PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of ajcrLink to Publisher's site
 
Am J Cancer Res. 2017; 7(11): 2144–2156.
Published online 2017 November 1.
PMCID: PMC5714744

CSF-1R regulates non-small cell lung cancer cells dissemination through Wnt3a signaling

Abstract

Therapeutic antibodies targeting colony stimulating factor 1 receptor (CSF-1R) to block colony stimulating factor-1/colony stimulating factor 1 receptor (CSF-1/CSF-R) signaling axis have exhibit remarkable efficacy in the treatment of malignant tumor. Yet, little is known about the effects of intrinsic CSF-1R in human non-small-cell carcinoma (NSCLC). Here we demonstrated that NSCLC cell-intrinsic CSF-1R promoted cells growth and metastasis both in vitro and in vivo. CSF-1R knocked-down by transfecting with shRNA target CSF-1R suppressed NSCLC cells proliferation and tumor growth in nude mice. Conversely, ectopic expression of CSF-1R promoted cells proliferation and accelerated tumor growth. Mechanistically, the NSCLC CSF-1R modulated downstream effectors of phosphatidylinositol 3-kinase (PI3K) signaling. In addition, CSF-1R overexpression significantly enhanced NSCLC cells mobility, invasion and epithelial-mesenchymal transition (EMT) process, whereas silencing CSF-1R inhibits these phenotypes. Microarray analysis suggested that Wnt family member 3a (Wnt3a) function as a downstream factor of CSF-1R. On account of this, we future identified CSF-1R/Wnt3a a signaling pathway sustained NSCLC cells metastasis. Finally, in patients, CSF-1R and Wnt3a expression positively correlated with the of NSCLC patients. Our results identify NSCLC cell intrinsic functions of CSF-1R/Wnt3a axis in dissemination of NSCLC.

Keywords: CSF-1R, NSCLC, EMT, metastasis, Wnt3a

Introduction

Solid tumors consist of neoplastic cells and host cells such as lymphocytes, macrophages and stromals cells [1]. Stromals cells sustain tumor cells growth and metastasis by secreting various cytokines. Colony-stimulating factor 1 (CSF-1) is secreted by both stromals cells and cancer cells [2]. CSF-1 binds to the tyrosine kinase receptor, such as colony stimulating factor 1 receptor (CSF-1R) on cancer cells, which results in cancer progression [3]. Actually, the over-expression of CSF-1 is closely related to poor prognosis in a number of cancer types, including lung, pancreatic, renal and ovarian cancer. Substantive researches indicate that the oncogenic role of CSF-1R owing to the co-expression of its growth factor/receptor pair [4]. Activation of CSF-1R by CSF-1 triggers a series of molecular events, including tyrosine phosphorylation of CSF-1R. Phosphorylation of CSF-1R creates binding sites for a variety of cytoplasmic proteins that activate phosphatidylinositol 3-kinase (PI3K) and extracellular regulated protein kinase 1/2 (ERK1/2) [5]. Tyrosine kinases inhibitors (TKI) (e.g. imatinib) has recently opened a new era in the therapy of solid tumors [6]. Few of TKI drugs are effective on CSF-1R and more importantly, several drugs targeting CSF-1/CSF-1R axis, such as PLX3397 are currently in Phase I/II trial [7].

Lung cancer accounts for the leading cause of cancer associated mortality worldwide characteristic with locally unresectable or metastatic disease [8]. During the neoplastic progression of lung cancer, cancer cells invade surrounding tissue and spread to distant sites including liver, brain, and other organs [9]. Unfortunately, there no effective means can efficiently prevent tumor-cell metastasis in lung cancer. Epithelial-mesenchymal transition (EMT) refers to morphological and phenotypic alterations of epithelial cells during embryonic development and tumor metastasis [10]. The process of EMT is accompanied by different expression of epithelial and mesenchymal molecular markers [11]. Previous study characterizes CSF-1R function as a promoter of growth and metastasis of canine mammary cancer cells [12]. In a study of breast adenocarcinomas (grades 1-3), the invasive tumor cells possess the evaluated expression of CSF-1 and block CSF-1/CSF-1R axis would subsequently inhibit metastasis and primary tumor growth [13]. Co-expression of CSF-1 and its receptor in metastatic ovarian cancer specimens is a predictor of poor prognosis in ovarian cancer [14]. In addition, lung carcinoma cell lines that express CSF-1R exhibited increased metastatic into basement membrane upon stimulated with CSF-1 [15]. On the basis of these studies, CSF-1/CSF-1R signaling is considered a potential target for cancer metastasis.

Here, we revealed that both non-small-cell carcinoma cell lines and clinical lung cancer contain CSF-1R-expressing cancer subpopulations. Over-expression of CSF-1R promoted NSCLC cells growth and conversely, NSCLC-specific CSF-1R knock-down inhibit tumor growth. In addition, we demonstrated that CSF-1R participated in the EMT and metastasis of NSCLC cells. Moreover, we identified that Wnt3a was the functional mediator of CSF-1R in NSCLC metastasis. Altogether, our results expanded the functions of CSF-1R/Wnt3a axis in NSCLC and suggested that targeting cancer cell-intrinsic CSF-1R might contribute to combat NSCLC growth and metastasis.

Materials and methods

Histological and immunohistochemical analysis

127 cases of primary lung cancer that underwent surgery in the Qilu Hospital, Shandong University between 2007 and 2011 were enrolled. Tissue collecting includes paired cancer tissues and adjacent non-tumor (ANT) lung tissues. All tissues were immediately frozen and stored in liquid nitrogen until use. All patients received no preoperative chemotherapy or radiotherapy. The clinical stages were determined according to the International Association for the Study of Lung Cancer (IASLC) Tumor-Node-Metastasis (TNM) classification. This study was approved by the Research Ethics Committee of Qilu Hospital. Informed consent was obtained from all of the patients. The clinic-pathological features of patients, including age, gender, histopathological type, TNM stage, were summarized in Supplemental Table 1. Human NSCLC tissues were fixed in 4% paraformaldehyde and embedded in paraffin wax. Immunohistochemical analysis was performed for different markers in this study.

Cell culture and cell viability assay

NSCLC lines (A549, H1650, H1975 and HCC827) were purchased from Chinese Academy of Sciences Cell Bank of Type Culture Collection (Shanghai, China). Cell lines were cultured in RPMI-1640 or DMEM supplemented with 10% FBS (Wisent, Quebec, Canada), 100 μg/mL (streptomycin/penicillin) and maintained in an incubator with 5% CO2 at 37°C. 1 × 105/ml cells were seeded into 96-well plates. After 24 h, 48 h, 72 h or 96 h, cell viability was determined by CellTiter 96® AQueous One Solution cell proliferation assay (MTS, Promega, Madison, WI, USA) using a SpectraMax 340 (Molecular Devices) at 490 nm.

Generation of CSF-1R knockdown or overexpressing cell line variants

Human shRNA constructs targeting CSF-1R and non-targeting shRNA control was brought from Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO, USA). The target sequences of shRNAs were listed: CSF-1R shRNA-1: CCGGACAGGAGAGAGCGGGACTATACTCGAGTATAGTCCCGCTCTCTCCTGTTTTTTG; CSF-1R shRNA-2: CCGGTGCTGCTATTGTACAAGTATACTCGAGTATACTTGTACAATAGCAGCATTTTTG. Plasmids coding for CSF-1R proteins, Wnt3a or control vector pReceiver-M01 were brought from GeneCopoeia (San Diego, CA, USA). Cells were transfected with plasmids or shRNAs by Lipofectamine 2000 reagent (Thermo Fischer Scientific). Oligonucleotides for human Wnt3a siRNA and negative control siRNA (scramble) were purchased from GenScript (GenScript, Nanjing, Jiangsu, China). The target sequences of Wnt3a siRNA was 5’-CGGATACTTCTTACTCCTC-3’: Cells were transfected with specific siRNA or scrambel using t Lipofectamine 2000 reagent (Thermo Fischer Scientific) according to the instruction manual.

Wound closure and invasion assay

1 × 105 H1975 cells were plated in 6-well plates. After H1975 cells reached 90% confluency, a wound was created with a 100 μl pipette tip. Then, the 6-well plates were washed with PBS to remove detached cells. The width of the wound was monitored with an inverted microscope after 24 h [16]. The percentage of migrated cells was counted. In Transwell invasion assay, 1 × 105 cells were seeded into the upper chamber of Transwell. Medium containing 20% FBS was added to the lower chamber. After 18 h, the invaded H1975 cells were counted in at least 3 randomly selected fields [17].

Flow cytometry and immunofluorescence staining

H1975 cells were detached and fixed with 4% PFA on ice, washed with PBS and re-suspended for anti-CSF-1R-APC conjugated antibody and its isotype matched control (Biolegend) antibody staining. Gates were drawn in order to exclude background staining (based on the isotype-stained samples). In immunofluorescence assay, H1975 cells were fixed in 4% paraformaldehyde and permeabilized in 0.1% Triton X-100. Wnt3a was detected by staining with anti-Wnt3a antibody overnight at 4°C followed by incubating with goat anti-rabbit IgG-FITC for 1 h at room temperature. Cell nuclei were stained with Hoechst for 10 min.

Soft agar assay

Culture medium (0.5 ml) containing 1% agarose (BD) was added to a 24-well plate and allowed to harden. 2 × 103 H1975 cells were suspended in 0.2 ml medium containing 0.1% agarose and overlaid on the bottom layer. 0.5 ml fresh medium was added to each well once a week for 4 weeks. The plate was stained with 0.1% crystal violet, and the cell colonies were counted.

Quantitative real-time RT-PCR (qRT-PCR)

Total RNA was isolated from cells using TRIzol reagent (Invitrogen, USA). First-strand cDNA was synthesized with 1 μg RNA using a PrimeScript RT reagent kit (TakaraBio, Japan). qRT-PCR was conducted using iQTM SYBR® Green Supermix and iQ5 real-time detection system (Bio-Rad Laboratories, CA). The 2(-ΔΔCt) method was applied to quantify the expression levels of candidate genes. The primer pairs used for PCR were as follows: GAPDH (forward, 5’-GGAGCGAGATCCCTCCAAAAT-3’; reverse, 5’-GGCTGTTGTCATACTTCTCATGG-3’) was used as an internal control; CSF-1R (forward, 5’-GGGAATCCCAGTGATAGAGCC-3’; reverse, 5’-TTGGAAGGTAGCGTTGTTGGT-3’). Wnt3a (forward, 5’-CTCCTCTCGGATACCTCTTAGTG-3’; reverse, 5’-CCAAGGACCACCAGATCGG-3’). Total RNA was extracted from parental H1975 and H1975 CSF-1R knock-down cells, and the metastasis associated gene expression was analyzed in H1975 versus H1975 CSF-1R knock-down cells by qRT-PCR.

Western blot analysis

H1975 cells were lysed on ice in RIPA lysis buffer. 25 μg cell lysates was loaded and separated by 10% SDS-PAGE. The protein was transferred to PVDF membranes. PVDF was blocked and incubated with monoclonal antibody against CSF-1R (1:1000, Santa Cruz Biotechnology), Wnt3a (1:1000, Santa Cruz Biotechnology), PI3K (1:1000, Signalway Antibody) and phosphor-PI3K Tyr 485 (1:10000, Epitomics), AKT and phosphor-AKT Ser473 (1:1000, Cell Signaling Technology), mTOR and phospho-mTOR Ser2448 (1:1000, Cell Signaling Technology), ERK1/2 and phospho-ERK1/2 Thr 202 (1:1000, Cell Signaling Technology), GPADH (1:10000, Bioworld Technology) followed by incubation with horseradish peroxidase-conjugated IgGs (1:10000, Bioworld Biotechnology). The protein was then visualized using ECL system (Millipore).

Xenograft and lung metastasis assay

Cell lines infected with specific shRNA or plasmids were re-suspended in PBS and injected subcutaneously into flanks of nude mice (Shanghai Slack Laboratory). One week after injection, the tumor mass were measured with calipers every 3 days and tumor volumes were calculated by the formula: 0.5 × length × width2. To evaluate the metastatic of indicated H1975 cells, 2 × 106 cells in 100 μl PBS were injected into 6-weeks-old female nude mice via tail vein. After 8 weeks, mice were sacrificed and quantitation of metastatic colonies was performed on hematoxylin and eosin (H&E) stained. All animal experiments were approved by the Committee on Animal Care of Shandong University.

Statistical analysis

The data were shown as mean ± SD. Differences in the results of two groups were evaluated using either two-tailed Student’s t test or one-way ANOVA. P < 0.05 was considered statistically significant.

Result

CSF-1R is over-expressed in NSCLC

In order to mechanistically dissect the potential significance of CSF-1R in NSCLC, we characterized the expression of CSF-1R in a series of NSCLC clinical samples (Supplemental Table 1) and several tumor cell lines. Immunohistochemical staining of clinical NSCLC biopsies with CSF-1R antibody demonstrated the higher level of CSF-1R in NSCLC lesions, as compare to the adjacent non-tumor tissue (Figure 1A). Kaplan-meier survival analysis revealed that over-expression of CSF-1R correlated with poor prognosis in patient with NSCLC (Figure 1B). qPCR (Figure 1C) and immunoblot analysis (Figure 1D) identified that several NSCLC cell lines, including H1650, A549, HCC827 and H1975 exhibited high expression of CSF-1R. Furthermore, flow cytometric was performed to analyze CSF-1R in the surface of NSCLC cells and the results revealed that CSF-1R positive tumor cells frequencies ranged from 13.6% to 36.5% (Figure 1E). Finally, H1975 was selected to form NSCLC grafts in mice and immunohistochemical analysis verified CSF-1R expression by NSCLC cells (Figure 1F). Together, these results suggest that CSF-1R is increasing during NSCLC progression.

Figure 1
CSF-1R is over-expression in NSCLC tissues and cell lines. A. Immunohistochemical staining of CSF-1R in human NSCLC tissue. The intensity of CSF-1R staining was quantified using ImageJ Plus and shown in the box plot below. Scale bars represent 100 μm. ...

CSF-1R modulates tumor growth in vivo

To dissect the functional role of CSF-1R in NSCLC cells growth, we generated CSF-1R knock-down (knock-down) and CSF-1R-overexpressing (OE) NSCLC H1975 cells. Transduction of H1975 cells with two distinct shRNAs targeting CSF-1R significantly inhibited CSF-1R mRNA and blocked protein expression of CSF-1R compared to control cells (Figure 2A). Conversely, transduction with CSF-1R-encoding constructs resulted in up-regulation both mRNA and protein level of CSF-1R in H1975 cells (Figure 2D). We next investigated the role of endogenous CSF-1R in tumor growth in vivo. CSF-1R-knock down resulted in decreased (Figure 2B) and CSF-1R-OE increased (Figure 2E) H1975 NSCLC growth in nude mice compared to that of controls. At the experimental endpoint, CSF-1R-knock-down demonstrated diminished (Figure 2C) and CSF-1R-OE H1975 grafts significantly increased (Figure 2F) CSF-1R mRNA and CSF-1R protein expression compared to control tumors. We next examined the effects of CSF-1R silencing or overexpression on H1975 cells growth and colony formation in vitro. Consistent with the vivo findings, CSF-1R-knock-down impaired H1975 cells proliferation (Figure 3A) and colony formation abilities (Figure 3B), whereas CSF-1R-OE promoted in vitro culture growth (Figure 3D) and clonogenicity (Figure 3E) compared to respective controls. Because the expression of CSF-1R in cancer cells regulates series of downstream signaling pathwayssuch as ERK and PI3K/AKT/mTOR signaling, which play critical roles in tumor growth and metastasis, we determined the effect of CSF-1R knock-down in phosphorylation of ERK1/2, PI3K, AKT and mTOR. CSF-1R knock-down reduced (Figure 3C) and over-expression (OE) increased (Figure 3F) phosphorylation of the ERK1/2, PI3K, AKT and mTOR, which indicated CSF-1R mediated induction of pro-tumorigenic ERK and PI3K/AKT/mTOR signaling pathway. Altogether, these results suggested the intrinsic functions of CSF-1R in NSCLC growth.

Figure 2
NSCLC cells expressed CSF-1R promotes tumorigenicity in xenotransplanted tumor model. A. CSF-1R mRNA (lower panel) and protein expression (upper panel) by CSF-1R-shRNA-1 and CSF-1R-shRNA-2 versus vector control. B. Tumor growth kinetics (mean ± ...
Figure 3
H1975 cells expressed CSF-1R promotes cells growth in vitro. A. Control shRNA or shRNA against CSF-1R were transfected into H1975 cells. After 24 h post transfections, cells were cultured for further 24 h, 48 h, 72 h, 96 h, respectively, and subjected ...

CSF-1R knockdown in NSCLC cells inhibits EMT

Epithelial-mesenchymal transition (EMT) is characterized by tumor cells mobility and up-regulation of mesenchymal markers and epithelial markers decreasing. To future characterize the role of CSF-1R in NSCLC metastasis; we noticed the morphology of H1975 cells change from spindle-like and scattered appearance to cobble stone-like shape, once CSF-1R was down-regulation in H1975 cells (Figure 4A). We next determined these characteristics in the CSF-1R knock-down H1975 cells to investigate whether CSF-1R knock-down inhibits H1975 cells EMT. In the wound healing analysis, the control cells exhibited remarkably faster wound healing than CSF-1R knock-down cells (Figure 4B). Consistent with it, CSF-1R knock-down significantly reduced H1975 cells invasion in the Transwell analysis (Figure 4C). In addition, the CSF-1R knock-down cells appeared significantly increase in epithelial markers and a loss of mesenchymal markers (Figure 4D). Ectopic over-expressing of CSF-1R in the H1975 cells (Figure 4E) effectively restored the epithelial morphology (Figure 4F). Meanwhile, up-regulation of CSF-1R accelerate H1975 cells migration, invasion and restore its EMT phenotypes (Figure 4G-I). Together, these results indicate that reducing CSF-1R suppressed metastasis and EMT in H1975 cells.

Figure 4
CSF-1R knock-down suppresses EMT in H1975 cells. A. Phase-contrast images of control and two CSF-1R knock-down pools. Scale bars represent 100 μm. B. Wound healing assay. Confluent cell monolayers were wounded, and wound closure was monitored ...

Identification of Wnt3a as a CSF-1R target gene

In order to unravel cellular pathways involved in CSF-1R-mediated NSCC metastasis, we performed gene expression analysis in parental cells and CSF-1R knock-down H1975 cells (Figure 5A). We selected a panel of 21 genes involved in regulation of migration and invasion. The most down-regulated gene was Wnt3a, which activate the calcium-calmodulin kinase, protein kinase c or Jun NH (2)-terminal kinase pathway, called non-canonical Wnt signaling (Figure 5B). Wnt3a regulates multiple cancer-associated processes including proliferation, survival, EMT, metastasis and angiogenesis. Interestingly, lung cancers generally have higher levels of Wnt3a expression, which is associated with reduced disease-free survival. We confirmed that CSF-1R knock-down down-regulated both Wnt3a mRNA and protein (Figure 5C, ,5D).5D). Similar results were obtained from immunofluorescence assay. Notably, shRNA-based CSF-1R depletion remarkably diminished the expression of Wnt3a in H1975 cells (Figure 5E). We therefore evaluated migration and invasion of H1975 cells upon Wnt3a depletion (Figure 5F). Wnt3a knock-down reduced migration by 45% (Figure 5G) and invasion was remarkably suppressed in the Wnt3a knock-down H1975 cells (Figure 5H). Furthermore, H1975 shWnt3a cells exhibited a flat, cobblestone-like morphology, whereas the control cells had a spindle shape feature (Figure 5I). These results identify Wnt3a as a CSF-1R target gene that regulates H1975 cancer cell migration and invasion.

Figure 5
Identification of Wnt3a as a CSF-1R-dependent gene. A. Screening strategy. B. Heatmap representing relative expression of 46 genes involved in regulation of migration and invasion in response to CSF-1R depletion in H1975 cells. Z scores are represented ...

CSF-1R regulates migration and invasion through Wnt3a

CSF-1R regulation of Wnt3a expression led us to hypothesize that CSF-1R regulates NSCLC cell migration and invasion through Wnt3a signaling. CSF-1R and Wnt3a may act in a single signaling pathway. If CSF-1R acts upstream of Wnt3a, we would expect that ablation of CSF-1R or Wnt3a individually impairs migration and invasion to a similar degree, compared to co-depletion. We conducted migration and invasion assays under these conditions (Figure 6A, ,6B).6B). As shown above, individual ablation of CSF-1R or Wnt3a significantly reduced migration and invasion. In support of the hypothesis, co-depletion of CSF-1R and Wnt3a did not cause additive inhibition. Furthermore, if CSF-1R acts upstream of Wnt3a, Wnt3a overexpression in CSF-1R-depleted cells should restore cell migration and invasion. Similarly, CSF-1R over-expression in Wnt3a-depleted cells should fail to rescue. We found that overexpression of either CSF-1R or Wnt3a increased migration and invasion by about 20~30% in shRNA control cells (Figure 6C, ,6D).6D). Critically, Wnt3a overexpression rescued migration (Figure 6C) and invasion (Figure 6F) in CSF-1R-depleted cells. CSF-1R overexpression in Wnt3a-depleted cells failed to restore migration and invasion, confirming that Wnt3a acts downstream of CSF-1R. To test the hypothesis that CSF-1R/Wnt3a signaling is crucial for NSCLC propagation, we employed qPCR assay to measure the endogenous expression of Wnt3a in tissues of NSCLC. We found Wnt3a was significantly up-regulated in the tissues of NSCLC (Figure 6E). Statistical analysis revealed that up-regulation of Wnt3a correlated with NSCLC patient poor prognosis (Supplemental Table 2 and Figure 6F). More importantly, Wnt3a expression was highly positive correlated with CSF-1R (Figure 6G). Taken together, our results indicate that CSF-1R regulates migration and invasion through Wnt3a signaling.

Figure 6
Wnt3a acts downstream of CSF-1R to regulate H1975 cells migration and invasion. A. H1975 was transfected with the indicated shRNAs (scramble, shCSF-1R, shWnt3a) for 24 h prior to conduct migration assays. Bars show means ± SD of three independent ...

Discussion

The current study provides new insights into colony-stimulating-factor receptor-1 (CSF-1R) pathway functions in NSCLC growth and metastasis [18]. Firstly, we conducted a comprehensive characterization of CSF-1R in clinical lung cancer biopsies and established NSCLC cells. Substantive researches in solid tumors demonstrate that the CSF-1/CSF-1R axis correlates with adverse prognosis of breast, lung, prostate and kidney cancer [19]. Activation of CSF-1R by its ligand CSF-1 not only occurs in an autocrine manner in tumor cells, but also in paracrine manner, which CSF-1R is stimulated by CSF-1 secreted by fibroblasts. Taking these data together, several drugs specific targeting CSF-1R (e.g. imatinib) has been developed and is currently in Phase I/II trial [20]. Although the dysregulated expression of CSF-1R has been documented in solid tumors, few studies performed to investigate the potential role of CSF-1R in the NSCLC. In this study, qRT-PCR, immunoblotting and flow cytometric were conducted to reveal the over-expression of CSF-1R in clinical tumor samples and lung cancer cell lines.

Preclinical data reveal that tumor-associated macrophages (TAMs) is a potential therapeutic target owing to they promote various tumor processes, include, escape of immunologic surveillance and secret pro-angiogenic factors [21]. To date, CSF-1R has been mainly studied in TAMs. Several approaches have been used to ablate TAMs or inhibit their tumor promoting functions in mouse models of tumor. One strategy is CSF-1R inhibition, which depleted macrophages and reduced tumor in volume in several xenografts. Our study demonstrates CSF-1R in a non-TAMS cell type, i.e. NSCLC cells. Similar to the pro-tumorigenic effects of TAMs expressed CSF-1R, our finding establish CSF-1R expressed by NSCLC cells function as a tumor growth and metastasis promoting mechanism in multiple experimental in vitro and in vivo. Phosphorylation of CSF-1R tyrosine creates binding sites for a variety of cytoplasmic proteins that activate signal transduction pathways, including PI3K and ERK1/2. Consistent with the interrelationship of CSF-1R and ERK1/2 signaling in breast cancer cells, we found that CSF-1R knock-down decreased, while CSF-1R over-expression (OE) increased phosphorylation of the PI3K/AKT/mTOR and ERK1/2 signaling. Future studies will try to determine whether NSCLC CSF-1R dependent phosphorylation was reversed via pharmacological inhibition of mTOR.

TAMs have high impact on the cancer development owing to the facilitate invasion, angiogenesis, and tumor cell mobility. Clinical specimens from ovarian cancer metastasis possess strong immunostaining for CSF-1 and CSF-1R, as compared to noninvasive borderline tumors and benign ovarian tissues, which express litter or no CSF-1/CSF-1R [22]. Blockade of CSF-1R signaling using ribonucleic acid (RNA) interference or pharmacological inhibitors completely inhibits microglial enhancement of glioblastoma invasion. To advance human NSCLC treatment, it is necessary to understand the molecular mechanisms underlying tumor invadion and metastasis. Overcoming the drug resistance mediated by growth and receptor tyrosine kinases have been of particular interest in lung cancer therapy. In this study, we highlight the importance of CSF-1R in regulating NSCLC cell EMT and metastasis, which suggested a new therapeutic option to combat metastatic of NSCLC. The increase in CSF expression in NSCLC cells resulted in a highly significant increase in the invasiveness and mobility observed in vitro. In contrast, the CSF knock-down NSCLC cells provide less invasiveness and mobility. Modulation of CSF-1R levels in NSCLC cells is achieved at the EMT protein levels and correlated with tumor cells phenotype. Meanwhile, the over-expression CSF-1R correlates with a significantly higher number of metastatic lesions in vivo.

Our study also identified the metastasis associated genes whose expression is altered by CSF-R knockdown, which suggested the Wnt3a is direct target of CSF-1R. Here we report a new CSF-1R/Wnt3a signaling axis in NSCLC cancer cells metastasis. We show that CSF-1R regulates Wnt3a expression to regulate NSCLC cancer migration and invasion. The Wnt signaling pathway is commonly activated and altered in cancer. Wnt3a has been implicated in regulation of multiple processes in cancer, including proliferation, survival, EMT, angiogenesis, metastasis, cancer cell ‘stemness’ and therapy resistance in several cancer types [23]. Consistent with the previous studies, in our NSCLC cancer cells metastatic model system in vitro, Wnt3a is identified as one gene in cancer cells migration and invasion. Altogether, this study demonstrated that CSF-1R function as tumor promoter in NSCLC by regulation the activity of Wnt3a and accelerating EMT, migration, invasion and metastasis. Therefore, CSF-1R protein constitutes a promising therapeutic target to resolve tumor progression and dissemination.

Disclosure of conflict of interest

None.

Supporting Information

References

1. Pyonteck SM, Akkari L, Schuhmacher AJ, Bowman RL, Sevenich L, Quail DF, Olson OC, Quick ML, Huse JT, Teijeiro V, Setty M, Leslie CS, Oei Y, Pedraza A, Zhang J, Brennan CW, Sutton JC, Holland EC, Daniel D, Joyce JA. CSF-1R inhibition alters macrophage polarization and blocks glioma progression. Nat Med. 2013;19:1264–1272. [PMC free article] [PubMed]
2. Pass HI, Lavilla C, Canino C, Goparaju C, Preiss J, Noreen S, Blandino G, Cioce M. Inhibition of the colony-stimulating-factor-1 receptor affects the resistance of lung cancer cells to cisplatin. Oncotarget. 2016;7:56408–56421. [PMC free article] [PubMed]
3. Ries CH, Hoves S, Cannarile MA, Ruttinger D. CSF-1/CSF-1R targeting agents in clinical development for cancer therapy. Curr Opin Pharmacol. 2015;23:45–51. [PubMed]
4. Ries CH, Cannarile MA, Hoves S, Benz J, Wartha K, Runza V, Rey-Giraud F, Pradel LP, Feuerhake F, Klaman I, Jones T, Jucknischke U, Scheiblich S, Kaluza K, Gorr IH, Walz A, Abiraj K, Cassier PA, Sica A, Gomez-Roca C, de Visser KE, Italiano A, Le Tourneau C, Delord JP, Levitsky H, Blay JY, Ruttinger D. Targeting tumor-associated macrophages with anti-CSF-1R antibody reveals a strategy for cancer therapy. Cancer Cell. 2014;25:846–859. [PubMed]
5. Krol M, Majchrzak K, Mucha J, Homa A, Bulkowska M, Jakubowska A, Karwicka M, Pawlowski KM, Motyl T. CSF-1R as an inhibitor of apoptosis and promoter of proliferation, migration and invasion of canine mammary cancer cells. BMC Vet Res. 2013;9:65. [PMC free article] [PubMed]
6. Scott DA, Aquila BM, Bebernitz GA, Cook DJ, Dakin LA, Deegan TL, Hattersley MM, Ioannidis S, Lyne PD, Omer CA, Ye M, Zheng X. Pyridyl and thiazolyl bisamide CSF-1R inhibitors for the treatment of cancer. Bioorg Med Chem Lett. 2008;18:4794–4797. [PubMed]
7. Swierczak A, Cook AD, Lenzo JC, Restall CM, Doherty JP, Anderson RL, Hamilton JA. The promotion of breast cancer metastasis caused by inhibition of CSF-1R/CSF-1 signaling is blocked by targeting the G-CSF receptor. Cancer Immunol Res. 2014;2:765–776. [PubMed]
8. Liang J, Liu X, Yin B, Liu H, Xiao J, Li Y. Efficacy assessment of pemetrexed treatment of an NSCLC case with brain metastasis. Oncol Lett. 2012;4:1119–1121. [PMC free article] [PubMed]
9. Wang X, Chen X, Meng Q, Jing H, Lu H, Yang Y, Cai L, Zhao Y. MiR-181b regulates cisplatin chemosensitivity and metastasis by targeting TGFbetaR1/Smad signaling pathway in NSCLC. Sci Rep. 2015;5:17618. [PMC free article] [PubMed]
10. Wei L, Sun JJ, Cui YC, Jiang SL, Wang XW, Lv LY, Xie L, Song XR. Twist may be associated with invasion and metastasis of hypoxic NSCLC cells. Tumour Biol. 2016;37:9979–9987. [PubMed]
11. Zhang D, Chen C, Li Y, Fu X, Xie Y, Li Y, Huang Y. Cx31.1 acts as a tumour suppressor in non-small cell lung cancer (NSCLC) cell lines through inhibition of cell proliferation and metastasis. J Cell Mol Med. 2012;16:1047–1059. [PMC free article] [PubMed]
12. Sullivan AR, Pixley FJ. CSF-1R signaling in health and disease: a focus on the mammary gland. J Mammary Gland Biol Neoplasia. 2014;19:149–159. [PubMed]
13. Barbetti V, Morandi A, Tusa I, Digiacomo G, Riverso M, Marzi I, Cipolleschi MG, Bessi S, Giannini A, Di Leo A, Dello Sbarba P, Rovida E. Chromatin-associated CSF-1R binds to the promoter of proliferation-related genes in breast cancer cells. Oncogene. 2014;33:4359–4364. [PMC free article] [PubMed]
14. Quail DF, Bowman RL, Akkari L, Quick ML, Schuhmacher AJ, Huse JT, Holland EC, Sutton JC, Joyce JA. The tumor microenvironment underlies acquired resistance to CSF-1R inhibition in gliomas. Science. 2016;352:aad3018. [PMC free article] [PubMed]
15. Cioce M, Canino C, Goparaju C, Yang H, Carbone M, Pass HI. Autocrine CSF-1R signaling drives mesothelioma chemoresistance via AKT activation. Cell Death Dis. 2014;5:e1167. [PMC free article] [PubMed]
16. Dong C, Du Q, Wang Z, Wang Y, Wu S, Wang A. MicroRNA-665 suppressed the invasion and metastasis of osteosarcoma by directly inhibiting RAB23. Am J Transl Res. 2016;8:4975–4981. [PMC free article] [PubMed]
17. Gao H, Zhong F, Xie J, Peng J, Han Z. PTTG promotes invasion in human breast cancer cell line by upregulating EMMPRIN via FAK/Akt/mTOR signaling. Am J Cancer Res. 2016;6:425–439. [PMC free article] [PubMed]
18. Holmgaard RB, Brachfeld A, Gasmi B, Jones DR, Mattar M, Doman T, Murphy M, Schaer D, Wolchok JD, Merghoub T. Timing of CSF-1/CSF-1R signaling blockade is critical to improving responses to CTLA-4 based immunotherapy. Oncoimmunology. 2016;5:e1151595. [PMC free article] [PubMed]
19. von Tresckow B, Morschhauser F, Ribrag V, Topp MS, Chien C, Seetharam S, Aquino R, Kotoulek S, de Boer CJ, Engert A. An openlabel, multicenter, phase I/II Study of JNJ-40346527, a CSF-1R inhibitor, in patients with relapsed or refractory hodgkin lymphoma. Clin Cancer Res. 2015;21:1843–1850. [PubMed]
20. Guo J, Marcotte PA, McCall JO, Dai Y, Pease LJ, Michaelides MR, Davidsen SK, Glaser KB. Inhibition of phosphorylation of the colonystimulating factor-1 receptor (c-Fms) tyrosine kinase in transfected cells by ABT-869 and other tyrosine kinase inhibitors. Mol Cancer Ther. 2006;5:1007–1013. [PubMed]
21. Quail DF, Joyce JA. Molecular pathways: deciphering mechanisms of resistance to macrophage-targeted therapies. Clin Cancer Res. 2016;23:876–884. [PMC free article] [PubMed]
22. Casbon AJ, Lohela M, Werb Z. Delineating CSF-1-dependent regulation of myeloid cell diversity in tumors. Oncoimmunology. 2015;4:e1008871. [PMC free article] [PubMed]
23. Wang S, Qiu M, Xia W, Xu Y, Mao Q, Wang J, Dong G, Xu L, Yang X, Yin R. Glypican-5 suppresses epithelial-mesenchymal transition of the lung adenocarcinoma by competitively binding to Wnt3a. Oncotarget. 2016;7:79736–79746. [PMC free article] [PubMed]

Articles from American Journal of Cancer Research are provided here courtesy of e-Century Publishing Corporation