TREX1 influences clinical phenotype in monogenic microangiopathic disease ( Figure 1A). The variants we identified were distributed throughout the TREX1 gene, and there was no apparent spatial clustering when variants were mapped onto a 3D protein model ( Figure 2C, Figure 3A).

Figure 3.

An external file that holds a picture, illustration, etc.
Object name is wellcomeopenres-2-13676-g0002.jpg
Rare variants can affect TREX1 nuclease activity.

( A) Location of rare variants (CADD>10) mapped onto TREX1 dimer structure (highlighted in red), with coordinates taken for mouse TREX1 in complex with ssDNA (blue). Variants in the case cohort are highlighted in blue. ( B) TREX1 nuclease assay measures nuclease activity as release of 3’fluorescein from an oligonucleotide containing a DABCYL quencher. ( C) Relative nuclease activity of predicted most severe variants identified from case (A139Vfs*21) and control groups (R114H) of the UK Young Lacunar Stroke Study. Nuclease activity was assayed in total protein supernatants from Trex1 -/- MEFs transfected with TREX1 expression constructs containing variants generated by site directed mutagenesis. Rare variants identified in the Young Lacunar stroke cohorts were compared with a known nuclease-dead variant (D18N). Data shown is average of two or more independent experiments performed in triplicate ± standard deviation of the independent experiments relative to WT ** p<0.01.

Rare TREX1 variants can decrease exonuclease activity

To confirm that rare variants with high CADD scores exert a deleterious effect on protein function, we evaluated the effect of rare variants on TREX1 exonuclease activity with a high C-score from each group. We identified a variant from each group with a CADD score >20 and thus predicted to confer significant pathogenic effect on the protein. To examine such amino acid changes on TREX1 function, we reconstituted mouse Trex1 -/- MEFs with the mutated allele, generated by site-directed mutagenesis and assessed cellular nuclease activity against a ssDNA substrate ( Figure 3B). While wildtype TREX1 reconstituted nuclease activity against ssDNA, rare variants from both groups (Case: A139Vfs*21, C-score 34. Control: R114H, C-score 28) lead to significant loss of 3’-5’ exonuclease activity ( Figure 3C).

Together these results show no evidence for an association between rare variants of TREX1 and early onset lacunar stroke, including variants that exert deleterious effects on protein function.

Discussion

There is a need to identify aetiological factors in small vessel stroke, in particular molecular pathways that might be amenable to therapeutic intervention 1. Recent meta-analyses of GWAS studies have suggested that the “missing heritability” of small vessel stroke may be in part attributed to rare variants 2, 21. One possibility is that mutations in genes that cause monogenic small vessel diseases, such as NOTCH3, HTRA1, COL4A1 and TREX1, might confer risk for sporadic lacunar stroke. This hypothesis is strengthened by the identification of an association between sporadic SVD phenotypes and common variants in COL4A1/2, since mutations in these genes can cause monogenic SVD 3.

TREX1 is therefore an important candidate gene to evaluate in lacunar stroke. Biallelic and monoallelic mutations in TREX1 can cause two clinically distinct monogenic syndromes characterized by prominent microangiopathy, AGS and RVCL. While the molecular events by which altered TREX1 function causes SVD is unknown, increasing lines of evidence suggest an association with activated innate immunity, including pathways that are potentially amenable to therapeutic intervention 11, 22. As such detailed evaluation of this gene in sporadic small vessel stroke phenotypes is a priority.

Here we test the hypothesis that rare variants of TREX1 are associated with lacunar stroke, in particular early onset disease. We first examine DNA from an exploratory cohort, recognizing important limitations in the interpretation of genetic data from small uncontrolled studies. Consistent with other screening studies of this gene in other early-onset SVD phenotypes 12, we identified rare variants of TREX1 in about 1.3% of cases, and observed that 3 out of 4 of these cases were under 70 years of age. Comparison of this proportion to published control data suggested a potential association of early onset lacunar stroke with rare variants of TREX1. However, such analyses present serious methodological limitations, since published control cohorts are not matched for geographical region and age. Therefore, although this type of comparison might be useful in generating preliminary data on which to focus and power more detailed studies, the statistical analysis of this preliminary cohort is prone to bias, confounding and chance 23.

Therefore to assess whether our observations in this preliminary cohort represented a real association, we performed a more methodologically rigorous evaluation of TREX1 in the UKYLSR. This differs from the exploratory study in a number of ways, which allow more robust genetic conclusions to be drawn. Firstly, the UKYLSR is a dedicated study of early onset lacunar stroke. Secondly, inclusion in the study requires confirmation of a small vessel stroke by MRI. This is important since a clinical diagnosis of a lacunar syndrome may not necessarily be caused by a small vessel stroke 1. Thirdly, the study was controlled with an age, sex and geographically matched control population. We remained blinded to case-control status throughout the study, including analyses of the functional consequences of rare variants.

The results of this case-control study showed no evidence that rare variants in TREX1 are associated with small vessel stroke. In the UKYLSR, rare variants in TREX1 occur in about 2% of both cases and controls. As such rare variants occur more frequently than previously detected in different control populations, highlighting potential population variation and reinforcing the need for dedicated age and population-matched control cohorts 20. Our findings emphasize the importance of confirmation cohorts in genetic association studies, however persuasive the prior biological rationale 24.

These rare variants included those that can directly alter protein structure and function. The distribution of CADD scores, which reflect an in silico evaluation of the potential pathogenicity of variants, was not different between groups. We show that rare variants with high CADD scores, which can affect enzymatic function in vitro, are observed at similar frequencies in both cases and control populations.

Our results are consistent with a recently published next-generation sequencing study comparing approximately 600 lacunar stroke patients with control individuals from the INTERSTROKE cohort 25. This study showed that rare variants in monogenic stroke genes, including TREX1, were not associated with lacunar stroke phenotypes. A potential limitation of both studies is lack of statistical power, although unbiased publication of such sequencing studies will allow meta-analyses with higher degrees of power to be performed.

These results have implications relevant for clinical practice. Firstly, none of the 1,280 lacunar stroke patients sequenced here had genetic results consistent with monogenic TREX1-associated genetic microangiopathies. Secondly, the identification of rare heterozygous variants of TREX1 in early onset small vessel stroke, even those that confer substantial functional effects, may not be of clinical relevance, although our analysis does not exclude a weak effect. Taken together, these findings do not support routine testing of TREX1 variants in early onset small vessel stroke, in the absence of syndromic features or a supportive family history. Furthermore, the interpretation of rare TREX1 variants in early onset SVD phenotypes obtained through screening 12 or next generation sequencing approaches 25, should be interpreted with caution given that they are observed in control populations at a frequency of approximately 2%.

Data availability

The data referenced by this article are under copyright with the following copyright statement: Copyright: © 2017 McGlasson S et al.

Raw data for this study are available from OSF: http://doi.org/10.17605/OSF.IO/2K4AP 26

Acknowledgements

Study managers: Josie Monaghan; Alan Zanich, Samantha Febrey, Eithne Smith, Jenny Lennon, St George’s University of London

Database cleaning: Loes Rutten-Jacobs, University of Cambridge

Recruitment of the UK Young Lacunar stroke Study was supported by the NIHR Stroke Research Network. We are grateful to all centres who recruited cases and controls. A full list of the centres that recruited to the UK Young Lacunar Stroke Resource are given below. Andrew Jackson is supported by the MRC. Hugh Markus is supported by an NIHR Senior Investigator award and the NIHR Cambridge University Hospitals Comprehensive Biomedical Research Centre. Louise Bicknell is supported by Medical Research Scotland. We are grateful to Dr Martin Reijns and Dr David Kavanagh for helpful comments on the manuscript. We are grateful to MRC Human Genetics Unit technical support team, in particular Stephen Brown (sequencing).

Participating centres (number of enrolled patients per centre; local investigators)

Aberdeen Royal Infirmary, Aberdeen (12; Mary Macleod). Addenbrooke’s Hospital, Cambridge (54; Jean-Claude Baron, Elizabeth Warburton, Diana J Day, Julie White). Airedale General Hospital, Steeton (4; Samantha Mawer). Barnsley Hospital, Barnsley (3; Mohammad Albazzaz, Pravin Torane, Keith Elliott, Kay Hawley). Bart’s and the London, London (2; Patrick Gompertz). Basingstoke and North Hampshire Hospital, Basingstoke (13; Elio Giallombardo, Deborah Dellafera). Blackpool Victoria Hospital, Blackpool (11; Mark O'Donnell). Bradford Royal Infirmary, Bradford (1; Chris Patterson). Bristol Royal Infirmary, Bristol (8; Sarah Caine). Charing Cross Hospital, London (12; Pankaj Sharma). Cheltenham General and Gloucester Royal Hospitals, Cheltenham and Gloucester (10; Dipankar Dutta). Chesterfield Royal Hospital, Chesterfield (4; Sunil Punnoose, Mahmud Sajid). Countess of Chester Hospital, Chester (22; Kausik Chatterjee). Derriford Hospital, Plymouth (4; Azlisham Mohd Nor). Dorset County Hospital NHS Foundation Trust, Dorchester (6; Rob Williams). East Kent Hospitals University NHS Foundation Trust, Kent (22; Hardeep Baht, Guna Gunathilagan). Eastbourne District General Hospital, Eastbourne (4; Conrad Athulathmudali). Frenchay Hospital, Bristol (1; Neil Baldwin). Frimley Park Hospital NHS Foundation Trust, Frimley (6; Brian Clarke). Guy’s and St Thomas’ Hospital, London (14; Tony Rudd). Institute of Neurology, London (25; Martin Brown). James Paget University Hospital, Great Yarmouth (1; Peter Harrison). King's College Hospital, London (16; Lalit Kalra). Leeds Teaching Hospitals NHS Trust, London (125; Ahamad Hassan). Leicester General Hospital and Royal Infirmary, Leicester (9; Tom Robinson, Amit Mistri). Luton and Dunstable NHSFT University Hospital, Luton (16; Lakshmanan Sekaran, Sakthivel Sethuraman, Frances Justin). Maidstone and Tunbridge Wells NHS Trust (3; Peter Maskell). Mayday University Hospital, Croydon (14; Enas Lawrence). Medway Maritime Hospital, Gillingham (5; Sam Sanmuganathan). Milton Keynes Hospital, Milton Keynes (1; Yaw Duodu). Musgrove Park Hospital, Taunton (9; Malik Hussain). Newcastle Hospitals NHS Foundation Trust, Newcastle upon Tyne (12; Gary Ford). Ninewells Hospital, Dundee (5; Ronald MacWalter). North Devon District Hospital, Barnstaple (8; Mervyn Dent). Nottingham University Hospitals, Nottingham (17; Philip Bath, Fiona Hammonds). Perth Royal Infirmary, Perth (2; Stuart Johnston). Peterborough City Hospital, Peterborough (1; Peter Owusu-Agyei). Queen Elizabeth Hospital, Gateshead (5; Tim Cassidy, Maria Bokhari). Radcliffe Infirmary, Oxford (5; Peter Rothwell). Rochdale Infirmary, Rochdale (4; Robert Namushi). Rotherham General Hospital, Rotherham (1; James Okwera). Royal Cornwall Hospitals NHS Trust, Truro (11; Frances Harrington, Gillian Courtauld). Royal Devon and Exeter Hospital, Exeter (22; Martin James). Royal Hallamshire Hospital, Sheffield (1; Graham Venables). Royal Liverpool University Hospital and Broadgreen Hospital, Liverpool (9; Aravind Manoj). Royal Preston Hospital, Preston (18; Shuja Punekar). Royal Surrey County Hospital, Guildford (23; Adrian Blight, Kath Pasco). Royal Sussex County Hospital, Brighton (14; Chakravarthi Rajkumar, Joanna Breeds). Royal United Hospital, Bath (6; Louise Shaw, Barbara Madigan). Salford Royal Hospital, Salford (16; Jane Molloy). Southampton General Hospital, Southampton (1; Giles Durward). Southend Hospital, Westcliff-on-Sea (26; Paul Guyler). Southern General Hospital, Glasgow (34; Keith Muir, Wilma Smith). St George’s Hospital, London (108; Hugh Markus). St Helier Hospital, Carshalton (10; Val Jones). Stepping Hill Hospital, Stockport (4; Shivakumar Krishnamoorthy). Sunderland Royal Hospital, Sunderland (1; Nikhil Majumdar). The Royal Bournemouth Hospital, Bournemouth (15; Damian Jenkinson). The Walton Centre, Liverpool (15; Richard White). Torbay Hospital, Torquay (19; Debs Kelly). University Hospital Aintree, Liverpool (19; Ramesh Durairaj). University Hospital of North Staffordshire, Stoke-on-trent (16; David Wilcock). Wansbeck General Hospital and North Tyneside Hospital, Ashington and North Shields (6; Christopher Price). West Cumberland Hospital, Whitehaven (6; Olu Orugun, Rachel Glover). West Hertfordshire Hospital, Watford (20; David Collas). Western General Hospital, Edinburgh (12; Cathie Sudlow). Western Infirmary, Glasgow (33; Kennedy R. Lees, Jesse Dawson). Wycombe Hospital and Stoke Mandeville, High Wycombe (20; Dennis Briley and Matthew Burn). Yeovil District Hospital, Yeovil (46; Khalid Rashed). York Teaching Hospital, York (1; John Coyle).

Notes

[version 1; referees: 2 approved]

Funding Statement

The Edinburgh Stroke Study was supported by the Wellcome Trust (clinician scientist award to C Sudlow 063668, and Wellcome Trust Case-Control Consortium 2 (WTCCC2) 085475 and 084724), and the Binks Trust. Sample processing occurred in the Genetics Core Laboratory of the Wellcome Trust Clinical Research Facility, Western General Hospital, Edinburgh. Much of the neuroimaging occurred in the Scottish Funding Council Brain Imaging Research Centre (www.sbirc.ed.ac.uk), Division of Clinical Neurosciences, University of Edinburgh, a core area of the Wellcome Trust Clinical Research Facility and part of the SINAPSE (Scottish Imaging Network—A Platform for Scientific Excellence) collaboration (www.sinapse.ac.uk), funded by the Scottish Funding Council and the Chief Scientist Office. Collection of the UK Young Lacunar Stroke Resource was primarily supported by a Wellcome Trust Functional Genomics grant with additional support from the Stroke Association. DH is supported by the Wellcome Trust (101153, Intermediate Clinical Fellowship). SM is supported by the Wellcome Trust and the Anne Rowling Clinic. HM is supported by a National Institute of Health Research Senior Investigator award and his work is supported by the Cambridge University Hospitals BRC. Study managers: Josie Monaghan; Alan Zanich, Samantha Febrey, Eithne Smith, Jenny Lennon, St George’s University of London Database cleaning: Loes Rutten-Jacobs, University of Cambridge

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1. Wardlaw JM, Smith C, Dichgans M.: Mechanisms of sporadic cerebral small vessel disease: insights from neuroimaging. Lancet Neurol. 2013;12(5):483–497. 10.1016/S1474-4422(13)70060-7 [PMC free article] [PubMed] [Cross Ref]
2. Traylor M, Bevan S, Baron JC, et al. : Genetic Architecture of Lacunar Stroke. Stroke. 2015;46(9):2407–2412. 10.1161/STROKEAHA.115.009485 [PMC free article] [PubMed] [Cross Ref]
3. Rannikmae K, Davies G, Thomson PA, et al. : Common variation in COL4A1/COL4A2 is associated with sporadic cerebral small vessel disease. Neurology. 2015;84(9):918–926. 10.1212/WNL.0000000000001309 [PMC free article] [PubMed] [Cross Ref]
4. Malik R, Traylor M, Pulit SL, et al. : Low-frequency and common genetic variation in ischemic stroke: The METASTROKE collaboration. Neurology. 2016;86(13):1217–1226. 10.1212/WNL.0000000000002528 [PMC free article] [PubMed] [Cross Ref]
5. Tan RY, Markus HS.: Monogenic causes of stroke: now and the future. J Neurol. 2015;262(12):2601–2616. 10.1007/s00415-015-7794-4 [PubMed] [Cross Ref]
6. Gould DB, Phalan FC, van Mil SE, et al. : Role of COL4A1 in small-vessel disease and hemorrhagic stroke. N Engl J Med. 2006;354(14):1489–1496. 10.1056/NEJMoa053727 [PubMed] [Cross Ref]
7. Richards A, van den Maagdenberg AM, Jen JC, et al. : C-terminal truncations in human 3'-5' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy. Nat Genet. 2007;39(9):1068–1070. 10.1038/ng2082 [PubMed] [Cross Ref]
8. Barth PG, Walter A, van Gelderen I.: Aicardi-Goutières syndrome: a genetic microangiopathy? Acta Neuropathol. 1999;98(2):212–216. 10.1007/s004010051071 [PubMed] [Cross Ref]
9. Barth PG.: The neuropathology of Aicardi-Goutières syndrome. Eur J Paediatri Neurol. 2002;6(Suppl A):A27–31; discussion A37–29, A77–86. 10.1053/ejpn.2002.0570 [PubMed] [Cross Ref]
10. Crow YJ, Hayward BE, Parmar R, et al. : Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutières syndrome at the AGS1 locus. Nat Genet. 2006;38(8):917–920. 10.1038/ng1845 [PubMed] [Cross Ref]
11. Schuh E, Ertl-Wagner B, Lohse P, et al. : Multiple sclerosis-like lesions and type I interferon signature in a patient with RVCL. Neurol Neuroimmunol Neuroinflamm. 2015;2(1):e55. 10.1212/NXI.0000000000000055 [PMC free article] [PubMed] [Cross Ref]
12. Pelzer N, de Vries B, Boon EM, et al. : Heterozygous TREX1 mutations in early-onset cerebrovascular disease. J Neurol. 2013;260(8):2188–2190. 10.1007/s00415-013-7050-8 [PubMed] [Cross Ref]
13. Jackson C, Crossland L, Dennis M, et al. : Assessing the impact of the requirement for explicit consent in a hospital-based stroke study. QJM. 2008;101(4):281–289. 10.1093/qjmed/hcm152 [PMC free article] [PubMed] [Cross Ref]
14. Bamford J, Sandercock P, Jones L, et al. : The natural history of lacunar infarction: the Oxfordshire Community Stroke Project. Stroke. 1987;18(3):545–551. 10.1161/01.STR.18.3.545 [PubMed] [Cross Ref]
15. Kilarski LL, Rutten-Jacobs LC, Bevan S, et al. : Prevalence of CADASIL and Fabry Disease in a Cohort of MRI Defined Younger Onset Lacunar Stroke. PLoS One. 2015;10(8):e0136352. 10.1371/journal.pone.0136352 [PMC free article] [PubMed] [Cross Ref]
16. Adams HP, Jr, Bendixen BH, Kappelle LJ, et al. : Classification of subtype of acute ischemic stroke. Definitions for use in a multicenter clinical trial. TOAST. Trial of Org 10172 in Acute Stroke Treatment. Stroke. 1993;24(1):35–41. 10.1161/01.STR.24.1.35 [PubMed] [Cross Ref]
17. Lek M, Karczewski KJ, Minikel EV, et al. : Analysis of protein-coding genetic variation in 60,706 humans. Nature. 2016;536(7616):285–291. 10.1038/nature19057 [PMC free article] [PubMed] [Cross Ref]
18. Kircher M, Witten DM, Jain P, et al. : A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet. 2014;46(3):310–315. 10.1038/ng.2892 [PMC free article] [PubMed] [Cross Ref]
19. de Silva U, Choudhury S, Bailey SL, et al. : The crystal structure of TREX1 explains the 3' nucleotide specificity and reveals a polyproline II helix for protein partnering. J Biol Chem. 2007;282(14):10537–10543. 10.1074/jbc.M700039200 [PubMed] [Cross Ref]
20. Lee-Kirsch MA, Gong M, Chowdhury D, et al. : Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 are associated with systemic lupus erythematosus. Nat Genet. 2007;39(9):1065–1067. 10.1038/ng2091 [PubMed] [Cross Ref]
21. Malik R, Traylor M, Pulit SL, et al. : Low-frequency and common genetic variation in ischemic stroke: The METASTROKE collaboration. Neurology. 2016;86(13):1217–1226. 10.1212/WNL.0000000000002528 [PMC free article] [PubMed] [Cross Ref]
22. Hasan M, Fermaintt CS, Gao N, et al. : Cytosolic Nuclease TREX1 Regulates Oligosaccharyltransferase Activity Independent of Nuclease Activity to Suppress Immune Activation. Immunity. 2015;43(3):463–474. 10.1016/j.immuni.2015.07.022 [PMC free article] [PubMed] [Cross Ref]
23. Button KS, Ioannidis JP, Mokrysz C, et al. : Power failure: why small sample size undermines the reliability of neuroscience. Nat Rev Neurosci. 2013;14(5):365–376. 10.1038/nrn3475 [PubMed] [Cross Ref]
24. Hunt KA, Smyth DJ, Balschun T, et al. : Rare and functional SIAE variants are not associated with autoimmune disease risk in up to 66,924 individuals of European ancestry. Nat Genet. 2012;44(1):3–5. 10.1038/ng.1037 [PMC free article] [PubMed] [Cross Ref]
25. Chong M, O'Donnell M, Thijs V, et al. : Mendelian Genes and Risk of Intracerebral Hemorrhage and Small-Vessel Ischemic Stroke in Sporadic Cases. Stroke. 2017;48(8):2263–2265. 10.1161/STROKEAHA.117.017322 [PubMed] [Cross Ref]
26. McGlasson S.: “Rare Variants of the 3’-5’ DNA Exonuclease TREX1 in Early Onset Small Vessel Stroke.” Open Science Framework. 2017. Data Source [PMC free article] [PubMed]

Review Summary Section

Review dateReviewer name(s)Version reviewedReview status
2017 December 4Arne LindgrenVersion 1Approved
2017 November 13John P. Atkinson and Andria L. FordVersion 1Approved

Approved

Arne Lindgren, Referee1
1Department of Clinical Sciences Lund, Neurology, Lund University, Lund, Sweden
Competing interests: No competing interests were disclosed.
Review date: 2017 December 4. Status: Approved

This is a study of 290 subjects with lacunar stroke from the Edinburgh Stroke Study and 990 subjects with lacunar stroke plus 939 control subjects from the UK Lacunar Stroke Resource. The authors examined if there was an association between variants in TREX1 and lacunar stroke but could not detect this. This is an important and relevant finding because when taking previous reports into consideration it has been reasonable to suspect a relation between TREX1 variants and lacunar stroke. Some comments:

Microangiopathy can cause many different phenotypes and a discussion about how closely the different microangiopathies noted in previous studies of TREX1 can be supposed to be related to the phenotype lacunar stroke would be of interest. Maybe the reported microangiopathies should instead be suspected to be related to other phenotypes than lacunar stroke? It would therefore be valuable if the authors, with their acknowledged expertise, in the manuscript could explain more about the possible relationships between microangiopathy and SVD causing lacunar stroke.

For clarity of the manuscript, the authors should consider moving some parts of the Results section to the Methods section. This includes the paragraph beginning with “The UK Young Lacunar Stroke Resource (UKYLSR) is a study of approximately 1,000 patients” and the sentences starting with: “We therefore next considered annotations of these variants which evaluated the potential pathogenicity of a given variant. CADD is a method…”

The authors also used mouse TREX1 for their evaluations. It would be valuable if they could comment in e.g. their Discussion whether any differences between mouse TREX1 and human TREX1 may be of importance.

Suggest that the authors omit the sentence “p = 0.005, Fishers Exact Test compared to published control cohort” from the legend of Table 1. This is already more clearly explained in the text on page 5.

The abbreviation Exo is explained in Figure 1 but not in Figure 2.

I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Approved

John P. Atkinson, Referee1 and Andria L. Ford, Co-referee2
1Division of Rheumatology, Washington University School of Medicine, St. Louis, MO, USA
2Department of Neurology, Washington University School of Medicine, Saint Louis, MO, USA
Competing interests: No competing interests were disclosed.
Review date: 2017 November 13. Status: Approved

I recommend this paper be published as it has important albeit largely negative data. There are several points though that the authors should consider addressing.

Authors:

  1. The authors are to be commended on putting together their remarkable cohorts – numbers are impressive. Several reports of “associations” such as in Reference 20 are under powered and the authors nicely point this out.
  2. Another point to make is that RVCL mutations are frame-shift. The protein these patients produce is lacking its COOH-tail. TREX1 is on the “loose” so to speak. The variants identified herein in the COOH tail in stroke or control cohorts herein would thus not be expected to lead to RVCL.
  3. The authors should comment that testing for the presence of lacunar stroke is not the same as testing for accelerated small vessel disease. We don’t see lacunar strokes in patients with RVCL/CRV/TREX1 vasculopathy. The ischemic damage is even on a smaller scale (truly a microangiopathy).
  4. A medical biostatistician specially in genetics should review this paper.

We have read this submission. We believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.


Articles from Wellcome Open Research are provided here courtesy of The Wellcome Trust