PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of plosonePLoS OneView this ArticleSubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)
 
PLoS One. 2017; 12(9): e0184162.
Published online 2017 September 1. doi:  10.1371/journal.pone.0184162
PMCID: PMC5581180

Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization

Marcin Olszewski, Conceptualization, Formal analysis, Investigation, Methodology, Writing – original draft,1 Marta Śpibida, Formal analysis, Investigation, Validation, Visualization, Writing – original draft,1 Maciej Bilek, Formal analysis,2 and Beata Krawczyk, Conceptualization, Supervision, Writing – original draft, Writing – review & editing1,*
Ruslan Kalendar, Editor

Abstract

DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein) were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s), processivity (19 nt), thermostability (half-life 35 min at 95°C) and higher tolerance to PCR inhibitors (0.3–1.25% of whole blood, 0.84–13.5 μg of lactoferrin and 4.7–150 ng of heparin) than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM) and KCl or (NH4)2SO4 salts (more than 60 mM and 40 mM, respectively). Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

Introduction

With advances in science, there is a growing use of thermostable DNA polymerases. Many new enzymes have been identified and described, predominantly those which were isolated from genera such as Thermus, Thermococcus and Pyrococcus. Depending on their origin and genetic variation, polymerases have different properties and be used for various purposes. Taq DNA polymerase isolated from the thermophilic eubacterium Thermus aquaticus [1] has revolutionized molecular biology and has become one of the most commonly used polymerases. It is the first thermostable enzyme ever used in PCR [2]. The native Taq DNA polymerase is isolated from Thermus aquaticus and its recombinant form is manufactured commercially using E.coli as a host. It has a relatively short half-life as compared to other thermostable polymerases isolated from Archaea. Studies have shown that it takes 45–50 minutes to deactivate half of polymerase molecules at 95°C and 9 minutes at 97.5°C [3]; hence, the quest for the shortest possible denaturation times to be used during amplification [4]. In 1 kb products, the amplification efficiency of Taq DNA polymerase is estimated at approx. 80%, with the CG content varying from 45 to 56% [5]. The amplification efficiency decreases with amplicon size increasing above 1 kb. As a result there is a requirement to engineer Taq DNA polymerases for enhanced processivity and improved performance, which is achieved by combining polymerases with thermostable DNA-binding proteins. It has been shown that the covalent combination of a DNA polymerase with the Sso7d protein of Sulfolobus solfataricus significantly increases its processivity [6]. Taq DNA polymerases are widely used in diagnostics. The amplification of clinical and/or environmental samples becomes more and more problematic. Taq DNA polymerases become completely inhibited when a PCR mixture contains 0.004% of blood [7]. It seems that hemoglobin and lactoferrin play an important role in the inhibition of the amplification process. BSA was found to be the most efficient amplification facilitator [8].

Research to date has shown that proteins which naturally bind to single- or double-stranded DNA in a PCR reaction mix, improve the yield of amplification and efficiency of long PCR products [9,10]. When polymerase is fused with such proteins, their functional properties improve considerably without affecting their stability or activity, [6, 11, 12]. In our study, we decided to fuse a Nanoarchaeum equitans protein with the N-terminal end of Taq Stoffel DNA polymerase.

We have recently identified a Nanoarchaeum equitans protein (a NeqSSB-like protein) which was found to naturally bind to DNA [13]. This protein has a single OB fold and constitutes a biologically active monomer which is similar to SSBs isolated from certain viruses. NeqSSB-like proteins are highly thermostable and have the ability to bind to any form of DNA (ssDNA, dsDNA) and, surprisingly, to mRNA, without any structure-dependent preferences. The half-life of the ssDNA binding activity at 100°C is 5 min and its melting temperature (Tm) is 100.2°C [13].

The aim of this study was to clone and overexpress an E. coli fusion protein composed of a Taq Stoffel DNA polymerase and a NeqSSB-like protein, to purify the resulting gene product, study its biochemical properties and suitability for use in PCR, and to see how it compares to a Taq Stoffel DNA polymerase.

Materials and methods

Construction of recombinant plasmids

A nucleotide sequence of the Thermus aquaticus gene encoding a Stoffel fragment of the Taq DNA polymerase was obtained from the GenBank database (accession number J04639.1). The T. aquaticus strain (ATCC25104) was used to isolate a genomic DNA which was then used as a template to amplify a taq Stoffel fragment gene by using the standard PCR amplification protocol with a Hypernova DNA polymerase (BLIRT SA, Gdansk, Poland). A DNA fragment of the taq Stoffel corresponding to nucleotides 997 to 2626 was obtained in PCR using the primers: F 5’ AATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCCCTGGAGGAGGCCC (forward) and R 5’ GCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTTAatggtggtggtggtggtgCTCCTTGGCGGAGAGCCAG (reverse). The primers contained sequences which were complementary to the taq Stoffel gene (underlined), a sequence complementary to pET-30 Ek/LIC vector (italics), and an oligohistidine tag sequence (lowercase). A stop codon (TTA) was added to the reverse primer immediately after the oligohistidine sequence. After amplification, the PCR product (1703 bp) was mixed with the DNA of pET-30 Ek/LIC vector (Novagen, Madison, WI, USA) which was digested by BamHI and NdeI enzymes (NEB, UK) and, following this, the mixture was used in a cloning experiment in which the OverLap Assembly kit was used (A&A Biotechnology, Poland). The E. coli TOP10 (Invitrogen, USA) cells were transformed with the help of a cloning mixture and several colonies were examined for the presence of a recombinant plasmid using a gel retardation assay and the restriction analysis.

Fusion with a NeqSSB-like gene on the N-terminal end of a taq Stoffel fragment corresponding to nucleotides 997 to 2626 was obtained in PCR with the use of the primers: F1 5’ GAGAGGCCGATGGAGGGGTCGACATGATCGCCCTGGAGGAGGCCC (forward) and R1 5’ GCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTTAatggtggtggtggtggtgCTCCTTGGCGGAGAGCCAG (reverse). The primers contained sequences complementary to the taq Stoffel gene (underlined), a sequence complementary to the pET-30 Ek/LIC vector (italics), a sequence for 6 amino acid linker residues (bolded) and a oligohistidine tag sequence (lowercase). The stop codon (TTA) was added to the reverse primer immediately following the oligohistidine sequence.

The DNA of pBAD/NeqSSB-likeHT plasmid [13] was used as a template for the amplification of the NeqSSB-like gene using the standard PCR amplification protocol. The forward primer was F2 5’ ATTTTGTTTAACTTTAAGAAGGAGATATACATATGGATGAAGAGGAACTAATACAACTAATAATAGAAAAAACT (it contained a sequence which was complementary to the NeqSSB-like gene (underlined) and a sequence which was complementary to the pET-30 Ek/LIC vector (italics)), whilst the reverse primer was R2 5’ TCCTCCAGGGCGATCATGTCGACCCCTCCATCGGCCTCTCCTTTAAAAGCTTTTA (it contained a sequence which was complementary to the NeqSSB-like gene (underlined) and a sequence for 6 amino acid linker residues (bolded). As a result of the PCR amplification, the following two products were obtained: a taq Stoffel gene (1703 bp) and a NeqSSB-like gene (793 bp). Following this, the PCR products were mixed with the DNA of the pET-30 Ek/LIC vector (Novagen, Madison, WI, USA) which was digested by BamHI and NdeI enzymes (NEB, UK) and the resulting mixture was used in a cloning experiment in which the OverLap Assembly kit was used (A&A Biotechnology, Poland). The cloning scheme of the fusion NeqSSB-TaqS polymerase is shown in S1 Fig.

E. coli TOP10 (Invitrogen, USA) cells were transformed with the help of the cloning mixture and several colonies were examined for the presence of a recombinant plasmid using a gel retardation assay and the restriction analysis. The resulting pET30/NeqSSB-TaqS plasmid contained a complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI), a sequence of the Taq Stoffel DNA polymerase (amino acid residues from 317 to 832) and as His tag domain which enables the purification of the recombinant protein using the metal affinity chromatography.

The nucleotide sequences of the resulting recombinant plasmids, pET30/TaqS and pET30/NeqSSB-TaqS were confirmed by the DNA sequencing (Genomed, Poland).

Expression and purification of TaqS and NeqSSB-TaqS DNA polymerases

The pET30/TaqS and pET30/NeqSSB-TaqS plasmids were transformed into the E. coli BL21 (DE3) RIL (Novagen, USA). The cells with a recombinant plasmid were grown to an OD600 of 0.4 in Luria-Bertani medium at 37°C, with the addition of kanamycin and chloramphenicol at a concentration of 50 μg/ml each, and were induced by IPTG at the final concentration of 1 mM for 24 h. The cells were centrifuged at 5000xg for 12 min and the pellets were resuspended in 20 ml of buffer A (50 mM Tris-HCl pH 9, 0.5 M NaCl and 5 mM imidazole). The samples were disintegrated five times for 45 s at 4°C, and centrifuged at 10000xg for 15 min. The supernatant was heat-treated at 70°C for 15 min and the denatured host proteins were removed by centrifugation. Following this, the protein was purified in a one-step process. We used the Ni2+-affinity chromatographic technique. The supernatant and the enzyme which was produced were put into a His•Bind Column (Novagen, USA), which was earlier prepared and equilibrated using buffer A. The recombinant proteins were washed two times using the washing buffer B (50 mM Tris-HCl pH 9, 0.5 M NaCl and 40 mM imidazole) and then eluted with the elution buffer C (50 mM Tris-HCl pH 9, 0.5 M NaCl and 300 mM imidazole). The eluted fractions were dialyzed three times against buffer D (100 mM Tris-HCl pH 8, 100 mM KCl, 0.2 mM EDTA). The trace amounts of the genomic bacterial DNA were removed using 25 U of Benzonase (Merck, Darmstadt, Germany) and MgCl2 at the final concentration of 5 mM. Following this, the protein sample was incubated at 37°C for 1 h. The enzyme was inactivated, by incubation at 70°C for 15 min whilst the denatured proteins were removed by centrifugation. The final formulation was prepared for storage (50 mM Tris-HCl pH 8, 50 mM KCl, 1 mM DTT, 0.1 mM EDTA, 1% Tween 20, 1% Nonidet P-40 and 50% glycerol).

DNA polymerase activity assay

As directed in the EvaEZ Fluorometric Polymerase Activity Assay Kit Manual (Biotium, Hayward, USA), the DNA polymerase activity was assayed in an isothermal reaction at 72°C using MyGo/Pro Real-Time PCR instrument (IT-IS International Ltd., UK) in accordance with the definition of one unit of enzyme activity (“One unit of DNA polymerase activity is conventionally defined as the amount of enzyme that will incorporate 10 nmol of nucleotides during a 30-min incubation” [14]). The active DNA polymerase extended the primer to form a double-stranded product able to bind the EvaGreen dye with the resulting increase in fluorescence. The level of fluorescence was correlated with the polymerase activity and the number of bound nucleotides [1416]. The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl.

Optimization of PCR amplification

We optimized the working conditions for NeqSSB-TaqS DNA polymerases. Reactions were carried out using different buffer compositions with various pH values, which included various concentrations of MgCl2, KCl and (NH4)2SO4. In all these reactions, we used 1 mM of each dNTP, 0.4 mM of each primer, and a miniprep plasmid DNA as a PCR template with a unique known target sequence and size (PCR product of 300 bp). PCR was performed using 1U of the purified NeqSSB-TaqS DNA polymerase or TaqS DNA polymerase in 20 μl of the reaction mixture containing 5 ng of a DNA template. PCR was conducted as follows: an initial denaturation at 94°C for 1 min; 25 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 15 s and elongation at 72°C for 15 s. After the final cycle, the sample were incubated for 5 min at 72°C.

To determine the optimum MgCl2 concentration, the PCR was performed at increasing concentrations of MgCl2 (0–9 mM) with the use of a Tris–HCl buffer. Furthermore, the PCR was carried out using various concentrations of KCl and (NH4)2SO4 (10–90 mM) for various pH values ranging from 7.0 to 9.0 for a Tris–HCl buffer (pH values were measured at a temperature of 25°C).

Thermostability was assayed as described by Dabrowski and Kur [17]. The purified NeqSSB-TaqS and TaqS DNA polymerases were heated up to 95°C and 99°C for 1, 5, 10, 20, 40 and 60 minutes.

In all our experiments, we amplified a 300 bp target fragment in a PCR using the same amount of the enzyme in the optimal conditions. We applied 10 μl of each PCR product for visualization by agarose gel electrophoresis. The relative activity of the polymerase was evaluated by densitometry with the use of GelAnalyzer 2010a program (http://www.gelanalyzer.com/). The program measured the area below the peak representing intensity of light emitted by the band on the gel. The peak of the largest field (the highest optical density) represents a 100% polymerase activity. Peaks with smaller fields (less intensive light) were compared with the largest peak and their activity was determined as a percentage of this value.

PCR amplification rate assay

The PCR amplification rate was measured, after some modifications, using the method described by Lee et al. [11]. We used the DNA of a pET 30 plasmid containing the known target sequences as a template for the PCR in order to obtain the products with a length of 300, 500 and 1000 bp.

Amplification was performed using NeqSSB-TaqS and TaqS DNA polymerases in the optimal conditions for a PCR. Each PCR included the initial denaturation at 94°C for 2 min, and 25 cycles at 94°C for 15 s, at 55°C for 15 s and at 72°C for 5, 10, 15,…60 s. The PCR products were electrophoresed using the standard 1% agarose gel.

Processivity analysis

The processivity test was carried out as described in [18], after some modifications. Eighty five μl of 20 mM Tris-HCl pH 8.3, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 290 μM of each of the four dNTPs, 40 nM primer-template (5′-GGGGATCCTCTAGAGTCGACCTGC and 5’ TATCGGTCCATGAGACAAGCTTGCTTGCCAGCAGGTCGACTCTAGAGGATCCCC), 3 μl of EvaGreen Fluorescent DNA stain (Jena Bioscience, Jena, Germany) and 1 U of the tested polymerase were pre-incubated for 5 min at 50°C. The reactions were initiated by the simultaneous addition of 7.5 μl of 50 mM MgCl2 and 7.5 μl of a 0.6 mg/μl heparin trap, and the polymerization was allowed to proceed at 72°C. Aliquots (10 μl) were withdrawn after 0, 1, 2, 5, and 10 min to cool the thermoblock (4°C) and the lengths of the extended products were determined by a melting point using a MyGo/PRO Real-time PCR instrument (IT-IS International Ltd., GB). The reaction included the following stages: a pre-melt hold for 10 s at 95°C (a ramp rate of 5°C/s), the initial 60-second stage at 60°C (a ramp rate of 4°C/s) and the final 1-second stage at 97°C (a ramp rate of 0.201°C/s). The processivity was determined by comparing the melting temperature profiles of different length products serving as markers. The marker product was obtained in a PCR using the same primer as that described above and the synthetic templates which allowed the formation of products with a length exceeding the primer’s length by 1, 2, 3 through up to 20 nt.

Primer-template binding

The binding of polymerases to the primer-template (5’-CTTCATTACACCTGCAGCTCT and 5’-CACAGCCCTGTCCCTCTTCTTC) occurred at various annealing temperatures ranging from the optimal 55°C up to 72°C, with the use of primers for the PCR amplification of a human CCR5 gene [19].

Resistance to inhibitors

The effect of PCR inhibitors such as 0.84 μg to 54 μg of lactoferrin (Sigma-Aldrich, St. Louis, USA), 4.7 ng to 600 ng of heparin (Sigma-Aldrich, St. Louis, USA), and human blood (from a healthy volunteer) in concentrations ranging from 0.15% to 10%, on the catalytic activity of NeqSSB-TaqS and TaqS DNA polymerases was assessed in a PCR using the genomic DNA of Staphylococcus aureus as a template and primers for the specific nuc gene [20].

Furthermore, resistance to inhibitors present in the whole human blood was tested using primers for the amplification of human CCR5 gene [19] without the addition of any templates. PCRs were assayed as described by Kermekchiev et al. [21] with the addition of blood to the mixture (at concentrations ranging from 0.15% to 10%).

DNA binding preferences

To demonstrate the ability of DNA polymerases to bind different types of DNA (ssDNA and dsDNA) and their preferences for binding single- or double-stranded DNA, we performed the electrophoretic mobility shift assay test of the polymerase DNA complexes. The test was performed using fluorescein-labelled oligonucleotides (dT) 76 at the 5’ end, and a PCR product with a length of 100 bp, as described in the method outlined by Olszewski et al. 2015 [13]. The output products were analyzed using a 2% agarose gel ethidium bromide in the UV light.

Results

Expression and purification of TaqS and NeqSSB-TaqS DNA polymerases

The gene encoding the Stoffel fragment of a Taq DNA polymerase was cloned into the vector pET-30 Ek/LIC to generate a pET30/TaqS plasmid which led to the expression of the enzyme as a protein with a C-terminal polyhistidine tag. The PCR products of the taq Stoffel and NeqSSB-like genes were mixed together with the DNA of the pET-30 Ek/LIC vector in order to obtain the pET30/NeqSSB-TaqS plasmid which encodes the enzyme as a fusion protein containing the complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI) and a sequence of the Taq Stoffel DNA polymerase with a C-terminal polyhistidine tag. E. coli BL21 (DE3) RIL cultures with pET30/TaqS and pET30/NeqSSB-TaqS plasmids were harvested and presonicated.

Recombinant DNA polymerases were purified by passing a heat-denatured supernatant through a His•Bind Ni2+ affinity column. The purified TaqS and NeqSSB-TaqS DNA polymerases were found to have a specific activity (according to the definition proposed by Habig et al. [22]) of 1600 U/mg and 2200 U/mg respectively. These results show that the NeqSSB fusion did not have any negative effect on the catalytic activity of the TaqS DNA polymerase.

We recovered approximately 46% and 44% of TaqS and NeqSSB-TaqS DNA polymerases from the sonicated extracts, respectively. The degree of polymerase recovery and each DNA polymerase purification step were monitored with the help of SDS-polyacrylamide gel electrophoresis (Fig 1).

Fig 1
The expression and purification of TaqS (A) and NeqSSB-TaqS (B) DNA polymerases. The proteins were analyzed on a 10% polyacrylamide gel (SDS-PAGE). Lane M: Unstained Protein Weight Marker (Fermentas, Lithuania), molecular masses highlighted. Lane 1: the ...

We observed major protein bands of 62 and 90 kDa for TaqS and NeqSSB-TaqS, repectively, corresponding to molecular masses of 61.8 and 89.9 kDa (the calculations were made based on the amino acid sequences). The E. coli overexpression system used in this study allowed the production of 30 mg of a TaqS DNA polymerase and 18 mg of a NeqSSB-TaqS fusion protein per 1 l of induced culture. Most of the native thermostable enzymes were synthesized by thermophilic bacteria at low levels and consequently they were difficult to purify [23, 24]. Another factor which contributed to such a low output was the toxicity of the overexpressed DNA-interacting proteins in the E. coli host cells. This phenomenon is common not only in DNA polymerases and SSB proteins, but also in other enzymes including restriction endonucleases [25, 26]. Several thermostable DNA polymerases in the biologically active form were produced using the same E. coli systems as those used in this study. Their expression levels in E. coli were in a range from 2.25 mg/l to 50 mg/l [2729]. Hence, the production efficiencies of TaqS and NeqSSB-TaqS DNA polymerases achieved in this study were satisfactory.

Characterization of fusion NeqSSB-TaqS DNA polymerase

The activity rather than concentration of enzymatic proteins should be compared because during the purification process the same amount of enzyme may become deactivated and then the activity will not be equivalent to concentration Hence, to obtain reliable and accurate results, this characteristic of the polymerase was assessed by the activity assay. In the subsequent experiments, the 1 U/μl activity for the TaqS and NeqSSB-TaqS DNA polymerases was determined by comparing it with a commercial Taq DNA polymerase with an activity of 1 U/μl, using a EvaEZ Fluorometric Polymerase Activity Assay Kit (Biotium, Hayward, USA), in an isothermal reaction at 72°C on a real-time PCR apparatus (IT-IS International Ltd., UK).

For characterization purposes, the polymerase activity was measured in a PCR for different buffer compositions with various concentrations of MgCl2, KCl or (NH4)2SO4 and various pHs (Fig 2). The activity of the DNA polymerase was highly dependent on MgCl2, whereby the maximum activities for TaqS DNA polymerases were within a range of 2 to 5 mM MgCl2 and for NeqSSB-TaqS DNA polymerases within a range of 1 to 5 mM MgCl2 (Fig 2A). The DNA polymerase activity was completely inhibited when KCl concentrations exceeded 20 mM for TaqS DNA polymerases and 60 mM for NeqSSB-TaqS DNA polymerases (Fig 2B). (NH4)2SO4 also had an adverse effect on TaqS and NeqSSB-TaqS DNA polymerase activities, inhibiting them completely when concentrations exceeded 20 and 40 mM, respectively (Fig 2C).

Fig 2
Characterization of a fusion NeqSSB-TaqS DNA polymerase in comparison to a TaqS DNA polymerase.

The amplification efficiency for various PCR buffers depending on the composition of salt is shown in Fig 3. KCl was used at the optimum concentration of 10 mM, whilst (NH4)2SO4 was applied at concentrations varying from 10 to 40 mM. The positive effect of the reaction buffer at the optimum salt concentrations, 10 mM KCl and 10 mM (NH4)2SO4 was observed for both polymerases. However, the tolerance of the fusion NeqSSB-TaqS DNA polymerase to salt has increased. When NeqSSB-TaqS DNA polymerases were used, amplification was efficient over a broad range of KCl concentrations. These results were consistent with the results obtained for Sso7d fused with Taq and Pfu DNA polymerases which were also tolerant to high KCl concentrations [6].

Fig 3
Amplification efficiency for DNA polymerases depending on the composition of salt in PCR.

The effect of pH on TaqS and NeqSSB-TaqS DNA polymerase activities was evaluated using buffers with a pH ranging from 7 to 9. The highest enzyme activities were observed for pH 7.5 for both polymerases (Fig 2D).

The results of the above-mentioned experiment show that the optimal buffer for NeqSSB-TaqS DNA polymerases consists of 20 mM Tris–HCl (pH 8.0), 4 mM MgCl2, 10 mM (NH4)2SO4 and 10 mM KCl.

The thermal stability of TaqS and NeqSSB-TaqS DNA polymerases was determined by measuring a decrease in their activity after preincubation at 95°C or 99°C. The thermal stability of NeqSSB-TaqS DNA polymerase was remarkably higher. The half-lives of TaqS and NeqSSB-TaqS DNA polymerases at 95°C were found to be 15 and 35 min, respectively (Fig 2E).

PCR amplification rate and processivity

The fusion NeqSSB-TaqS DNA polymerase replicated the template strand at a faster rate than the TaqS DNA polymerase (Fig 4). The NeqSSB-TaqS DNA polymerase replicated a 300 bp template within 5 s, 500 bp within 10 s and 1000 bp within 20 s, whilst the TaqS DNA polymerase within 20 s, 35 s and 60 s respectively. This suggests that the fusion of a NeqSSB protein with a TaqS DNA polymerase can provide a more efficient DNA amplification within a shorter reaction time.

Fig 4
Evaluation of PCR amplification rate.

The polymerase processivity is the number of dNTPs incorporated per each binding event. To ensure the correctness of measurements, polymerase molecules should associate to DNA only once and, under such single hit conditions, the processivity is expressed by the number of the incorporated dNTPs. In our experiments, heparin was used to sequester polymerase after it dissociated from the primer-template [30]. To determine processivity, the hot start conditions were created by pre-incubating the reaction mixture in the absence of Mg2+ and the reactions were initiated by the simultaneous addition of metal ions and a heparin trap. Following this, the processivity was determined by comparing the melting temperature profiles of products which had different known lengths and served as markers. The NeqSSB-TaqS DNA polymerase had a prominent melting peak at 80,49°C after the incorporation of 19 nucleotides, which represented processivity (Fig 5). The control TaqS DNA polymerase showed a lower processivity with the prominent melting peak at 77,27°C after the incorporation of 9 dNTPs (Fig 5). This suggests that the fusion of the TaqS DNA polymerase with the NeqSSB considerably improved processivity. The processivity values determined with the use of a heparin trap were much lower than the values previously published for the Taq DNA polymerase [31, 32] and were within a range of 80 nt to 160 nt. In these studies, no trap was used to protect against polymerase rebinding and against a repetition of the extension cycle. The differences in the results obtained may be explained by the changes in the protocol that we used.

Fig 5
Determination of processivity based on the melting temperatures of DNA products created in the presence of a heparin trap.

Primer-template binding

The influence of the fusion of a NeqSSB and a TaqS DNA polymerase on the primer-template binding was determined using PCR reactions at various annealing temperatures ranging from the optimal temperature of 55°C up to 72°C. As shown in Fig 6, the binding affinity for the fusion polymerase increased considerably. The specific PCR product for the NeqSSB-TaqS DNA polymerase was observed at the annealing temperature of 72°C, whilst for the TaqS DNA polymerase at 65.5°C. This suggests that the fusion enzyme containing DNA which binds to NeqSSB protein, probably creates a much stronger bond to the primer-template than that created by the TaqS DNA polymerase.

Fig 6
The primer-template binding for NeqSSB-TaqS and TaqS DNA polymerases.

Tolerance of the fusion NeqSSB-TaqS DNA polymerase to PCR inhibitors

The fusion NeqSSB-TaqS enzyme and the TaqS DNA polymerase were PCR-tested in the presence of serial dilutions of whole human blood, lactoferrin and heparin which all have been reported to inhibit PCR [7, 8, 21, 33,34]. It was shown that the fusion NeqSSB-TaqS DNA polymerase was much more resistant to all the tested inhibitors than the TaqS Stoffel enzyme was. NeqSSB-TaqS and TaqS polymerases remained functional in the presence of 0.3–1.25% and less than 0.3% of whole blood, respectively (Fig 7A), 0.84–13.5 μg and 1.68 ng of lactoferrin, respectively (Fig 7B), and 4.7–150 ng and 9.4 ng of heparin, respectively (Fig 7C).

Fig 7
DNA polymerase tolerance to PCR inhibitors.

Resistance to inhibitors including whole human blood was also tested in a PCR in which primers were used to amplify a human CCR5 gene without the addition of any template (the template came directly from the blood). As shown in Fig 7D, the fusion NeqSSB-TaqS DNA polymerase amplified the human gene target in blood concentrations of 2.5%, whilst the TaqS DNA polymerase was strongly inhibited at any tested blood concentration.

DNA binding preferences

The preference test in the form which was proposed by Olszewski et al. 2015 [13] allowed us to demonstrate the DNA polymerase’s ability to bind single or double stranded DNA. Furthermore, the test indicated the DNA polymerase’s preferences for the particular types of DNA: ssDNA is represented by oligonucleotides (dT)76 (green shine), whereas dsDNA is represented as a PCR product (100bp) (pink shine). The results of gel electrophoresis of enzyme-DNA complexes are shown in Fig 8A and 8B.

Fig 8
A mobility shift assay for TaqS DNA polymerase (A) and NeqSSB-TaqS DNA polymerase (B) with ssDNA and dsDNA. The output products were analyzed on a 2% agarose gel with ethidium bromide in the UV light. The reaction mix contained 10 pmol Oligo (dT)76 and/or ...

The results indicate that the NeqSSB-TaqS fusion DNA polymerase has a greater ability to bind both with ssDNA and dsDNA. Partial ssDNA binding is already seen at 3.3 pmol of the NeqSSB-TaqS DNA polymerase (Fig 8B, lane 13), whilst the full ssDNA binding occurs at 26.4 pmol (Fig 8B, lane 16). The binding of dsDNA is observed at 52.8 pmol of the fusion DNA polymerase (Fig 8B, lane 17).

In the case of the TaqS DNA polymerase, an interaction with DNA starts to be observable when it has a 7.5-fold higher concentration than the fusion DNA polymerase (Fig 8A). The TaqS DNA polymerase has been shown to have partial ability to bind to both single and double stranded DNA at a concentration of 24.6. pmol, without clearly indicated preference. The NeqSSB-TaqS fusion DNA polymerase shows a noticeable preference for ssDNA over dsDNA. Furthermore, the results indicate that polymerases interact with DNA in a completely different way. The fusion polymerase creates distinct complexes typical of the interaction between SSB protein and DNA [13]. Such complexes do not occur for TaqS DNA polymerase. These observations suggest that if the NeqSSB-TaqS polymerase contains NeqSSB protein then it creates a significantly higher level of affinity between the NeqSSB-TaqS fusion polymerase and ssDNA.

Discussion

Currently, the PCR method is in common use in diagnostics, molecular biology and genetic engineering. Amplification efficiency is strongly dependent on DNA polymerase and reaction conditions. Modern diagnostic methods and genetic engineering techniques require the use of new types of DNA polymerases with better properties as regards higher processivity and/or amplification rates.

Available research suggests that the binding of enzymes to the template DNA is a very important stage in the polymerization process. It induces a conformational change in the thumb subdomain, creating a close fit with a DNA molecule. Another conformation change occurs inside the enzyme during the binding of dNTP.

It has a bearing on the formation of a "closed" conformation, rotating the structural components inside the fingers subdomain towards the 3' end [35, 36]. By improving any of the above-mentioned steps we can strongly influence the final performance of the whole process. For this reason, we modify the reaction conditions for the known DNA polymerases to facilitate the first step which involves the binding of a polymerase to a DNA strand. Such modifications include the addition of SSB or PriB proteins [9, 13, 3740]. A better example of such a modification is the creation of fusion DNA polymerases which include proteins that bind naturally to single and double stranded DNA. In our studies, to achieve proper fusion, we used the NeqSSB protein of Nanoarchaeum equitans, which binds both types of DNA. The NeqSSB is a small protein which has the unique properties of a hyperthermophilic protein and is active as a monomer; therefore it can be used in PCRs at denaturation temperatures exceeding 90°C. We fused the polymerase with DNA binding proteins on the N-end using 6 amino acid linker (Gly-Val-Asp-Met-Ile) in a similar way to that used in the fusion polymerase patented in 2013 [41]. The linker creates a more flexible and ‘relaxed’ fusion polymerase. Steric hindrances are avoided which may be crucial for the stable association of the fusion polymerase with the DNA template which is essential for the polymerisation process. Some studies [6, 11, 12] and our tests have shown that the covalent linking of a DNA binding protein to a DNA polymerase can strongly enhance the polymerase processivity. We have shown that a fusion polymerase which included the NeqSSB protein increased the elongation rate threefold and improved processivity from 9 nt to 19 nt. Inhibitors present in the tested material or which are a residue from the process of isolation of nucleic acid are the most common problem encountered during the amplification of environmental and blood samples [42]. PCR inhibitors can interact with DNA or block enzymes by degrading the DNA polymerase, by inhibiting its active centre or by blocking access to this centre for cofactors such as magnesium ions [8, 43]. Inhibitors either reduce the efficiency of PCR or block it completely. The available commercial native polymerases are not always able to deal with these problems in a PCR. Our study shows that a fusion NeqSSB-TaqS DNA polymerase created by joining a Taq Stoffel DNA polymerase with the NeqSSB-like protein of Nanoarchaeum equitans exhibits a much higher tolerance to PCR inhibitors (blood, lactoferrin, heparin) as compared to Taq Stoffel DNA polymerases. For example, the TaqS DNA polymerase in a PCR mixture was completely inhibited in all of the tested whole blood concentrations and the endogenous CCR5 gene did not amplify at all, unlike the NeqSSB-TaqS DNA polymerase which was able to amplify in 2.5% whole blood. High-thermostable DNA polymerases have a broad range of applications in molecular biology, especially in the amplification of GC-rich templates [43]. We showed that thermostability was remarkably higher for the NeqSSB-TaqS DNA polymerase. The half-life at 95°C was two times longer for NeqSSB-TaqS than for TaqS DNA polymerases. Mg2+ ions are a critical parameter in PCRs and the optimization of their concentration is essential for the native DNA polymerase. Unlike the TaqS DNA polymerase, the NeqSSB-TaqS DNA polymerase exhibited acceptable amplification efficiency within a wide range of Mg2+ concentrations (from 1 to 5 mM MgCl2). Furthermore, the NeqSSB-TaqS DNA polymerase had a satisfactory amplification efficiency for (NH4)2SO4 and KCl concentrations which were 2 and 3 times greater, respectively. The above-mentioned results are consistent with the results obtained in another study in which a fusion DNA polymerase was tested [6].

The improvement in the properties of the NeqSSB-TaqS fusion DNA polymerase results from a much better affinity to the DNA template and is also due to different binding mechanisms as indicated in the results of the DNA binding assay.

The presence of an additional SSB protein which has a natural binding affinity to both ssDNA and dsDNA increases the polymerase affinity for both types of the nucleic acids. Research indicates that the natural binding affinity between the TaqS polymerase and dsDNA, and especially ssDNA, is significantly lower than that for the TaqS polymerase in fusion with NeqSSB. The TaqS polymerase started to interact with DNA in a noticeable but very limited manner at protein concentrations which were at a level at which the fusion polymerase was already able to completely bind to both single- and double-stranded DNA.

This has also been confirmed by DNA binding experiments in which DNA binding proteins, eg.SSB indicated a higher affinity for DNA than for Taq and TaqS DNA polymerases [44, 45]. Furthermore, the binding of DNA by a TaqS polymerase occurs in a completely different way than the binding of DNA by a fusion polymerase. In the fusion polymerase, the NeqSSB protein is responsible for such a strong and preferential DNA binding as was shown in the case of protein-DNA complexes typical of SSB proteins [13].

The results of the binding assay enable us to better understand the results discussed in the section entitled Primer-template binding. The results indicate that, compared to TaqS reference polymerase, the NeqSSB-TaqS fusion polymerase is better able to stabilize the double-stranded DNA at the moment of the primer hybridization, and a PCR reaction may take place at a higher primer attachment temperature. Such a stabilization of the double-stranded structure in the presence of the NeqSSB-TaqS fusion polymerase can increase PCR specificity.

Conclusions

To summarize, a fusion NeqSSB-TaqS DNA polymerase consisting of the Taq Stoffel DNA polymerase and the NeqSSB-like protein of Nanoarchaeum equitans exhibits a much higher extension rate, offers higher processivity and has a higher tolerance to PCR inhibitors as compared to the Taq Stoffel DNA polymerase. For this reason, in many PCR applications, it may be better to use a NeqSSB-TaqS DNA polymerase instead of a Taq DNA polymerase.

Supporting information

S1 Fig

The outline of the cloning method used to obtain a fusion NeqSSB-TaqS DNA polymerase created by joining a Taq Stoffel DNA polymerase and the NeqSSB-like protein of Nanoarchaeum equitans.

A DNA insert for cloning was prepared using two independent PCR reactions. The amplicon obtained in PCR1 contained the nucleotide sequence of NeqSSB, a linker coding sequence, an extra sequence complementary to the N-end of TaqStoffel and to the pET30 EK/LIC plasmid.

The PCR2 amplicon contained the nucleotide sequence of TaqStoffel DNA polymerase, a linker coding sequence and an extra sequence complementary to the C-end of NeqSSB and to the pET30 EK/LIC plasmid.

These products and pET30EK/LIc plasmid which were digested by NdeI and BamHI restriction enzymes, was used as a matrix in the Gibson reaction (OverLap Assembly kit).

(TIF)

Acknowledgments

We would like to dedicate this paper to Professor Józef Kur. He was our inspiration and motivated us to rise to the challenge of the continuous improvement of our knowledge and career growth.

Funding Statement

Financial support within the framework of Statutory research programme in Gdańsk University of Technology (2014-2016): 4914/E-359/M/2014 DS-030863; 4914/E-359/M/2015 DS-031438; 4914/E-359/M/2016 DS.-031955; 4914/E-359/S/2014-2106 (Beata Krawczyk, Marcin Olszewski). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability

Data Availability

All relevant data are within the paper.

References

1. Kaledin AS, Sliusarenko AG, Gorodetskiĭ SI. Isolation and properties of DNA polymerase from extreme thermophylic bacteria Thermus aquaticus YT-1. Biokhimiia. 1980; 45:644–651. [PubMed]
2. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988; 239:487–491. [PubMed]
3. Lawyer FC, Stoffel S, Saiki RK, Chang SY, Landre PA, Abramson RD, et al. High-level expression, purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5′ to 3′ exonuclease activity. PCR Methods Appl. 1993; 2:275–287. [PubMed]
4. Yu K, Pauls KP. Optimization of the PCR program for RAPD analysis. Nucleic Acids Res. 1992; 20:2606 [PMC free article] [PubMed]
5. Arezi B, Xing W, Sorge JA, Hogrefe HH. Amplification efficiency of thermostable DNA polymerases. Anal Biochem. 2003; 321:226–235. [PubMed]
6. Wang Y, Prosen DE, Mei L, Sullivan JC, Finney M, Vander Horn PB. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 2004; 32:1197–1207. doi: 10.1093/nar/gkh271 [PMC free article] [PubMed]
7. Al-Soud WA, Rådström P. Capacity of nine thermostable DNA polymerases to mediate DNA amplification in the presence of PCR inhibiting samples. Appl Environ Microbiol. 1998; 64:3748–3753. [PMC free article] [PubMed]
8. Al-Soud WA, Rådström P. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol. 2001; 39:485–493. doi: 10.1128/JCM.39.2.485-493.2001 [PMC free article] [PubMed]
9. Dabrowski S, Kur J. Cloning, overexpression, and purification of the recombinant His-Tagged SSB protein of Escherichia coli and use in Polymerase Chain Reaction amplification. Protein Expr Purif. 1999; 16: 96–102. doi: 10.1006/prep.1999.1044 [PubMed]
10. Oscorbin IP, Boyarskikh UA, Zakabunin AI, Khrapov EA, Filipenko ML. DNA-Binding Domain of DNA Ligase from the Thermophilic Archaeon Pyrococcus abyssi: Improving Long-Range PCR and Neutralization of Heparin’s Inhibitory Effect. Appl Biochem Biotech. 2015; 176(7): 1859–1869. [PubMed]
11. Lee J II, Cho SS, Kil E-J, Kwon S-T. Characterization and PCR application of a thermostable DNA polymerase from Thermococcus pacificus. Enzyme Microb Technol. 2010; 47:147–152.
12. Sun S, Geng L, Shamoo Y. Structure and Enzymatic Properties of a Chimeric Bacteriophage RB69 DNA Polymerase and Single-Stranded DNA Binding Protein With Increased Processivity. Proteins. 2006; 65: 231–238. doi: 10.1002/prot.21088 [PubMed]
13. Olszewski M, Balsewicz J, Nowak M, Maciejewska N, Cyranka-Czaja A, Zalewska-Piątek B, et al. Characterization of a single-stranded DNA-binding- like protein from Nanoarchaeum equitans—nucleic acid binding protein with broad substrate specificity. PLoS One. 2015; 10:e0126563 doi: 10.1371/journal.pone.0126563 [PMC free article] [PubMed]
14. Tveit H, Kristensen T. Fluorescence-based DNA polymerase assay. Anal Biochem. 2001; 289(1):96–98. doi: 10.1006/abio.2000.4903 [PubMed]
15. Driscoll MD, Rentergent J, Hay S. A quantitative fluorescence-based steady-state assay of DNA polymerase, FEBS J. 2014; 281(8):2042–2050. [PMC free article] [PubMed]
16. Ma C, Tang Z, Wang K, Tan W, Li J, Li W, Li Z, Yang X, Li H, Liu L. Real-time monitoring of DNA polymerase activity using molecular beacon. Anal Biochem. 2006; 1;353(1):141–143. doi: 10.1016/j.ab.2006.02.006 [PubMed]
17. Dabrowski S, Kur J. Recombinant His-tagged DNA polymerase II. Cloning and purification of Thermus aquaticus recombinant DNA polymerase (Stoffel fragment). Acta Biochim Pol. 1998; 45:661–667. [PubMed]
18. Elshawadfy AM, Keith BJ, Ee Ooi H, Kinsman T, Heslop P, Connolly BA. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction. Front Microbiol. 2014; 5:224 doi: 10.3389/fmicb.2014.00224 [PMC free article] [PubMed]
19. Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell. 1996; 86:367–377. [PubMed]
20. Barski P, Piechowicz L, Galiński J, Kur J. Rapid assay for detection of methicillin-resistant Staphylococcus aureus using multiplex PCR. Mol Cell Probes. 1996; 10:471–475. doi: 10.1006/mcpr.1996.0066 [PubMed]
21. Kermekchiev MB, Kirilova LI, Vail EE, Barnes WM. Mutants of Taq DNA polymerase resistant to PCR inhibitors allow DNA amplification from whole blood and crude soil samples. Nucleic Acids Res. 2009; 37:e40 doi: 10.1093/nar/gkn1055 [PMC free article] [PubMed]
22. Habig WH, Pabst MJ, Jakoby WB. Glutathione S-Transferases. The first enzymatic step in mercapturic acid formation. JBC. 1974; 249 (22): 7130–7139. [PubMed]
23. Chien A, Edgar DB, Trela JM. Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus. J. Bacterid. 1976; 127, 1550–1557. [PMC free article] [PubMed]
24. Kaledin AS, Slyusarenko AG, Gorodetskii SI. Isolation and properties of DNA polymerase from extremely thermophilic bacterium Thermus aquaticus YTI. Biokhimiya. 1980; 45,644–651. [PubMed]
25. Zylicz-Stachula A, Zołnierkiewicz O, Lubys A, Ramanauskaite D, Mitkaite G, Bujnicki JM, Skowron PM. Related bifunctional restriction endonuclease-methyltransferase triplets: TspDTI,Tth111II/TthHB27I and TsoI with distinct specificities. BMC Molecular Biology 2012; 13:13 doi: 10.1186/1471-2199-13-13 [PMC free article] [PubMed]
26. Zylicz-Stachula A, Zołnierkiewicz O, Sliwinska K, Jezewska-Frackowiak J, Skowron PM. Bifunctional TaqII restriction endonuclease: redefining the prototype DNA recognition site and establishing the Fidelity Index for partial cleaving. BMC Biochemistry 2011; 12:62 doi: 10.1186/1471-2091-12-62 [PMC free article] [PubMed]
27. Kim DJ, Pyun YR. Cloning, Expression, and Characterization of Thermostable DNA Polymerase from Thermoanaerobacter yonseiensis. J Biochem Mol Biol. 2002; 35:320–329. [PubMed]
28. Dabrowski S, Kur J. Cloning and expression in Escherichia coli of the recombinant his-tagged DNA polymerases from Pyrococcus furiosus and Pyrococcus woesei. Protein Expr Purif. 1998; 14:131 doi: 10.1006/prep.1998.0945 [PubMed]
29. Engelke DR, Krikos A, Bruck ME, Ginsburg D. Purification of Thermus aquaticus DNA polymerase expressed in Escherichia coli. Anal Biochem. 1990; 191:396–400. [PubMed]
30. Bambara RA, Fay PJ, Mallaber LM. Methods of analysing processivity. Meth Enzymol. 1995; 262:270–280. [PubMed]
31. Kim YJ, Lee HS, Kwon ST, Lee JH, Kang SG. Enhancing the processivity of a family B-type DNA polymerase of Thermococcus onnurineus and application to long PCR. Biotechnol Lett. 2014; 36:985–92. doi: 10.1007/s10529-013-1441-x [PubMed]
32. Merkens LS, Bryan SK, Moses RE. Inactivation of the 5'-3' exonuclease of Thermus aquaticus DNA polymerase. Biochim Biophys Acta. 1995; 1264:243–8. [PubMed]
33. Al-Soud WA, Rådström P. Effect of amplification facilitators on diagnostic PCR in the presence of blood, feces and meat. J Clin Microbiol. 2000; 38:4463–70. [PMC free article] [PubMed]
34. Yokota M, Tatsumi N, Nathalang O, Yamada T, Tsuda I. Effects of heparin on polymerase chain reaction for blood white cells. J Clin Lab Anal. 1999; 13:133–40. [PubMed]
35. Rothwell P. J., Waksman G., Structure and mechanism of DNA polymerases, Advances in protein chemistry. 2005; 71. [PubMed]
36. Patel PH, Motoshi S, Adman E, Shinkai A. Prokaryotic DNA Polymerase I: Evolution, Structure and Base Flipping Mechanism for Nucleotide Selection. J Mol Biol. 2001; 308: 823–837. doi: 10.1006/jmbi.2001.4619 [PubMed]
37. Dabrowski S, Olszewski M, Piatek R, Brillowska-Dabrowska A, Konopa G, Kur J. Identification and characterization of single-stranded-DNA-binding proteins from Thermus thermophilus and Thermus aquaticus—new arrangement of binding domains. Microbiology. 2002; 148:3307–3315. doi: 10.1099/00221287-148-10-3307 [PubMed]
38. Olszewski M, Mickiewicz M, Kur J. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis. Arch Microbiol. 2008; 190:79–87. doi: 10.1007/s00203-008-0366-6 [PubMed]
39. Nowak M, Olszewski M, Śpibida M, Kur J. Characterization of single-stranded DNA-binding proteins from the psychrophilic bacteria Desulfotalea psychrophila, Flavobacterium psychrophilum, Psychrobacter arcticus, Psychrobacter cryohalolentis, Psychromonas ingrahamii, Psychroflexus torquis, and Photobacterium profundum. BMC Microbiol. 2014; 14:91 doi: 10.1186/1471-2180-14-91 [PMC free article] [PubMed]
40. Olszewski M, Rebała K, Szczerkowska Z, Kur J. Application of SSB-like protein from Thermus aquaticus in multiplex PCR of human Y-STR markers identification. Mol Cell Probes. 2005; 19:203–205. doi: 10.1016/j.mcp.2004.11.006 [PubMed]
41. Lee JE, Potter RJ, Mandelman D. SSB—polymerase fusion proteins, European Patent Office, EP 1934372 B1, date of filing: 08.09.2006, date of publication: 20.02.2013.
42. Śpibida M, Krawczyk B, Olszewski M, Kur J. Modified DNA polymerases for PCR troubleshooting. J Appl Genet. 2017;58(1):133–142. doi: 10.1007/s13353-016-0371-4 [PMC free article] [PubMed]
43. Watson RJ, Blackwell B. Purification and characterization of a common soil component which inhibits the Polymerase Chain Reaction. Can J Microbiol. 2000; 46: 633–42. [PubMed]
44. Datta K, LiCata VJ. Thermodynamics of the binding of Thermus aquaticus DNA polymerase to primed-template DNA. Nucleic Acids Res. 2003; 31:19. [PMC free article] [PubMed]
45. Kozlov AG, Lohman TM. Large contributions of coupled protonation equilibria to the observed enthalpy and heat capacity changes for ssDNA binding to Escherichia coli SSB protein. Proteins. 2000; 4:8–22 [PubMed]

Articles from PLoS ONE are provided here courtesy of Public Library of Science