PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of moloncolLink to Publisher's site
 
Mol Oncol. 2015 April; 9(4): 806–817.
Published online 2014 December 30. doi:  10.1016/j.molonc.2014.12.004
PMCID: PMC5528779

RIP1 modulates death receptor mediated apoptosis and autophagy in macrophages

Abstract

Macrophages are responsible for defending against diverse pathogens and play a crucial role in the innate immune system. Macrophage's lifespan is determined by homeostatic balance between survival and apoptosis. Here we report that tumor necrosis factor‐related apoptosis‐inducing ligand (TRAIL) triggers both apoptosis and autophagy in human U937 cells. Inhibition of autophagy facilitates TRAIL‐induced apoptosis, suggesting that autophagy of macrophages protects against TRAIL‐induced apoptosis. TRAIL treatment influences the expression of death receptors, indicating that TRAIL‐induced apoptosis and autophagy are mediated by death receptors. RIP1 ubiquitination and expression regulate apoptosis and autophagy. Furthermore, expression and bioactivity of the p43/41‐caspase‐8 variant are critical to TRAIL‐induced autophagy and apoptosis. Knockdown of RIP1 suppresses autophagy in macrophage. These data demonstrate that RIP1 is essential for the regulation of death receptor mediated autophagy and apoptosis. The results in this study contribute to understanding the regulation of autophagy and apoptosis in macrophages, and shed lights on death receptor‐targeted therapy for cancer, inflammation and autoimmune diseases.

Keywords: Tumor necrosis factor-related apoptosis-inducing ligand, Apoptosis, Autophagy, RIP1, Ubiquitination, Death

Abbreviations

c-FLIP
cellular FLICE inhibitory protein
DISC
death-inducing signaling complex
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
LC3
microtubule-associated protein 1A/1B-light chain 3
TRAIL
tumor necrosis factor-related apoptosis-inducing ligand
rsTRAIL
recombinant soluble TRAIL
3-MA
3-methyladenine

1. Introduction

Macrophages are widely distributed throughout body tissues and are essential components in the innate immune system. The cells exhibit effectors and antigen‐presenting cell functions and are thus responsible for defending against diverse pathogens (Auffray et al., 2009). Macrophages originate from a common myeloid progenitor in the bone marrow. Normally, circulating monocytes are alive for a very short time before undergoing spontaneous apoptosis (Fahy et al., 1999). Upon stimulation, monocytes differentiate into macrophages, which have a longer lifespan (Wiktor‐Jedrzejczak and Gordon, 1996). In the presence of certain stimuli, the apoptotic pathway of monocytes can be blocked, thus contributing to maintenance of the inflammatory response. As inflammation subsides, the cellular apoptosis program begins again and promotes regression of the immune response (Goyal et al., 2002; Savill and Fadok, 2000). A complex network of survival and death signal determines the fate of cells. Although monocytes are important defense components, the accumulation of monocytes may aggravate certain autoimmune diseases such as atherosclerosis, arthritis and multiple sclerosis (Linker et al., 2009). Understanding the interplay of survival and death signaling that coordinates the fate and function of macrophages has significant implications for research on cancer, inflammation and autoimmune diseases.

Tumor necrosis factor (TNF)‐related apoptosis‐inducing ligand (TRAIL, also known as apoptosis ligand 2, Apo2L) is a member of the TNF family, which has garnered extensive attention in the study of cancer, inflammation and autoimmune diseases. TRAIL is of particular interest in the development of cancer therapeutics as it is selectively cytotoxic to various tumor cells but has little or no toxic effect on most normal cells (Ashkenazi et al., 1999; Walczak et al., 1999; Wiley et al., 1995). Immune cell apoptosis is an important regulatory mechanism of innate immunity, which maintains homeostasis of the immune system and prevents autoimmune diseases. TRAIL is expressed in a variety of immune cells and plays an active role in various immune diseases, such as atherosclerosis, arthritis and multiple sclerosis (Cziupka et al., 2010; Martinez‐Lostao et al., 2010; Yao et al., 2006).

Binding of homotrimeric TRAIL to its death receptor DR4 or DR5 drives receptor clustering into high molecular weight complexes, leading to the assembly of the death‐inducing stimulating complex (DISC). The DISC is an aggregation of the intracellular death domain (DD) of the death receptor, the Fas‐associated death domain (FADD), the apoptosis initiator caspase‐8 or ‐10 and/or the caspase‐8 or ‐10 inhibitor c‐FLIP. In addition to the activation of caspases, TRAIL can also stimulate a cascade of intracellular reactions, such as activation of NF‐κB, JNK, p38, MAPK and PKB/Akt. (Harper et al., 2001; Lin et al., 2000; Secchiero et al., 2003; Song and Lee, 2008; Varfolomeev et al., 2005; Zhang et al., 2003). In ‘type I’ cells, the DISC activates sufficient caspase‐8 to stimulate effector caspase‐3, ‐6 or ‐7, which results in apoptosis. However, in ‘type II’ cells, less active caspase‐8 is generated by the DISC. Commitment of these cells to the apoptosis pathway requires further signal amplification by the intrinsic/mitochondrial pathway. In this case, an intracellular complex (known as complex II) composed of FADD, TRADD, caspase‐8, caspase‐10, RIP1, TRAF2 and IKK‐γ (NEMO) is formed. The physiological role of these TRAIL‐activated intracellular kinase cascades has yet to be fully elucidated (Varfolomeev et al., 2005).

RIP1 is an important regulatory protein in the DISC that can activate NF‐κB and caspase‐8 and generate reactive oxygen species (ROS). ROS are involved in the signal transduction of apoptosis, cell survival and programmed cell necrosis (Galluzzi and Kroemer, 2009; Kelliher et al., 1998; Lin et al., 1999). RIP1 function is modulated by ubiquitination and phosphorylation (Cho et al., 2009b; Ea et al., 2006). A previous report showed that in TNF‐α‐induced DISC, RIP1 and NEMO form a stable chain of linear ubiquitin. This complex is involved in determining cell survival, necrosis and apoptosis (Gerlach et al., 2011).

Cell death is a complex regulatory process. It is associated with at least three morphologically distinct processes: apoptosis, autophagic cell death (ACD) and necrosis. Autophagy or autophagocytosis is an evolutionarily conserved catabolic process involving the degradation of a cell's own components through the lysosomal machinery. As a protective mechanism to sustain cellular homeostasis, autophagy provides recycled resources for the cell by degrading long‐lived proteins and senile cell organelles into small peptides or amino acids. In addition, autophagy can repress pathogenic infection and parasitization. It has been demonstrated that autophagy deficiency is related to various disorders including cancers, inflammation and cardiovascular diseases, implying the importance of autophagy in physiological and pathological processes (Kirkegaard et al., 2004; Levine and Kroemer, 2008). In general, autophagy is considered to be an adaptive response to external stimuli (such as hunger, infection) that can resist apoptosis and promote cell survival, but in excess, it may lead to autophagic cell death (Kondo et al., 2005; Maiuri et al., 2007).

The life span of macrophages is determined by the integration of survival and death signals (Doseff, 2004). Autophagy and apoptosis are vital intracellular signaling and metabolic pathways; however, the relationship between them and the regulatory mechanism in macrophages are unclear. In this study, we report that TRAIL induces both apoptosis and autophagy in human macrophage lymphoma U937 cells. Inhibition of autophagy significantly enhances death receptor mediated apoptosis. RIP1 expression and ubiquitination modification play an important role in the conversion of autophagy to apoptosis. These results not only contribute a detailed understanding of the molecular mechanisms controlling apoptosis and autophagy but also have significance for the clinical treatment of cancer, inflammation and autoimmune diseases.

2. Materials and methods

2.1. Cells and reagents

Human macrophage lymphoma cell line U937, human acute monocytic leukemia cell line THP‐1 and mouse monocyte cell line RAW264.7 were purchased from American Type Culture Collection (Manassas, VA, USA). Cells were grown in RPMI 1640 medium (Invitrogen) supplemented with 10% (v/v) fetal bovine serum (Hyclone), 100 U/ml penicillin and 100 g/ml streptomycin at 37 °C in a humidified atmosphere of a 5% CO2. The pan‐caspase inhibitor Z‐VAD‐fmk (FMK001) was purchased from R&D Systems, Inc. (Minneapolis, MN). Non‐tagged recombinant soluble TRAIL protein (rsTRAIL, amino acid 95–281) was prepared as previously described by Guo et al. (Guo et al., 2005). Chloroquine diphosphate (C6628), 3‐Methyladenine (M9281) was purchased from Sigma–Aldrich Co. (Taufkirchen, Germany) and LY294002, Wortmannin, IKK inhibitor‐II and Wedelolactone from Merck Co. (NJ, USA). BAY 11‐7082 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

2.2. Chemicals and antibodies

Antibodies against caspase‐8, caspase‐3 (9662), caspase‐9 (9508), phospho‐IKKα/β, IKKα, phospho‐IκBα, TRADD and FADD were purchased from Cell Signaling Technology, Inc. (Beverly, MA), antibodies against Beclin 1 (sc‐11427), Ub (sc‐8017) and IκBα (sc‐24502) from Santa Cruz Biotechnology (Santa Cruz, CA), anti‐FLIP from Alexis Biochemicals (San Diego, CA), anti‐LC3B from Sigma–Aldrich Co. (Taufkirchen, Germany), anti‐NEMO from Proteintech Group Co. (Chicago, IL), anti‐GAPDH from Kangcheng Co. (Shanghai, China) and anti‐RIP1 (610458) from BD Pharmingen (San Diego, CA). Horseradish peroxidase‐linked anti‐mouse IgG, anti‐rabbit IgG and anti‐goat IgG were purchased from ZhongShan Co. (Beijing, China). Alexa Fluor® 488‐labeled goat anti‐rabbit IgG (H + L) antibody was purchased from Invitrogen Co. (Dynal AS, Oslo).

2.3. Apoptosis detection and cell viability assay

Apoptosis induced by TRAIL and 3‐MA was detected with an Annexin V‐FITC apoptosis detection kit according to the manufacturer's instructions (BD Biosciences Pharmingen, CA). Briefly, 2 × 105 cells were washed once with ice cold phosphate‐buffered saline (PBS, pH 7.4) and re‐suspended in 200 μl binding buffer. Cells were incubated with Annexin V‐FITC for 30 min and then with propidium iodide (PI) for 5 min at room temperature, and 400 μl binding buffer was added before testing. Apoptotic cells were detected by flow cytometry (FACS Calibur, Becton Dickinson). Cell viability was quantified by a 3‐(4, 5‐dimethylthiazol‐2‐yl)‐5‐(3‐carboxy‐ methoxyphenyl)‐2‐(4‐sulfophenyl)‐2H‐tetrazolium (MTT) assay (Sigma, St. Louis, MO).

2.4. Detection of TRAIL and its receptor expression

Human U937 and THP‐1 cells and mouse RAW264.7 cells were cultured in 6‐well plates at an appropriate density. The cells were collected and washed with PBS, then re‐suspended in FACS buffer (2% FBS in PBS with 0.1% sodium azide) and incubated with the PE‐labeled specific antibodies against DR4 or DR5 (eBioscience, San Diego, CA; the isotype control IgG, R&D Systems, Minneapolis) at 4 °C for 30 min. After washing twice with FACS buffer, the cells were fixed in 2% paraformaldehyde, followed by flow cytometry (FACScan, Becton Dickinson). The mean fluorescence intensity of each receptor on the surface of the cells was assessed according to the gated live‐cell population with Cell Quest software (BD Biosciences).

The soluble TRAIL expression was detected by using an ELISA kit according to the manufacturer's instruction (R&D Systems, Minneapolis).

2.5. Immunoprecipitation and immunoblot analysis

Cells were grown and treated in 10 cm plates (5 × 107), washed twice with PBS and lysed on ice for 30 min with 2 ml lysis buffer (20 mM Tris HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X‐100, 2 mM EDTA) with complete, EDTA‐free protease inhibitors (Roche). Lysates were then centrifuged at 13,000 × g for 15 min. Cell lysate containing 1 mg of total proteins was subjected to immunoprecipitation (IP) with the antibody to RIP1 at 4 °C overnight followed by the addition of protein A‐agarose beads and shaking at 4 °C for 4 h on a rotating platform. RIP1 IPs were washed three times with lysis buffer, then resuspended in protein sample buffer and heated at 95 °C for 5 min. The immuno‐complexes were subjected to SDS‐PAGE (5% acrylamide for the spacer gel and 12% acrylamide for the separation gel) and transferred to a PVDF membrane (Amersham Biosciences, Buckinghamshire). The membrane was probed with specific antibodies and horseradish peroxidase (HRP)‐conjugated secondary antibodies, followed by visualization with a chemiluminescence system (ECL, Amersham Biosciences, Buckinghamshire) and exposure to X‐ray film. For the RIP1 ubiquitination assay, cell lysate containing 1 mg of total protein was subjected to IP with the RIP1 antibody as indicated above, followed by SDS‐PAGE and Western blot assay with Ub antibody.

2.6. Immunofluorescence microscopy

Cells were treated for 3 h with or without recombinant soluble TRAIL protein (500 ng/ml), placed onto a glass slide, fixed with 4% polyformaldehyde in PBS and made permeable with 0.5% Triton X‐100. Cells were incubated with anti‐LC3B antibody at 4 °C for 1 h, washed twice with PBS and stained with Alexa Fluor® 488‐labeled goat anti‐rabbit IgG at 4 °C for 1 h in the dark. Immunofluorescence was observed under a Leica SP2 laser‐scanning confocal microscope (Leica SP2, St. Louis, MO).

2.7. Caspase expression and activity assay

Caspase expression and caspase‐8 activity were determined using a BCA kit (Pierce, Rockford) and an APOPCYTO caspase‐8 fluorometric assay kit (MBL, Nagoya) according to the manufacturers' protocols.

2.8. RNA interference assay

Cells were transfected with the RIP1 siRNA duplex (sense 5′‐ACCAACUAUCUAGGAAAUAC ACCCA‐3′, antisense 5′‐UGGGUGUAUUUCCUAGAUAGUUGGUCU‐3′) or a double scrambled negative control (IDT, Iowa) at a final concentration of 10 nM. The transfection efficiency was evaluated using a TYETM 563 DS transfection control. Transfection was carried out with siRNA duplexes using the transfection reagent X‐treme GENE HP (Roche, Minneapolis) according to a standard protocol. Cells transiently transfected with the siRNA duplex were harvested after 48 h for further study.

2.9. Statistical analysis

All data were expressed as the mean value ± S.D., and Student's t test was used for evaluating statistical significance. P values were considered to indicate statistical significance when less than 0.05.

3. Results

3.1. TRAIL induces both apoptosis and autophagy

Apoptosis is an important mechanism for regulating the number of macrophages. Both apoptosis and autophagy are important in development and physiological functions, as well as in various diseases. Although there are significant differences between apoptosis and autophagy, their regulation is intimately connected; the same regulator molecules may determine a different cell fate of apoptosis or autophagy. To explore the regulatory mechanisms of apoptosis and autophagy in macrophages, THP‐1, K562 and U937 cell lines were first treated with recombinant soluble TRAIL (rsTRAIL) at various concentrations, and the cell viability was detected by MTT assay. We observed that rsTRAIL at a higher dosage induced 20% cell death of U937 cells, but not in THP‐1 or K562 cells (Figure S1). In the presence of pan‐caspase inhibitor Z‐VAD, rsTRAIL‐induced cell death was significantly inhibited (Figure 1A), indicating that TRAIL induces caspase‐dependent apoptosis in U937 cells but not in THP‐1 or K562 cells. Therefore, U937 cells were chosen as a cell model system for further study.

Figure 1

TRAIL induces caspase‐dependent apoptosis and autophagy in U937 cells. (A) Cells were placed in a 96‐well plate at a density of 104/well and treated with rsTRAIL at concentrations of 0, 200, 400, 600, 800 and 1000 ng/ml. Cells ...

Then, the ability of TRAIL to induce autophagy in U937 cells was investigated. U937 cells were treated with rsTRAIL and LPS, respectively. Expression of LC3‐II (microtubule‐associated protein light chain 3‐II), a hallmark of autophagy, was analyzed by Western blot and immunofluorescence. LPS significantly increases LC3‐II expression in macrophages (Figure S2). As shown in Figure 1B, stimulation of rsTRAIL significantly enhanced LC3‐II expression in U937 cells. In addition, the fluorescence intensity of the intracellular accumulation of LC3, a marker of the autophagosome, was distinctly increased in the cells treated with rsTRAIL for 3 h (Figure 1C), indicating that TRAIL also induces autophagy in U937 cells. The lysosomal protease inhibitor chloroquine was further used to detect the expression of the LC3 by immunoblotting (Figure S3), which conformed that TRAIL induces autophagy. These data demonstrate that TRAIL induces both apoptosis and autophagy in U937 cells.

3.2. Inhibition of autophagy facilitates TRAIL‐induced apoptosis

Because TRAIL induces both autophagy and apoptosis, the relationship between these processes was investigated in the cells. U937 cells were pretreated with the autophagy inhibitor 3‐MA, Wortmannin or LY294002 for 2 h and then treated with rsTRAIL for 12 h, the cell viability was evaluated by MTT assay. As shown in Figure 2A, the autophagy inhibitors enhanced TRAIL‐induced cell death to varying degrees; in particularly, the cell mortality was more than 40% in 3‐MA‐treated cells. Western blot assay showed that the expression of LC3‐II was not altered by a single autophagy inhibitor or by the combination of inhibitor Wortmannin or LY294002 and rsTRAIL. Only the combination of 3‐MA and rsTRAIL significantly suppressed the expression of LC3‐II (Figure 2B).

Figure 2

Inhibition of autophagy enhances TRAIL‐induced apoptosis in U937 cells. Cells were treated with or without 3‐MA (5–10 μM), Wortmannin (100 nM) and LY294002 (20 μM) for 2 h before ...

Phosphatidylserine (PS) expression, a hallmark of early apoptotic cells, on the surfaces of cells treated with or without 3‐MA inhibitors and/or rsTRAIL was detected by staining with fluorescein‐labeled Annexin V followed by flow cytometry. As shown in Figure 2C, Annexin V‐positive cells represented 2.7% of the cells without treatment, 9.0% of the cells treated with rsTRAIL, 10.9% of the cells treated with 3‐MA and 59.1% of the cells treated with the combination of 3‐MA and rsTRAIL, suggesting that autophagy inhibitor 3‐MA significantly promotes TRAIL‐induced apoptotic cell death. Taken together, these data indicate that autophagy inhibitors, particularly 3‐MA, enhance apoptosis, and furthermore, inhibition of autophagy significantly facilitates TRAIL‐induced apoptosis in U937 cells.

3.3. TRAIL treatment influences death receptor expression in U937 cells

To further clarify the mechanism of TRAIL‐induced apoptosis and autophagy in macrophages, U937, THP‐1 and RAW264.7 cells were treated with rsTRAIL, and the expression levels of TRAIL receptors DR4 and DR5 were examined by flow cytometry. As shown in Figure 3A, DR4 expression was upregulated in the human U937 cells, but not in the human THP‐1 cells or mouse RAW264 cells (DR4 is absent in mouse cells). These results are consistent with the previous report by Orhan Aktas et al. (Aktas et al., 2007). In contrast, DR5 expression was down regulated in U937 cells, but not in THP‐1 cells and mouse RAW264.7 cells. These data demonstrated that TRAIL‐induced apoptosis and autophagy are mediated by both DR4 and DR5 in human U937 cells.

Figure 3

TRAIL‐induced apoptosis and autophagy are mediated by death receptors in U937 cells. U937, THP‐1 and RAW264.7 cells were treated with 500 ng/ml rsTRAIL for 6 h. The expression of DR4 and DR5 was examined by flow cytometry ...

3.4. RIP1 ubiquitination and expression regulate apoptosis and autophagy

We next examined how death receptor mediates both autophagy and apoptosis in U937 cells. It has been reported that ubiquitination and deubiquitination of RIP1 are key events in the process of apoptosis. RIP1 ubiquitination in TRAIL‐treated U937 cells was detected by Western blot assay. As shown in Figure 4A, RIP1 ubiquitination rapidly increased in U937 cells treated with rsTRAIL for 30 min and longer, indicating that non‐degradable ubiquitination of RIP1 may regulate TRAIL‐induced autophagy and apoptosis. This result was further confirmed RIP1 ubiquitination was significantly reduced (Figure 4B). RIP1 expression was also distinctly decreased in the presence of 3‐MA in the cells treated with rsTRAIL, different to the LPS‐treated positive control cells (Figure 4C). Dynamic analysis of RIP1 expression in rsTRAIL‐treated U937 cells in the presence of 3‐MA showed that RIP1 expression rapidly increased from 0.5 h to 3 h to the peak levels and then quickly decreased. LC3‐II expression exhibited a similar pattern (Figure 4D). Taken together, these data demonstrate that autophagy and apoptosis in the rsTRAIL‐treated macrophages are regulated not only by RIP1 ubiquitination but also by dynamic expression of RIP1.

Figure 4

RIP1 ubiquitination and expression regulate death receptors mediated apoptosis and autophagy in U937 cells. Cells were treated with rsTRAIL (500 ng/ml) for 3 h and then lysed. RIP1 ubiquitin in the cell lysate was analyzed by immunoprecipitation ...

3.5. Expression and activity of the p43/41‐caspase‐8 variant are critical to death receptor mediated autophagy and apoptosis

In addition to RIP1, the other major regulatory proteins in the TRAIL‐R‐recruited DISC are caspase‐8 and c‐FLIP. These proteins are structurally similar; however, caspase‐8 possesses catalytic homocysteine activity in the intermediate structure. C‐FLIP competitively binds with caspase‐8, thereby inhibiting caspase‐8 activation and resulting in an anti‐apoptotic effect (Krueger et al., 2001; Scaffidi et al., 1999). C‐FLIP usually has three splice variants, c‐FLIP‐S, c‐FLIP‐R and c‐FLIP‐L, as well as spliced variants p43 and p22. Caspase‐8 has a variety of splice variants, which can form homodimers, heterodimers or tetramers to compete with each other and regulate the downstream signaling pathway (Feoktistova et al., 2011). Therefore, the dynamic changes in the caspase‐8 and c‐FLIP variants were analyzed in U937 cells treated with rsTRAIL in the presence of 3‐MA. As shown in Figure 5A, c‐FLIP‐L was cleaved into the p43 variant at 1 h and then to the p22 variant from 3 h to 9 h. Accordingly, caspase‐8 was degraded into p43/41 while autophagy was suppressed by 3‐MA in the cells treated with rsTRAIL, suggesting that the dynamic expression of the caspase‐8 and c‐FLIP variants is essential to the conversion of autophagy to apoptosis, in which both p43/41 of caspase‐8 and p22 of c‐FLIP are responsible for death receptor mediated apoptosis. These data suggest that during the conversion of autophagy to apoptosis, caspase‐8 and c‐FLIP form splice variants, which may exist primarily as p43/41‐caspase‐8 and p22‐FLIP isoforms in the apoptosis process.

Figure 5

Expression of the p43/41‐caspase‐8 variant and its bioactivity are associated with the conversion of TRAIL‐induced autophagy to apoptosis in U937 macrophages. Cells were treated with rsTRAIL (500 ng/ml) in the presence ...

The activity of caspase‐8 in U937 cells treated with rsTRAIL and 3‐MA was further analyzed by an APOPCYTO caspase‐8 fluorometric assay. As shown in Figure 5B, caspase‐8 activity was significantly increased in a time‐dependent manner, and a 3.5‐fold enlargement occurred in the cells treated for 6 h with the two combined agents compared with the control cells without treatment. This result was confirmed in the presence of the caspase‐8 inhibitor Z‐IEDT‐fmk, in which caspase‐8 activity was the same as in the control. But 3‐MA plus rsTRAIL didn't affect the activity of caspase‐8 (Figure S4). These data indicate that the expression and activity of p43/41‐caspase‐8 are critical to the conversion of autophagy to apoptosis in macrophages.

3.6. RIP1 regulates NF‐κB activity in death receptors mediated autophagy and apoptosis

It has been reported that RIP1 can affect downstream NF‐κB activity via caspase‐8 in TNF‐α‐induced apoptosis (Lin et al., 1999). Because caspase‐8 activity and RIP1 expression were significantly increased in a time‐dependent manner in TRAIL‐ and 3‐MA‐treated cells, the downstream expression and phosphorylation events of IKK complex (IKK‐α, IKK‐γ and IκB) were further analyzed by Western blot assay. As shown in Figure 6A and Figure S5, the expression and phosphorylation of IKK‐α, IKK‐γ and IκB‐α was strikingly decreased after the cells were treated for 3 h with rsTRAIL plus 3‐MA, which is consistent with the pattern of caspase‐8 activity and RIP1 expression, indicating that RIP1 may regulate the expression and phosphorylation of IKK‐α, IKK‐γ and IκB‐α as well as NF‐κB activity. This result was further confirmed by knockdown of RIP1 expression with RIP1‐specific siRNA. As shown in Figure 6B, IκB‐α phosphorylation was down‐regulated when RIP1 expression was suppressed, suggesting that RIP1 expression regulates NF‐κB activity in death receptor mediated conversion of autophagy to apoptosis.

Figure 6

RIP1 expression regulates NF‐κB activity in the conversion of DR‐mediated autophagy to apoptosis in U937 macrophages. (A) Cells were treated with rsTRAIL (500 ng/ml) in the presence of 3‐MA (10 μM) ...

To determine whether LC3‐II expression is influenced by NF‐κB activity, U937 cells were treated with rsTRAIL in the presence of NF‐κB inhibitor, BAY11‐7082 (10 μM), IKK inhibitor‐II and Wedelolactone (20 μM). LC3‐II expression was then analyzed by western blot assay. As shown in Figure 6C, LC3‐II expression did not show any changes, while NF‐κB activity was blocked, indicating that NF‐κB activation does not affect LC3‐II expression. Therefore, NF‐κB activation did not affect TRAIL‐induced autophagy.

3.7. RIP1 is an essential regulator for Beclin 1 expression and death receptor mediated apoptosis and autophagy

Finally, we further verified the RIP1 function in the regulation of TRAIL‐induced autophagy and apoptosis. RIP1 was knocked down by RIP1‐specific siRNA in U937 cells treated with rsTRAIL, and LC3‐II expression was measured with Western blot assay. As shown in Figure 7A, LC3‐II expression was markedly suppressed in RIP1 knockdown cells, suggesting that down‐regulation of RIP1 expression inhibits autophagy in U937 cells.

Figure 7

RIP1 is an essential regulator of Beclin 1 expression and death receptors mediate autophagy in U937 macrophages. (A) Cells were transfected with RIP1 siRNA or control siRNA for 48 h, followed by treatment with rsTRAIL (500 ng/ml) for ...

Beclin 1, an essential autophagic protein in mammalian cells (Liang et al., 1999), is a substrate of caspase‐8. Caspase‐8 can cleave Beclin 1 into “N” and “C” fragments, disabling the capacity of Beclin 1 to induce autophagy (Djavaheri‐Mergny et al., 2010). The expression of Beclin 1 and RIP1 was analyzed in U937 cells treated with the combination of rsTRAIL and 3‐MA for the indicated time course. As shown in Figure 7B, Beclin 1 expression was increased from 0.5 h to 3 h and then gradually decreased until 12 h. In parallel, a similar pattern of RIP1 expression was observed in the cells. However, Beclin 1 expression was suppressed in RIP1 knockdown cells (Figure 7C, Figure S6) and the suppression of Beclin 1 expression significantly increased TRAIL‐induced apoptosis in macrophages. These data indicate that RIP1 is an essential regulator for Beclin 1 expression, as well as of death receptor mediated apoptosis and autophagy in macrophages (Figure 8).

Figure 8

Working model for RIP1 modulates TRAIL‐induced death receptor mediated apoptosis and autophagy in macrophages. TRAIL induces death receptor (DR4 or DR5)‐mediated apoptosis and autophagy. Inhibition of autophagy with the specific inhibitor ...

4. Discussion

Apoptosis and autophagy play important regulatory roles in cell development and function. In this study, we report that TRAIL induces both autophagy and apoptosis in U937 cells. Inhibition of autophagy strengthens apoptosis indicates that autophagy shields the cell from death. TRAIL treatment increases DR4 expression, decreases DR5 expression, suggesting that death receptors mediate autophagy and apoptosis in macrophages.

TRAIL, the native ligand for death receptor DR4 and DR5, is a potential anti‐cancer agent; it has a large cytotoxic effect on various tumor cells and without effects on most normal cells (Ashkenazi et al., 1999; Walczak et al., 1999). There are increasing evidences that TRAIL also plays an important role in the regulation of innate and adaptive immunity (Anel et al., 2007; Wajant, 2006; Wei et al., 2005). In a previous study, we showed that TRAIL binding to DR4 induces the chemotactic migration of THP‐1 human leukemia monocytes and LPS‐primed primary human monocytes in vitro, as well as LPS‐stimulated BALB/c mouse monocytes ex vivo (Wei et al., 2010). In this study, we find that TRAIL treatment influences death receptor expression in U937 cells, indicating that death receptor mediates TRAIL‐induced apoptosis and autophagy in macrophages. These data further demonstrate that TRAIL plays an important role in innate immunity.

Autophagy is a cell survival process involving macromolecule and organelle degradation. It has been reported that autophagy is connected to various physiological processes and an astonishing number of human diseases (Jostins et al., 2012; Levine and Kroemer, 2008; Liu et al., 2011; Mizushima et al., 2008). A unique report on TRAIL‐induced autophagy by Mills et al. showed that TRAIL is required for the induction of autophagy during lumen formation in vitro (Mills et al., 2004). Here we demonstrate that TRAIL induces both autophagy and apoptosis; inhibition of autophagy facilitates apoptosis in macrophages. These results suggest that TRAIL‐induced autophagy is a cyto‐protective mechanism, favoring stress adaptation and inhibiting cell death.

TNF‐R‐mediated regulation of cell fate is closely related to the assembly of the DISC complex, which involves the aggregation of the intracellular domain of the death receptor, caspase‐8, FADD, TRADD and others. (Cao et al., 2011; Vanlangenakker et al., 2011; Zhang et al., 2011). A recent study shows that RIP1‐dependent signal transduction pathways are involved in regulating cell survival, apoptosis and necrosis (Festjens et al., 2007). In these pathways, as in TNF‐R‐mediated signaling, RIP1 is positioned at the center of cell‐fate ‘decisions’; survival, apoptosis or necroptosis pathways are followed by the formation of complex I, complex II or the necrosome, respectively (Micheau and Tschopp, 2003; Rothe et al., 1995). In complex I (TRADD, RIP1, TRAF2, etc.), RIP1 quickly recruits IKK complex and activates NF‐κB. RIP1 and NEMO can also form a stable complex with a linear ubiquitin chain, thereby inhibiting cell death (Haas et al., 2009; Tokunaga et al., 2009). If RIP1 is not ubiquitinated, the complex I (TRADD‐RIP1‐TRAF2) is dissociated from the death receptor to allow FADD and caspases to bind and cause cell death by apoptosis (Bertrand et al., 2008; Petersen et al., 2007). When caspase activation is inhibited by viral infection, RIP1 and RIP3 induce necroptosis (Vandenabeele et al., 2010). We show here that the dynamic disintegration of RIP1 expression and deubiquitination suppress autophagy and increase apoptosis in TRAIL‐treated macrophages. This result suggests that the ubiquitination status of RIP1 may ‘tune’ its activity in different signaling pathways. Our observations provide new evidence that RIP1 plays a critical role in the regulation of death receptor mediated conversion of autophagy to apoptosis in macrophages.

Beclin 1, the mammalian orthologue of yeast Atg6, plays a central role in autophagy (Liang et al., 1998; Wang, 2008). We observed that knockdown of RIP1 suppresses the expression of Beclin 1 during TRAIL‐induced autophagy and apoptosis, suggesting that Beclin 1 is a downstream modulator of RIP1 signaling. It is known that both RIP1 and Beclin 1 are substrates of caspase‐8 and that caspase‐mediated cleavage of Beclin 1 promotes crosstalk between apoptosis and autophagy (Djavaheri‐Mergny et al., 2010; Kang et al., 2011). Moreover, Cho et al. report that TRAIL can trigger the caspase‐mediated cleavage of Beclin 1 in HeLa cells (Cho et al., 2009a). Another study (Hou et al., 2010) suggests that caspase‐8 activity in the TRAIL‐mediated autophagic response is counter‐balanced by the TRAIL‐mediated apoptotic response; the proposed mechanism involves continuous sequestration of the large caspase‐8 subunit in the autophagosomes of Bax−/− HCT116 colon cancer cells, which supports the existence of a feedback mechanism that cross‐regulates autophagy and apoptosis. Further clarification of the mechanism and downstream targets of Beclin 1 in the autophagy‐apoptosis shift would be valuable for the development of novel therapeutic strategies for the treatment of cancer and other diseases.

In summary, we have found that TRAIL induces both autophagy and apoptosis in macrophages, with the inhibition of autophagy significantly enhancing apoptosis. TRAIL treatment increased DR4 expression, decreased DR5 expression, indicating that TRAIL‐induced apoptosis and autophagy are mediated by death receptors in macrophages. RIP1 expression and ubiquitination are dynamically regulated, and the phosphorylation of IKK‐α, IKK‐γ (NEMO), and IκB is strikingly decreased in the TRAIL‐induced conversion of autophagy to apoptosis. Knockdown of RIP1 suppresses the expression of LC3‐II, which is the hallmark of autophagy. In addition, loss of RIP1 suppresses Beclin 1, which is a substrate of caspase‐8, during death receptor mediated autophagy in macrophages. Furthermore, the expression and activity of the p43/41‐caspase‐8 variant are critical to the conversion of autophagy to apoptosis. These data suggest that RIP1 is essential for the regulation of autophagy to apoptosis conversion. The combination of rsTRAIL with autophagic inhibitors may enhance TRAIL‐induced tumor cell death in clinical applications. Elucidating the molecular mechanism of the autophagy‐apoptosis conversion in macrophages is highly beneficial for the development of novel strategies for the treatment of cancer, inflammation and autoimmune diseases.

Conflict of interest

The authors declare no conflict of interest.

Supporting information

Supplementary data

Acknowledgements

This work was partially supported by the State Key Basic Research Program of China (Grant No. 2007CB507404) and the Natural Science Foundation of China (Grant No. 30972684 and 30972699).

Supplementary data 1. 

1.1. 

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2014.12.004.

Notes

Yao Zhenyu, Zhang Peng, Guo Hui, Shi Juan, Liu Shilian, Liu Yanxin, Zheng Dexian, (2015), RIP1 modulates death receptor mediated apoptosis and autophagy in macrophages, Molecular Oncology 9, doi: 10.1016/j.molonc.2014.12.004.

References

  • Aktas O., Schulze-Topphoff U., Zipp F., 2007. The role of TRAIL/TRAIL receptors in central nervous system pathology. Front. Biosci. 12, 2912–2921. [PubMed: 17485268] [PubMed]
  • Anel A., Bosque A., Naval J., Pineiro A., Larrad L., Alava M.A., Martinez-Lorenzo M.J., 2007. Apo2L/TRAIL and immune regulation. Front. Biosci. 12, 2074–2084. [PubMed: 17127445] [PubMed]
  • Ashkenazi A., Pai R.C., Fong S., Leung S., Lawrence D.A., Marsters S.A., Blackie C., Chang L., McMurtrey A.E., Hebert A., 1999. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Invest. 104, 155–162. [PubMed: 10411544] [PubMed]
  • Auffray C., Sieweke M.H., Geissmann F., 2009. Blood monocytes: development, heterogeneity, and relationship with dendritic cells. Annu. Rev. Immunol. 27, 669–692. [PubMed: 19132917] [PubMed]
  • Bertrand M.J., Milutinovic S., Dickson K.M., Ho W.C., Boudreault A., Durkin J., Gillard J.W., Jaquith J.B., Morris S.J., Barker P.A., 2008. cIAP1 and cIAP2 facilitate cancer cell survival by functioning as E3 ligases that promote RIP1 ubiquitination. Mol. Cell 30, 689–700. [PubMed: 18570872] [PubMed]
  • Cao X., Pobezinskaya Y.L., Morgan M.J., Liu Z.G., 2011. The role of TRADD in TRAIL-induced apoptosis and signaling. FASEB J. 25, 1353–1358. [PubMed: 21187341] [PubMed]
  • Cho D.H., Jo Y.K., Hwang J.J., Lee Y.M., Roh S.A., Kim J.C., 2009. Caspase-mediated cleavage of ATG6/Beclin-1 links apoptosis to autophagy in HeLa cells. Cancer Lett. 274, 95–100. [PubMed: 18842334] [PubMed]
  • Cho Y.S., Challa S., Moquin D., Genga R., Ray T.D., Guildford M., Chan F.K., 2009. Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation. Cell 137, 1112–1123. [PubMed: 19524513] [PubMed]
  • Cziupka K., Busemann A., Partecke L.I., Potschke C., Rath M., Traeger T., Koerner P., von Bernstorff W., Kessler W., Diedrich S., 2010. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) improves the innate immune response and enhances survival in murine polymicrobial sepsis. Crit. Care Med. 38, 2169–2174. [PubMed: 20657274] [PubMed]
  • Djavaheri-Mergny M., Maiuri M.C., Kroemer G., 2010. Cross talk between apoptosis and autophagy by caspase-mediated cleavage of Beclin 1. Oncogene 29, 1717–1719. [PubMed: 20101204] [PubMed]
  • Doseff A.I., 2004. Apoptosis: the sculptor of development. Stem Cell Dev. 13, 473–483. [PubMed: 15588505] [PubMed]
  • Ea C.K., Deng L., Xia Z.P., Pineda G., Chen Z.J., 2006. Activation of IKK by TNFalpha requires site-specific ubiquitination of RIP1 and polyubiquitin binding by NEMO. Mol. Cell 22, 245–257. [PubMed: 16603398] [PubMed]
  • Fahy R.J., Doseff A.I., Wewers M.D., 1999. Spontaneous human monocyte apoptosis utilizes a caspase-3-dependent pathway that is blocked by endotoxin and is independent of caspase-1. J. Immunol. 163, 1755–1762. [PubMed: 10438906] [PubMed]
  • Feoktistova M., Geserick P., Kellert B., Dimitrova D.P., Langlais C., Hupe M., Cain K., MacFarlane M., Hacker G., Leverkus M., 2011. cIAPs block Ripoptosome formation, a RIP1/caspase-8 containing intracellular cell death complex differentially regulated by cFLIP isoforms. Mol. Cel. 43, 449–463. [PubMed: 21737330] [PMC free article] [PubMed]
  • Festjens N., Vanden Berghe T., Cornelis S., Vandenabeele P., 2007. RIP1, a kinase on the crossroads of a cell's decision to live or die. Cell Death Differ. 14, 400–410. [PubMed: 17301840] [PubMed]
  • Galluzzi L., Kroemer G., 2009. Shigella targets the mitochondrial checkpoint of programmed necrosis. Cell host & Microbe 5, 107–109. [PubMed: 19218080] [PubMed]
  • Gerlach B., Cordier S.M., Schmukle A.C., Emmerich C.H., Rieser E., Haas T.L., Webb A.I., Rickard J.A., Anderton H., Wong W.W., 2011. Linear ubiquitination prevents inflammation and regulates immune signalling. Nature 471, 591–596. [PubMed: 21455173] [PubMed]
  • Goyal A., Wang Y., Graham M.M., Doseff A.I., Bhatt N.Y., Marsh C.B., 2002. Monocyte survival factors induce Akt activation and suppress caspase-3. Am. J. Respir. Cell Mol. Biol. 26, 224–230. [PubMed: 11804874] [PubMed]
  • Guo Y., Chen C., Zheng Y., Zhang J., Tao X., Liu S., Zheng D., Liu Y., 2005. A novel anti-human DR5 monoclonal antibody with tumoricidal activity induces caspase-dependent and caspase-independent cell death. J. Biol. Chem. 280, 41940–41952. [PubMed: 16234248] [PubMed]
  • Haas T.L., Emmerich C.H., Gerlach B., Schmukle A.C., Cordier S.M., Rieser E., Feltham R., Vince J., Warnken U., Wenger T., 2009. Recruitment of the linear ubiquitin chain assembly complex stabilizes the TNF-R1 signaling complex and is required for TNF-mediated gene induction. Mol. Cell 36, 831–844. [PubMed: 20005846] [PubMed]
  • Harper N., Farrow S.N., Kaptein A., Cohen G.M., MacFarlane M., 2001. Modulation of tumor necrosis factor apoptosis-inducing ligand- induced NF-kappa B activation by inhibition of apical caspases. J. Biol. Chem. 276, 34743–34752. [PubMed: 11461927] [PubMed]
  • Hou W., Han J., Lu C., Goldstein L.A., Rabinowich H., 2010. Autophagic degradation of active caspase-8: a crosstalk mechanism between autophagy and apoptosis. Autophagy 6, 891–900. [PubMed: 20724831] [PubMed]
  • Jostins L., Ripke S., Weersma R.K., Duerr R.H., McGovern D.P., Hui K.Y., Lee J.C., Schumm L.P., Sharma Y., Anderson C.A., 2012. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature 491, 119–124. [PubMed: 23128233] [PubMed]
  • Kang R., Zeh H.J., Lotze M.T., Tang D., 2011. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 18, 571–580. [PubMed: 21311563] [PubMed]
  • Kelliher M.A., Grimm S., Ishida Y., Kuo F., Stanger B.Z., Leder P., 1998. The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity 8, 297–303. [PubMed: 9529147] [PubMed]
  • Kirkegaard K., Taylor M.P., Jackson W.T., 2004. Cellular autophagy: surrender, avoidance and subversion by microorganisms. Nat. Rev. Microbiol. 2, 301–314. [PubMed: 15031729] [PubMed]
  • Kondo Y., Kanzawa T., Sawaya R., Kondo S., 2005. The role of autophagy in cancer development and response to therapy. Nat. Rev. Cancer 5, 726–734. [PubMed: 16148885] [PubMed]
  • Krueger A., Schmitz I., Baumann S., Krammer P.H., Kirchhoff S., 2001. Cellular FLICE-inhibitory protein splice variants inhibit different steps of caspase-8 activation at the CD95 death-inducing signaling complex. J. Biol. Chem. 276, 20633–20640. [PubMed: 11279218] [PubMed]
  • Levine B., Kroemer G., 2008. Autophagy in the pathogenesis of disease. Cell 132, 27–42. [PubMed: 18191218] [PubMed]
  • Liang X.H., Jackson S., Seaman M., Brown K., Kempkes B., Hibshoosh H., Levine B., 1999. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature 402, 672–676. [PubMed: 10604474] [PubMed]
  • Liang X.H., Kleeman L.K., Jiang H.H., Gordon G., Goldman J.E., Berry G., Herman B., Levine B., 1998. Protection against fatal Sindbis virus encephalitis by beclin, a novel Bcl-2-interacting protein. J. Virol. 72, 8586–8596. [PubMed: 9765397] [PubMed]
  • Lin Y., Devin A., Cook A., Keane M.M., Kelliher M., Lipkowitz S., Liu Z.G., 2000. The death domain kinase RIP is essential for TRAIL (Apo2L)-induced activation of IkappaB kinase and c-Jun N-terminal kinase. Mol. Cell Biol. 20, 6638–6645. [PubMed: 10958661] [PubMed]
  • Lin Y., Devin A., Rodriguez Y., Liu Z.G., 1999. Cleavage of the death domain kinase RIP by caspase-8 prompts TNF-induced apoptosis. Genes Dev. 13, 2514–2526. [PubMed: 10521396] [PubMed]
  • Linker R., Gold R., Luhder F., 2009. Function of neurotrophic factors beyond the nervous system: inflammation and autoimmune demyelination. Crit. Rev. Immunol. 29, 43–68. [PubMed: 19348610] [PubMed]
  • Liu J., Xia H., Kim M., Xu L., Li Y., Zhang L., Cai Y., Norberg H.V., Zhang T., Furuya T., 2011. Beclin1 controls the levels of p53 by regulating the deubiquitination activity of USP10 and USP13. Cell 147, 223–234. [PubMed: 21962518] [PubMed]
  • Maiuri M.C., Zalckvar E., Kimchi A., Kroemer G., 2007. Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nat. Rev. Mol. Cell Biol. 8, 741–752. [PubMed: 17717517] [PubMed]
  • Martinez-Lostao L., Garcia-Alvarez F., Basanez G., Alegre-Aguaron E., Desportes P., Larrad L., Naval J., Martinez-Lorenzo M.J., Anel A., 2010. Liposome-bound APO2L/TRAIL is an effective treatment in a rabbit model of rheumatoid arthritis. Arthritis Rheum. 62, 2272–2282. [PubMed: 20506326] [PubMed]
  • Micheau O., Tschopp J., 2003. Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114, 181–190. [PubMed: 12887920] [PubMed]
  • Mills K.R., Reginato M., Debnath J., Queenan B., Brugge J.S., 2004. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is required for induction of autophagy during lumen formation in vitro. Proc. Natl. Acad. Sci. USA 101, 3438–3443. [PubMed: 14993595] [PubMed]
  • Mizushima N., Levine B., Cuervo A.M., Klionsky D.J., 2008. Autophagy fights disease through cellular self-digestion. Nature 451, 1069–1075. [PubMed: 18305538] [PubMed]
  • Petersen S.L., Wang L., Yalcin-Chin A., Li L., Peyton M., Minna J., Harran P., Wang X., 2007. Autocrine TNFalpha signaling renders human cancer cells susceptible to Smac-mimetic-induced apoptosis. Cancer Cell 12, 445–456. [PubMed: 17996648] [PubMed]
  • Rothe M., Pan M.G., Henzel W.J., Ayres T.M., Goeddel D.V., 1995. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell 83, 1243–1252. [PubMed: 8548810] [PubMed]
  • Savill J., Fadok V., 2000. Corpse clearance defines the meaning of cell death. Nature 407, 784–788. [PubMed: 11048729] [PubMed]
  • Scaffidi C., Schmitz I., Krammer P.H., Peter M.E., 1999. The role of c-FLIP in modulation of CD95-induced apoptosis. J. Biol. Chem. 274, 1541–1548. [PubMed: 9880531] [PubMed]
  • Secchiero P., Gonelli A., Carnevale E., Milani D., Pandolfi A., Zella D., Zauli G., 2003. TRAIL promotes the survival and proliferation of primary human vascular endothelial cells by activating the Akt and ERK pathways. Circulation 107, 2250–2256. [PubMed: 12668516] [PubMed]
  • Song J.J., Lee Y.J., 2008. Differential cleavage of Mst1 by caspase-7/-3 is responsible for TRAIL-induced activation of the MAPK superfamily. Cell Signal. 20, 892–906. [PubMed: 18276109] [PubMed]
  • Tokunaga F., Sakata S., Saeki Y., Satomi Y., Kirisako T., Kamei K., Nakagawa T., Kato M., Murata S., Yamaoka S., 2009. Involvement of linear polyubiquitylation of NEMO in NF-kappaB activation. Nat. Cell Biol. 11, 123–132. [PubMed: 19136968] [PubMed]
  • Vandenabeele P., Galluzzi L., Vanden Berghe T., Kroemer G., 2010. Molecular mechanisms of necroptosis: an ordered cellular explosion. Nat. Rev. Mol. Cell Biol. 11, 700–714. [PubMed: 20823910] [PubMed]
  • Vanlangenakker N., Bertrand M.J., Bogaert P., Vandenabeele P., Vanden Berghe T., 2011. TNF-induced necroptosis in L929 cells is tightly regulated by multiple TNFR1 complex I and II members. Cell Death Dis. 2, e230 [PubMed: 22089168.] [PubMed]
  • Varfolomeev E., Maecker H., Sharp D., Lawrence D., Renz M., Vucic D., Ashkenazi A., 2005. Molecular determinants of kinase pathway activation by Apo2 ligand/tumor necrosis factor-related apoptosis-inducing ligand. J. Biol. Chem. 280, 40599–40608. [PubMed: 16227629] [PubMed]
  • Wajant H., 2006. CD95L/FasL and TRAIL in tumour surveillance and cancer therapy. Cancer Treat. Res. 130, 141–165. [PubMed: 16610707] [PubMed]
  • Walczak H., Miller R.E., Ariail K., Gliniak B., Griffith T.S., Kubin M., Chin W., Jones J., Woodward A., Le T., 1999. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat. Med. 5, 157–163. [PubMed: 9930862] [PubMed]
  • Wang J., 2008. Beclin 1 bridges autophagy, apoptosis and differentiation. Autophagy 4, 947–948. [PubMed: 18769161] [PubMed]
  • Wei W., Liu Y., Zheng D., 2005. Current understanding on the immunological functions of tumor necrosis factor-related apoptosis-inducing ligand. Cell Mol. Immunol. 2, 265–269. [PubMed: 16274624] [PubMed]
  • Wei W., Wang D., Shi J., Xiang Y., Zhang Y., Liu S., Liu Y., Zheng D., 2010. Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) induces chemotactic migration of monocytes via a death receptor 4-mediated RhoGTPase pathway. Mol. Immunol. 47, 2475–2484. [PubMed: 20638129] [PubMed]
  • Wiktor-Jedrzejczak W., Gordon S., 1996. Cytokine regulation of the macrophage (M phi) system studied using the colony stimulating factor-1-deficient op/op mouse. Physiol. Rev. 76, 927–947. [PubMed: 8874489] [PubMed]
  • Wiley S.R., Schooley K., Smolak P.J., Din W.S., Huang C.P., Nicholl J.K., Sutherland G.R., Smith T.D., Rauch C., Smith C.A., 1995. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 3, 673–682. [PubMed: 8777713] [PubMed]
  • Yao Q., Seol D.W., Mi Z., Robbins P.D., 2006. Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthritis. Arthritis Res. Ther. 8, R16 [PubMed: 16507116] [PubMed]
  • Zhang H., Zhou X., McQuade T., Li J., Chan F.K., Zhang J., 2011. Functional complementation between FADD and RIP1 in embryos and lymphocytes. Nature 471, 373–376. [PubMed: 21368761.] [PubMed]
  • Zhang X.D., Borrow J.M., Zhang X.Y., Nguyen T., Hersey P., 2003. Activation of ERK1/2 protects melanoma cells from TRAIL-induced apoptosis by inhibiting Smac/DIABLO release from mitochondria. Oncogene 22, 2869–2881. [PubMed: 12771938] [PubMed]

Articles from Molecular Oncology are provided here courtesy of Wiley-Blackwell