PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of moloncolLink to Publisher's site
 
Mol Oncol. 2013 October; 7(5): 907–916.
Published online 2013 May 15. doi:  10.1016/j.molonc.2013.05.001
PMCID: PMC5528460

Activation of Rac1 GTPase promotes leukemia cell chemotherapy resistance, quiescence and niche interaction

Abstract

Leukemia stem cells (LSCs) reside in bone marrow niche and receive important signals from the microenvironment that support self‐renewal, maintain quiescence and endow LSC with the ability of chemotherapy resistance. Rac1 belongs to the small GTP‐binding protein superfamily and is implicated in the interactions of hematopoietic progenitors and bone marrow niche. Our previous studies have shown that Rac1 is over‐expressed in leukemia patients and activation of Rac1 GTPase is closely associated with the efficient migration of leukemia cells. However, the potential functions for Rac1 GTPase in LSCs behaviors and in the residence of leukemia cells in niche remain unknown. In this study, by forced expression of a dominant‐negative form of Rac1 GTPase in a CD34+ myeloid leukemia cell line, as well as bone marrow cells from leukemia patients, we show that inactivation of Rac1 GTPase causes impaired migration and enhances chemotherapeutic sensitivity. Inactivation of Rac1 in leukemia cells also lead to a reduction in the frequency of cells in quiescent state and inhibition of homing to bone marrow niche. Gene expression analysis shows that inactivation of Rac1 down‐regulates the expression of several cell intrinsic cell cycle inhibitors such as p21, p27, and p57, as well as the extrinsic molecules that mediated the interaction of LSC with osteoblastic niche. Furthermore, we show that Rac1 mediated the localization in niche is further attributed to the maintenance of quiescence. Our results provide evidence for the critical role of Rac1 GTPase in leukemia cell chemotherapy resistance, quiescence maintenance and the interaction with bone marrow microenvironment.

Keywords: Rho GTPase, Migration, Bone marrow microenvironment, Chemotherapy resistance, Quiescence, Leukemia

1. Introduction

Hematopoietic stem cells (HSCs) reside in a specific microenvironment which is critical for regulating stem cell activities, including self‐renewal, survival and differentiation. Bone marrow (BM) microenvironment, known as HSC niche, is composed of osteoblastic niche and vascular niche, these two types of niche play distinct roles in the regulation of HSCs (Suda et al., 2005; Yin and Li, 2006). HSCs' location in distinct niche components are achieved through the homeostasis of homing, engraftment and mobilization, in these events, cell migration, adhesion and cytoskeleton rearrangements are involved. The homeostasis of trafficking to and egression from BM niche determine the HSCs location and even may influence the microenvironment regulation on HSCs fates.

The migration of HSCs must be strictly regulated. Increasing evidence demonstrates that Rho proteins are critical molecules that integrate extracellular signals and switch signal pathways regulating actin cytoskeleton and cell migration (Etienne‐Manneville and Hall, 2002). The Rho family belongs to the small GTP‐binding protein superfamily and consists of Rac, Cdc42 and Rho subfamilies. Most Rho GTPases act as molecular switches that cycle between an inactive GDP‐bound conformation and an active GTP‐bound conformation. In addition to their effects on the actin cytoskeleton, Rho proteins regulate a multitude of other cellular functions, including proliferation, apoptosis, cell cycle progression and transcription activation (Bokoch, 2000). It has become evident that Rac members of Rho GTPases family are important molecules regulating HSCs interactions with hematopoietic microenvironment (Williams et al., 2008). Some studies have strongly suggested that Rac1 is required for engraftment of hematopoietic progenitors into the BM. Rac1‐deficient HSCs exhibit decreased homing in BM and impaired engraftment and reconstitution upon transplantation, which suggesting Rac1 is a key molecule regulating HSCs trafficking and residence in the BM niche (Cancelas et al., 2006, 2005; Gu et al., 2003).

Similar to HSC, leukemia stem cells (LSCs) reside in a specialized ‘niche’ and also receive important signals from the microenvironment that support self‐renewal and maintain quiescent state (Lane et al., 2009). Niche signals in LSC engraftment and cell‐cycle regulation endow LSC with the ability of chemotherapy resistance (Ishikawa et al., 2007). Furthermore, homing and residence in BM niche appears important in sustaining LSC survival (Matsunaga et al., 2003). However, the precise mechanism of bone marrow microenvironment for malignant hematopoiesis remains to be elucidated. Given the critical role of Rho GTPase in regulating HSCs trafficking and residence in the BM niche, it could be deduced that aberrant activation of Rho GTPases and their signaling pathways is implicated in hematologic pathogenesis. In our previous study, we found that Rac1 protein is over‐expressed in leukemia patients and activation of Rac1 GTPase is closely associated with the efficient migration and vigorous growth of leukemic cells (Wang et al., 2009). Rac GTPase activation in myeloid‐associated disease has also been well documented, especially in BCR‐ABL chronic myeloid leukemia and MLL‐AF9 leukemia (Muller et al., 2008; Thomas et al., 2007, 2008; Wei et al., 2008).

Despite these aforementioned studies, the potential function for Rac1 GTPase in residence of leukemia cells in niche and the role of localization in bone marrow microenvironment in LSCs' regulation remain largely unknown. In this study, we aim to examine the role of activation of Rac1 GTPase in LSC behaviors and homing. In a CD34+ myeloid leukemia cell line with enforced expression of dominant‐negative form of Rac1 GTPase (DN‐Rac1), we show that inactivation of Rac1 GTPase lead to a reduction in migration, chemotherapy resistance, quiescence and trafficking to bone marrow niche. Furthermore, we show that Rac1 mediated the localization in niche is further attributable to the maintenance of LSC quiescence. Gene expression analysis showed these effects are associated with deregulated p21, p27 and p57, as well as Tie2, N‐cadherin.

2. Materials and methods

2.1. Patients, antibodies and reagents

Bone marrow samples were obtained from two primary AML patients enrolled in Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences, which were under the ethical principles for medical research and approved by the Ethics Committee of Institute of Hematology and Blood Diseases Hospital. All patients gave informed consent. The diagnosis were based on 2008 World Health Organization's criteria. Bone marrow mononuclear cells (BMMNCs) were cultured in Iscove's modified Dulbecco's media supplemented with 15% fetal bovine serum for subsequent lentiviral infection.

Rac Assay Reagent (GST‐PBD‐Agarose) was purchased from Millipore (Temecula, CA). Anti‐Rac1 antibody and APC‐BrdU flow kit were from BD Biosciences (San Jose, CA). Transwell plate is the product of Corning Costar Corporation (Cambridge, MA). PE‐anti‐Tie2, PE‐anti‐MPL, PE‐anti‐Ki67, anti‐human CD45, Tie2 and N‐cadherin antibodies were all from Biolend (San Diego, CA). Dexamethasone, β‐sodium glycerophosphate and vitamin C were purchased form Sigma–Aldrich (Louis, MO). PCR core reagents and SYBR green were the products of TaKaRa Bio Inc. (Otsu, Shiga, Japan). PE‐anti‐N‐cadherin and anti‐MPL antibodies were from eBioscience Inc(San Diego, CA). Annexin V‐Alexa Fluor 647/PI kit and 7‐AAD were from Biolegend (San Diego, CA). Alkaline phosphatase detection kit is the product of Millipore (Temecula, CA).

2.2. Lentiviral vectors construction and transduction

The fragment containing dominant‐negative mutant Rac1N17 (DN‐Rac1) was amplified by PCR. The fragment was subcloned into pCDH1–MCS1–EF1–copGFP (System Biosciences, Mountain View, CA, USA) and named as pCDH–DN‐Rac1. The construct was verified by sequencing. The empty vector pCDH1–MCS1–EF1–copGFP was used as a parallel control vector and named pCDH in brief in this study. For lentiviruses transduction, the lentiviral vector constructs were co‐transfected into 293T cells with pPACK packaging plasmid mix (System Biosciences) using calcium phosphate precipitation method. Infectious lentiviruses were collected at 48 and 72 h after transfection and concentrated to 100‐fold by ultracentrifugation. The leukemia cell line KG1‐a cells were transduced with prepared lentivirus. GFP‐positive cell portions were sorted by FACS. Transgene expression was detected by active Rac1 pull‐down assay (see below).

2.3. Active Rac1 pull‐down assay and Western‐blot

Levels of active Rac1 were measured using a GST‐PAK1 PBD pull‐down assay according to the manufacturer's instructions. In brief, cells were harvested in chilled magnesium‐containing lysis buffer. Lysates were incubated with GST‐PAK1 PBD beads for 60 min at 4 °C. The beads were then washed with lysis buffer, boiled in reducing sample buffer, and analyzed by immunoblotting using specific Rac1 antibody. The same samples were probed for total Rac1 protein.

2.4. Cell migration assay

Cell migration assays were performed in transwell plate inserted with a 6.5 mm polycarbonate membrane (8.0 μm pore size). Briefly, 3 × 105cells were suspended in 0.2 mL of culture medium and were added to the upper chamber. As chemoattractant, serum‐free media with 100 ng/mL of SDF‐1 was added to the lower chamber. After 4 h of incubation at 37 °C in 5% CO2, the upper chamber was carefully removed, and the cells in the bottom chamber were harvested and counted. All assays were performed in triplicate.

2.5. Apoptosis measurement by Annexin V/propidium iodide staining

Cell apoptosis was induced by incubating with VP16. The cells were collected at different time and analyzed for apoptosis by Annexin V‐Alexa Fluor 647/PI kit according to the manufacturer's instructions. After the cells were incubated with Annexin V‐Alexa Fluor 647 and PI working solution, all the samples were analyzed by FACS LSRII flow cytometer (Becton Dickinson). The apoptotic cells in the green fluorescent protein (GFP)‐positive cell portions were calculated.

2.6. 7‐AAD and Ki‐67 staining for G0 cell cycle status

1 × 106 cells were incubated with 10 μg/mL of 7‐AAD in 0.5 mL of phosphate‐citrate buffer solution containing 0.02% saponin (PCBS). After being spun down, the cell pellet was resuspended in 100 μL PCBS containing Ki67‐PE and was incubated for 30 min at room temperature. After washed, the cell pellet was resuspended in 0.5 mL PCBS containing 10 μg/mL of actinomycin D and was kept on ice. The G0 phase cell ratio of the sample was determined by flow cytometry assay.

2.7. Bromodeoxyuridine (BrdU) incorporation assay

A BrdU flow kit was used to measure the incorporation of BrdU into DNA of the proliferating cells. The assay was performed according to the manufacturer's protocol. Briefly, cells were incubated with a 10 μM BrdU solution for 2 h at 37 °C. After fixed and permeabilized, cells were labeled with APC‐conjugated anti‐BrdU antibody and then were stained using 7‐amino‐actinomycin D (7‐AAD), followed by flow cytometry analysis. The BrdU content (APC positive) and total DNA content (7‐AAD positive) were assayed using FlowJo 7.6 software.

2.8. SYBR green quantitative real‐time reverse transcription‐PCR assay

Total RNA was extracted using RNAiso reagent. cDNA was prepared with SuperScript III and used as templates for PCR. PCR core reagents and SYBR green were used with 10 μM of forward and reverse primers. Real‐time quantitative PCR was performed on 7500 Real‐Time PCR System (Applied Biosystems). Expression levels of the target genes were normalized against GAPDH. All amplifications were done in triplicate, and at least three biological replicates were performed. The primer sequences used for the specific amplification are as follows: p21: 5′‐accttccagctcctg taacatact‐3′ and 5′‐gtctaggtggagaaacgggaa‐3′, p27: 5′‐aggatgtcagcgggagccgc‐3′ and 5′‐cttcttgggcgtctgctcca‐3′, p57: 5′‐cgctttcgctgtctctcttattatgac‐3′ and 5′‐agtggtacagacg gctcaggaa‐3′, N‐cadherin: 5′‐cggtgccatcattgccatcct‐3′ and 5′‐agtcatagtcctggtcttcttctc ct‐3′, Tie‐2: 5′‐tgcttggacccttagtga‐3′ and 5′‐ccttgtaacggatagtaataga‐3′, c‐MPL: 5′‐ccc atagagttgtgacgag‐3′ and 5′‐aaatcatgttcctttccct‐3′.

2.9. NOD/SCID xenotransplantation and homing assay

Animal studies were performed under the institutional guidelines approved by the Animal Care and Ethics Committee of the Chinese Academic of Medical Sciences. 1 × 107 cells in a final volume of 100 μL PBS were injected through the tail vein into sub‐lethally irradiated mice. Sixteen hours after injection, cells recovered from the BM were analyzed by flow cytometry for the presence of GFP positive cells.

2.10. Immunohistochemical staining

Localization of transplanted cells in BM was determined by immunohistochemical staining. Femurs of the recipients were fixed in 4% formaldehyde and decalcified and paraffin‐embedded sections were prepared. Immunohistochemical labeling was performed using mouse anti‐human CD45 (hCD45) monoclonal antibody and followed by the avidin–biotin peroxidase procedure.

2.11. Preparation of primary osteoblast cells

Primary osteoblast cells were prepared from human bone marrow stromal cells. Primary culture and first passage was cultured in media with 10−7 M of dexamethasone, 10 mM β‐sodium glycerophosphate and 5 μg/mL vitamin C for 7–14 days. At 7, 14, and 21 days, alkaline phosphatase (ALP) activity were evaluated and calcium nodule formation was demonstrated by alizarin red staining.

2.12. Statistical analysis

Independent pair T test was applied to evaluate the statistical significant differences between pCDH and DN‐Rac1 KG1‐a cell groups. Data were analyzed using SPSS statistics software. P values <0.05 were considered statistically significant differences.

3. Results

3.1. Inctivation of Rac1‐GTPase in leukemia cells suppresses migration and promotes drug induced apoptosis

As a first step in this study, we investigated the role of active Rac1 in the abnormal behaviors of leukemia cells. First, KG‐1a leukemia cells were infected with dominant‐negative Rac1 (Rac1N17, DN‐Rac1). After GFP‐positive cell portions were sorted by FACS, active Rac1 pull‐down assay was performed and showed that Rac1 was deactivated in DN‐Rac1 KG‐1a cells (Figure 1A).

Figure 1

Deactivation of Rac1‐GTPase inhibits migration and chemotherapy resistance in leukemia cells. Data are presented as the means ± standard errors from at least three independent experiments (B and C)). (A) Deactivation of ...

Given the regulation activity of Rac1 in actin cytoskeleton, we first tested whether Rac1 activation promote the migration of leukemic cells by using an in vitro migration assay. Figure 1B showed that as compared with null lentivirus group, cell migration was decreased (21 ± 3) % in DN‐Rac1 KG‐1a cells. Compared with control cells, the differences were statistically significant for DN‐Rac1 KG‐1a cell group. The results indicate that inactivation of Rac1 causes impaired migration in leukemic cell in vitro. We then evaluated the functions of active Rac1 in the proliferation of leukemia cells. Cell growth curves showed that OD values of DN‐Rac1 KG‐1a cells were slightly higher than that of control cells, and however, no significant difference was found (data not shown). Cell growth assay indicated that activation of Rac1 had little effect on leukemia cells proliferation.

In addition to the effects on the actin cytoskeleton, Rac1 regulates a multitude of other cellular functions, including apoptosis. As anti‐apoptotic phenotype is one of the hallmark characteristics of leukemic cells, especially LSCs, we then tested the role of Rac1 activation in drug‐induced apoptosis in KG1‐a cells. Cells were induced to undergo apoptosis with VP‐16 treatment and the percentage of early and late apoptotic cells was quantified. As shown in Figure 1C, compared with control cells, DN‐Rac1 KG‐1a cells exhibited VP‐16 induced extensive apoptosis. At 24 and 48 h after VP‐16 treatment, DN‐Rac1 KG‐1a cells showed significantly higher apoptosis levels than that of control cells (early apoptosis: 23.5% vs.3.0% at 24 h and 31.8% vs. 3.8% at 48 h, late apoptosis: 7.8% vs. 3.4% at 24 h and 23.4% vs. 10.1% at 48 h, respectively). These results showed that inactivation of Rac1 in leukemia cells enhanced the chemotherapeutic sensitivity, which suggested that activation of Rac1 rendered leukemic cells more resistant to drug induced apoptosis.

To confirm the effects of active Rac1 on leukemia cell line, we then further investigated whether activation of Rac1 GTPase in primary leukemia cells could lead to the similar effects on migration and protection from apoptosis. Figures 1D and E showed the effect of DN‐Rac1 on the primary leukemia cells obtained from two patients. It showed that after the cells were infected with lentivirus, DN‐Rac1 leukemia cells exhibited decreased migration ability and higher levels of drug‐induced apoptosis. The data from both leukemia cell line and BM cells of leukemia patients indicate that activation of Rac1 GTPase promotes leukemia cells migration and protects leukemia cells from drug induced apoptosis.

3.2. Dectivation of Rac1‐GTPas leads to a reduction of frequency of cells in quiescent state and down‐regulates cell cycle inhibitors

As one of the mechanisms of LSC's chemotherapy resistance, cell cycle quiescence is critical to protect LSC from drug induced apoptosis. To understand the mechanism underlying the enhanced resistance to apoptosis that results from Rac1 activation, we examined the G0 accumulation based on staining with 7‐AAD and Ki‐67. As shown in Figure 2A, the percentage of cells in G0 phase in DN‐Rac1 KG‐1a cell group was significantly lower than that of control cells. To further support the finding that decreased frequency of the cells in quiescence state was caused by deactivation of Rac1 GTPase, we detected the growth arrest rate using a BrdU incorporation assay. Figure 2B showed that higher level of BrdU incorporation was detected in DN‐Rac1 KG1‐a cells, while only a moderate level of BrdU incorporation was found in control cells. This result is consistent with our observation that DN‐Rac1 KG1‐a cells were found to proliferate slightly faster than pCDH KG1‐a cells. The data from G0 accumulation assay and BrdU incorporation assay indicate that deactivation of Rac1‐GTPas in leukemia cells leads to a reduction in the frequency of cells in quiescent state, which imply that Rac1 activation is attributed to the maintaining cell cycle quiescence in leukemia cells.

Figure 2

Dectivation of Rac1‐GTPase causes the percentage of leukemia cells in the G0 phase of the cell cycle decreased and BrdU positive cell increased. (A) Determination of G0 phase in KG1‐a cells by FACS analysis. KG1‐a cells were stained ...

To confirm the finding that Rac1 deactivation accelerates cell cycle status in leukemia cells, we further examined the expression profile of a number of cell cycle inhibitors. Real‐time quantitative RT‐PCR analysis showed that the expression of p21, p27 and p57 were significantly decreased in DN‐Rac1 KG1‐a cells (Figure 2C). These cell cycle regulators are likely more importance for quiescent state caused by Rac1 activation in leukemia cells.

3.3. Deactivation of Rac1‐GTPase prevents leukemic cells from homing to BM microenvironment and lodging in bone trabeculae region and down‐regulates niche associated regulators

Given the effect of Rac1 activation on leukemia cell migration, we hypothesized that Rac1 activation may promotes leukemic cells homing to and lodging in BM niche. To evaluate this possibility, KG1‐a cells were injected intravenously into sub‐lethally irradiated NOD/SCID mice. As analyzed by flow cytometry, 16 h after injection, a relatively lower percentage of GFP positive cells in BM cells were found in DN‐Rac1 KG‐1a cell group. Figure 3A showed that pCDH‐Rac1 KG‐1a cells were more efficient at entering BM than that of DN‐Rac1 KG‐1a cells, which indicated that Rac1 activation is essential to homing to BM niche for leukemic cells.

Figure 3

Deactivation of Rac1‐GTPase inhibits KG1‐a cells homing and lodging in bone trabeculae region. (A) Determination of homing ability of KG1‐a cells in host BM. Percentage of GFP positive cells was measured by FACS 16 h after ...

Next, we examined the location area of KG1‐a cells in BM niche. Immuno‐ histochemical staining showed that human CD45 positive leukemia cells were resided mainly in the trabeculae bone region (TBR), whereas almost no human CD45 positive cell was found in the compact region (CBR) (Figure 3B). CBR consists mainly of vascular and perivascular areas, and TBR is occupied by osteoblastic cells. Enrichment of leukemic cells in trabeculae indicates that KG1‐a leukemic cells, especially active‐Rac1 expressing cells are highly prone to abutting the osteoblastic cells.

A number of adhesion molecules that mediated the interaction of BM osteoblastic niche with HSC extrinsically regulate HSCs quiescence. To verify the regulation effect of Rac1 activation in leukemic cells quiescence and determine its extrinsic mechanisms, we further assessed the expression profiles of several regulators by real‐time quantitative RT‐PCR. Figure 3C showed that compared with control cells, DN‐Rac1 KG‐1a cells exhibited lower expression levels of Tie‐2, N‐cadherin and c‐MPL. Consistent with the RT‐PCR results, Western‐blot also revealed that Tie‐2 and N‐cadherin proteins were expressed at lower levels in DN‐Rac1 KG‐1a cells (Figure 3C). There was no difference in MPL protein level between two groups. These data support above conclusion that Rac1 activation promote leukemia cells home to BM niche and maintaining in quiescence state.

3.4. Coculture of leukemia cells with osteoblastic cells promotes active‐Rac1 enforced quiescence in leukemia cells

HSCs remain in a quiescent state through close interaction with osteoblastic cells (Li, 2011). Some striking similarities between normal stem cells and LSCs imply that osteoblastic niche is also essential to promoting maintenance of LSCs quiescence. Above result revealed that KG1‐a leukemic cells, especially active‐Rac1 expressing cells, mainly located in trabeculae bone area, which prompted us to speculate that trabeculae microenvironment may promote leukemia cells in a more quiescent state. To achieve this, we cocultured KG1‐a cells with osteoblastic cells that were isolated and induced from normal bone marrow stromal cells. As shown in Figure 4, after cultured on osteoblastic cells, the G0 accumulation in each group was significantly higher than that without osteoblastic cells, and the G0 accumulation in DN‐Rac1 KG‐1a cell group was also significantly lower than that of pCDH‐Rac1 KG‐1a cell. The presence of osteoblastic cells significantly enhanced the percentage of cells in G0 phase, indicating that osteoblastic cells were attributed to the maintaining cell cycle quiescence in leukemia cells. It also reveals that coculture of leukemia cells with osteoblastic cells promotes active‐Rac1 enforced quiescence in leukemia cells.

Figure 4

Coculture of KG1‐a cells with osteoblastic cells promotes the maintaining of quiescence in KG1‐a cells. (A) Representative images of alizarin red staining for calcium nodule formation in osteoblastic cells and the coculture of KG1‐a ...

4. Discussion

Rac1 overexpression has been found in a series of human solid tumors. Accumulating evidence indicates that Rac1‐associated cell signaling is critical for malignant transformation (Espina et al., 2008; Gomez del Pulgar et al., 2005). In our previous study, we have found that Rac1 is highly expressed in most primary leukemia patients (Wang et al., 2009). Rac GTPase activation has also been found in myeloid‐associated diseases (Muller et al., 2008; Thomas et al., 2007, 2008). Rho GTPase is involved in cellular processes that depend on the actin cytoskeleton such as cell spreading and migration. It was initially thought that Rho GTPase associated cell migration was important for solid tumor development but would not be of such importance in leukemia. However, more evidence suggests that the migratory nature of HSCs and their dynamic interaction with microenvironment modulate HSCs' fate, even be involved in the leukemogenesis (Kaplan et al., 2007). Although Rho GTPase activation in leukemia has received well scrutiny, much remain to be studied about the specific contributions of Rho GTPase signal that are important in hematopoietic malignancies (Mulloy et al., 2010). In this study, we report that activation of Rac1 GTPase is crucial for leukemia cells migration, chemotherapy resistance, quiescence and trafficking to bone marrow niche. Furthermore, we show that activation of Rac1 in leukemia cells up‐regulates the expression of niche associated molecules and cell cycle inhibitors, and promotes leukemic cells lodge in bone marrow niche, especially in trabeculae bone region, which is further attributable to the maintenance of LSC quiescence.

In this study, proliferation assay showed that no significant difference was existed after Rac1 was deactivated, however, in our previous study (Wang et al., 2009), both silencing of Rac1 with siRNA and Rac inhibitor treatment could suppress leukemia cells proliferation. The difference obtained from two studies is maybe due to the different inhibition means. In previous study, siRNA and Rac inhibitor treatment are transient inhibiting, and the proliferation is a transient effect. Actually, we observed that 72–92 h after siRNA and inhibitor treatment, the difference in proliferation was not significant. In this study, by stable enforced expression of a dominant‐negative form of Rac1 GTPase, no significant difference in proliferation was found, that maybe a persistent effect.

The anti‐apoptosis role of Rac1 GTPase, especially in drug induced apoptosis, has been defined and reported, but the mechanisms involved are not completely understood. A number of apoptosis associated regulators involved in Rac1 inhibited apoptosis, such as Bcl‐2 family members, caspase 3, JNK pathway et al., have been well described (Xu and Greene, 2006; Zhang et al., 2003, 2004). In this study about the mechanism involved in the Rac1 anti‐apoptosis, we only focused on the cell quiescence and niche interactions. Several studies have shown that quiescent state appears to be a critical factor in the resistance of cancer stem cells (CSCs) to chemotherapy. Studies using xenogeneic models indicate that AML LSCs are localized to the BM endosteal region, are noncycling, and resist elimination by chemotherapy (Saito et al., 2010). In addition, as we previously reported, after leukemia cells were induced to enter cell cycle, the proportion of G0 phase cells was decreased significantly and the sensitivity to drug was increased. (He et al., 2011) In the present study, we find that Rac1 activation contributes to leukemia cell quiescence, which leading to resistance to chemotherapy.

It is well documented that regulators of HSC maintenance by BM niche are also involved in the development of leukemias (Rizo et al., 2006). Immunodeficient mice transplanted with MLL‐AF9‐transduced CD34+ cord blood cells developed AML, ALL, or biphenotypic leukemia, which depended on different host factors, which provided the first evidence that lineage fate can be determined by the host microenvironment (Wei et al., 2008). Extrinsic components mediated by leukemia–stroma interactions play a pivotal role in leukemia development. One of the key initial steps of interactions of LSC with microenvironment is homing and subsequent attachment of LSCs to the protective areas of BM niche (Konopleva and Jordan, 2011). Homing to the microenvironment appears important in sustaining LSC survival (Tavor et al., 2004). In our study, we found that activation of Rac1 GTPase promoted leukemia cells migration, homing and lodging in BM marrow, hence suggesting that active Rac1 may facilitate leukemia cells localizing in the protective niche and then receiving important signals from the microenvironment that support LSCs self‐renewal, survival, even resistance to chemotherapy.

Leukemia is a stem cell disease, in which the regulation mechanisms contributed to HSCs are preserved. There are some marked similarities between normal stem cells and LSCs, many of the molecules that mediate the interaction between stem cells and the bone marrow niche are utilized by both HSCs and LSCs (Arai et al., 2004; Rizo et al., 2006) Tie2, MPL and N‐cadherin are key molecules expressed in HSC, which mediate the interactions between HSC and niche and play critical roles in quiescence and long‐term maintenance of HSC in niche (Arai et al., 2004; Arai and Suda, 2008; Puch et al., 2001; Yoshihara et al., 2007). Our data demonstrate that Rac1 activation leads to up‐regulation of Tie2 and N‐cadherin in leukemia cells and promote leukemia cell in quiescence state, these finding strongly suggest that signals for quiescent stem cells are also utilized by leukemic cells and expression of these molecules depends on Rac1 activity. Although there are some similarities between normal stem cells and LSCs, there are also marked differences. The most noticeable events involved in the malignant transformation are initiated by the chromosome translocations products, such as BCR‐ABL, AML1‐ETO and MLL gene rearrangements. Actually, Rac GTPase activation is involved in some of these specific translocations. For example, Rac1 and Rac2 have been found to function downstream of BCR‐ABL and play a role in transformation of HSCs by p210‐BCR‐ABL fusion protein (Skorski et al., 1998; Thomas et al., 2007). In addition, recent studies show that Rac signaling is essential for the maintenance of functional MLL‐AF9 leukemia stem cell and suggest that Rac GTPase signalling also represent a target of the context of MLL gene rearrangements (Mizukawa et al., 2011; Somervaille and Cleary, 2006). These findings, taken together with our study strongly imply that Rac1 GTPase activation is implicated in hematopoietic malignancies.

Although Rho GTPases were initially shown to have a role in cytoskeletal remodeling, it is now known that these GTPases are involved in several other cellular processes including transcriptional activation. Rac1 can induce the activation of transcription factors such as serum response factor and NF‐κB to stimulate transcription of multiple genes (Sulciner et al., 1996). Studies from Yi Gu showed that most genes displayed upregulated expression in Rac2‐deficient cells, including several genes encoding transcription factors such as NF‐κB, Stat4, and TSC‐22 (Gu et al., 2002). Despite Rac1 and Rac2, two closely related GTPases, regulate gene expression via different transcriptional signalling pathways, it is plausible that some transcription factors are postulated to lie downstream of Rac GTPase. Our study demonstrates that the cell functions regulated by active Rac1 not only are caused by the interaction of leukemia cells with microenvironment, but some cell events are also directly regulated by Rac1 activation, including cell quiescence and chemotherapy resistance. That could be explained by the regulation activity of Rac1 in gene transcription. Transcriptional regulation that contributed to the active Rac1 is being further investigated.

In summary, we demonstrate that Rac1 GTPase activation promotes leukemia cells migration, resistance to drug induced apoptosis and maintaining quiescence state. Our findings also reveal that active Rac1 renders leukemia cells home to and lodge in bone marrow niche, especially in trabeculae area, that would further contribute to leukemia cells quiescence and protect them from elimination by various chemotherapies. The results presented here represents an important progress in our understanding on how Rac1 GTPase participate in the regulation of leukemia cell behaviours and provide new insights into the importance of the abnormal interaction of leukemic cell with bone marrow microenvironment in leukemogenesis.

Financial support

This work was supported by National Natural Science Foundation of China (Grant No. 81070389, 81090412).

Conflict of interest

The authors declare no conflict of interest.

Notes

Wang Ji-Ying, Yu Pei, Chen Shuying, Xing Haiyan, Chen Yirui, Wang Min, Tang Kejing, Tian Zheng, Rao Qing, Wang Jianxiang, (2013), Activation of Rac1 GTPase promotes leukemia cell chemotherapy resistance, quiescence and niche interaction, Molecular Oncology, 7, doi: 10.1016/j.molonc.2013.05.001.

Contributor Information

Qing Rao, nc.ca.smachi@gniqoar.

Jianxiang Wang, nc.ca.smachi@xjgnaw.

References

  • Arai F., Hirao A., Ohmura M., Sato H., Matsuoka S., Takubo K., Ito K., Koh G.Y., Suda T., 2004. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell. 118, 149–161. [PubMed]
  • Arai F., Suda T., 2008. Quiescent Stem Cells in the Niche StemBook; Cambridge (MA) [PubMed]
  • Bokoch G.M., 2000. Regulation of cell function by Rho family GTPases. Immunol. Res.. 21, 139–148. [PubMed]
  • Cancelas J.A., Jansen M., Williams D.A., 2006. The role of chemokine activation of Rac GTPases in hematopoietic stem cell marrow homing, retention, and peripheral mobilization. Exp. Hematol.. 34, 976–985. [PubMed]
  • Cancelas J.A., Lee A.W., Prabhakar R., Stringer K.F., Zheng Y., Williams D.A., 2005. Rac GTPases differentially integrate signals regulating hematopoietic stem cell localization. Nat. Med.. 11, 886–891. [PubMed]
  • Espina C., Cespedes M.V., Garcia-Cabezas M.A., Gomez del Pulgar M.T., Boluda A., Oroz L.G., Benitah S.A., Cejas P., Nistal M., Mangues R., Lacal J.C., 2008. A critical role for Rac1 in tumor progression of human colorectal adenocarcinoma cells. Am. J. Pathol.. 172, 156–166. [PubMed]
  • Etienne-Manneville S., Hall A., 2002. Rho GTPases in cell biology. Nature. 420, 629–635. [PubMed]
  • Gomez del Pulgar T., Benitah S.A., Valeron P.F., Espina C., Lacal J.C., 2005. Rho GTPase expression in tumourigenesis: evidence for a significant link. Bioessays. 27, 602–613. [PubMed]
  • Gu Y., Byrne M.C., Paranavitana N.C., Aronow B., Siefring J.E., D'Souza M., Horton H.F., Quilliam L.A., Williams D.A., 2002. Rac2, a hematopoiesis-specific Rho GTPase, specifically regulates mast cell protease gene expression in bone marrow-derived mast cells. Mol. Cell. Biol.. 22, 7645–7657. [PubMed]
  • Gu Y., Filippi M.D., Cancelas J.A., Siefring J.E., Williams E.P., Jasti A.C., Harris C.E., Lee A.W., Prabhakar R., Atkinson S.J., Kwiatkowski D.J., Williams D.A., 2003. Hematopoietic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Science. 302, 445–449. [PubMed]
  • He K., Yu P., Xing H.Y., Li Y., Tian Z., Wang M., Tang K.J., Rao Q., 2011. Resistance of leukemia KG1a cells with positive N-cadherin in phase G(0) against killing activity of VP16. Zhongguo shi yan xue ye xue za zhi/Zhongguo bing li sheng li xue hui. J. Exp. Hematol./Chin. Assoc. Pathophysiol.. 19, 1102–1106. [PubMed]
  • Ishikawa F., Yoshida S., Saito Y., Hijikata A., Kitamura H., Tanaka S., Nakamura R., Tanaka T., Tomiyama H., Saito N., Fukata M., Miyamoto T., Lyons B., Ohshima K., Uchida N., Taniguchi S., Ohara O., Akashi K., Harada M., Shultz L.D., 2007. Chemotherapy-resistant human AML stem cells home to and engraft within the bone-marrow endosteal region. Nat. Biotechnol.. 25, 1315–1321. [PubMed]
  • Kaplan R.N., Psaila B., Lyden D., 2007. Niche-to-niche migration of bone-marrow-derived cells. Trends Mol. Med.. 13, 72–81. [PubMed]
  • Konopleva M.Y., Jordan C.T., 2011. Leukemia stem cells and microenvironment: biology and therapeutic targeting. J. Clin. Oncol.. 29, 591–599. [PubMed]
  • Lane S.W., Scadden D.T., Gilliland D.G., 2009. The leukemic stem cell niche: current concepts and therapeutic opportunities. Blood. 114, 1150–1157. [PubMed]
  • Li J., 2011. Quiescence regulators for hematopoietic stem cell. Exp. Hematol.. 39, 511–520. [PubMed]
  • Matsunaga T., Takemoto N., Sato T., Takimoto R., Tanaka I., Fujimi A., Akiyama T., Kuroda H., Kawano Y., Kobune M., Kato J., Hirayama Y., Sakamaki S., Kohda K., Miyake K., Niitsu Y., 2003. Interaction between leukemic-cell VLA-4 and stromal fibronectin is a decisive factor for minimal residual disease of acute myelogenous leukemia. Nat. Med.. 9, 1158–1165. [PubMed]
  • Mizukawa B., Wei J., Shrestha M., Wunderlich M., Chou F.S., Griesinger A., Harris C.E., Kumar A.R., Zheng Y., Williams D.A., Mulloy J.C., 2011. Inhibition of Rac GTPase signaling and downstream prosurvival Bcl-2 proteins as combination targeted therapy in MLL-AF9 leukemia. Blood. 118, 5235–5245. [PubMed]
  • Muller L.U., Schore R.J., Zheng Y., Thomas E.K., Kim M.O., Cancelas J.A., Gu Y., Williams D.A., 2008. Rac guanosine triphosphatases represent a potential target in AML. Leukemia. 22, 1803–1806. [PubMed]
  • Mulloy J.C., Cancelas J.A., Filippi M.D., Kalfa T.A., Guo F., Zheng Y., 2010. Rho GTPases in hematopoiesis and hemopathies. Blood. 115, 936–947. [PubMed]
  • Puch S., Armeanu S., Kibler C., Johnson K.R., Muller C.A., Wheelock M.J., Klein G., 2001. N-cadherin is developmentally regulated and functionally involved in early hematopoietic cell differentiation. J. Cell. Sci.. 114, 1567–1577. [PubMed]
  • Rizo A., Vellenga E., de Haan G., Schuringa J.J., 2006. Signaling pathways in self-renewing hematopoietic and leukemic stem cells: do all stem cells need a niche?. Hum. Mol. Genet.. 15, (2) R210–R219. [PubMed]
  • Saito Y., Uchida N., Tanaka S., Suzuki N., Tomizawa-Murasawa M., Sone A., Najima Y., Takagi S., Aoki Y., Wake A., Taniguchi S., Shultz L.D., Ishikawa F., 2010. Induction of cell cycle entry eliminates human leukemia stem cells in a mouse model of AML. Nat. Biotechnol.. 28, 275–280. [PubMed]
  • Skorski T., Wlodarski P., Daheron L., Salomoni P., Nieborowska-Skorska M., Majewski M., Wasik M., Calabretta B., 1998. BCR/ABL-mediated leukemogenesis requires the activity of the small GTP-binding protein Rac. Proc. Natl. Acad. Sci. U. S. A.. 95, 11858–11862. [PubMed]
  • Somervaille T.C., Cleary M.L., 2006. Identification and characterization of leukemia stem cells in murine MLL-AF9 acute myeloid leukemia. Cancer Cell. 10, 257–268. [PubMed]
  • Suda T., Arai F., Hirao A., 2005. Hematopoietic stem cells and their niche. Trends Immunol.. 26, 426–433. [PubMed]
  • Sulciner D.J., Irani K., Yu Z.X., Ferrans V.J., Goldschmidt-Clermont P., Finkel T., 1996. rac1 regulates a cytokine-stimulated, redox-dependent pathway necessary for NF-kappaB activation. Mol. Cell. Biol.. 16, 7115–7121. [PubMed]
  • Tavor S., Petit I., Porozov S., Avigdor A., Dar A., Leider-Trejo L., Shemtov N., Deutsch V., Naparstek E., Nagler A., Lapidot T., 2004. CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice. Cancer Res.. 64, 2817–2824. [PubMed]
  • Thomas E.K., Cancelas J.A., Chae H.D., Cox A.D., Keller P.J., Perrotti D., Neviani P., Druker B.J., Setchell K.D., Zheng Y., Harris C.E., Williams D.A., 2007. Rac guanosine triphosphatases represent integrating molecular therapeutic targets for BCR-ABL-induced myeloproliferative disease. Cancer Cell. 12, 467–478. [PubMed]
  • Thomas E.K., Cancelas J.A., Zheng Y., Williams D.A., 2008. Rac GTPases as key regulators of p210-BCR-ABL-dependent leukemogenesis. Leukemia. 22, 898–904. [PubMed]
  • Wang J., Rao Q., Wang M., Wei H., Xing H., Liu H., Wang Y., Tang K., Peng L., Tian Z., 2009. Overexpression of Rac1 in leukemia patients and its role in leukemia cell migration and growth. Biochem. Biophys. Res. Commun.. 386, 769–774. [PubMed]
  • Wei J., Wunderlich M., Fox C., Alvarez S., Cigudosa J.C., Wilhelm J.S., Zheng Y., Cancelas J.A., Gu Y., Jansen M., Dimartino J.F., Mulloy J.C., 2008. Microenvironment determines lineage fate in a human model of MLL-AF9 leukemia. Cancer Cell. 13, 483–495. [PubMed]
  • Williams D.A., Zheng Y., Cancelas J.A., 2008. Rho GTPases and regulation of hematopoietic stem cell localization. Methods Enzymol.. 439, 365–393. [PubMed]
  • Xu Z., Greene L.A., 2006. Activation of the apoptotic JNK pathway through the Rac1-binding scaffold protein POSH. Methods Enzymol.. 406, 479–489. [PubMed]
  • Yin T., Li L., 2006. The stem cell niches in bone. J. Clin. Invest.. 116, 1195–1201. [PubMed]
  • Yoshihara H., Arai F., Hosokawa K., Hagiwara T., Takubo K., Nakamura Y., Gomei Y., Iwasaki H., Matsuoka S., Miyamoto K., Miyazaki H., Takahashi T., Suda T., 2007. Thrombopoietin/MPL signaling regulates hematopoietic stem cell quiescence and interaction with the osteoblastic niche. Cell Stem Cell. 1, 685–697. [PubMed]
  • Zhang B., Zhang Y., Shacter E., 2003. Caspase 3-mediated inactivation of rac GTPases promotes drug-induced apoptosis in human lymphoma cells. Mol. Cell. Biol.. 23, 5716–5725. [PubMed]
  • Zhang B., Zhang Y., Shacter E., 2004. Rac1 inhibits apoptosis in human lymphoma cells by stimulating Bad phosphorylation on Ser-75. Mol. Cell. Biol.. 24, 6205–6214. [PubMed]

Articles from Molecular Oncology are provided here courtesy of Wiley-Blackwell