PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of dibGuide for AuthorsAboutExplore this JournalData in Brief
 
Data Brief. 2017 October; 14: 32–34.
Published online 2017 July 11. doi:  10.1016/j.dib.2017.07.006
PMCID: PMC5526467

Transcriptome of melanoma cells from two mouse models, Tyr:NRasQ61Kand Tyr:Rack1-HA, Tyr:NRasQ61K

Abstract

The transcriptome sequencing of melanoma cells from two mouse models differing in the expression level of the scaffold protein Receptor for activated C kinase (RACK1) are presented. Primary melanoma cells were harvested from Tyr:NRasQ61K; Pax3GFP/+ mice, with or without the Tyr:Rack1-HA transgene. Cells were cultured and infected with scramble shRNA or Rack1-targeting shRNA, on technical triplicates of viral infection. Libraries were prepared by selecting polyadenylated mRNAs and RNA Sequencing (RNASeq) was performed. Samples are described in the SRA portal (SRP096162) and FASTQ files have been deposited in Sequence Read Archive (accession numbers: SRR5150106 to SRR5150117). The interpretation of these data is presented in the following research article: “RACK1 cooperates with NRASQ61K to promote melanoma in vivo” (Campagne et al., 2017, doi: 10.1016/j.cellsig.2017.03.015) [1].

Keywords: Cutaneous melanoma, RACK1, shRNA, RNAseq

Specifications Table

Table thumbnail

Value of the data

  • • These data reflect the whole transcriptome of melanoma cells from two mouse models and can be used to explore the basal RNA expression of transformed melanocytes.
  • • The data can be used to understand Rack1 modulation effect in vivo.
  • • The data can be used to gain insight into molecular mechanisms modifying latency and incidence of melanoma in mice.

1. Data

Data provided in this article correspond to the FASTQ files obtained after RNA sequencing of melanoma cells from two mouse models, treated with scramble shRNA or Rack1-targeting shRNA.

2. Experimental design, materials and methods

2.1. Cell culture and RNA interference

Melanoma cells were sampled from primary tumors of Tyr:NRasQ61K; Pax3GFP/+ mice with or without Tyr:Rack1-HA transgene. Cells were cultured as previously described [2], and RNA interference was performed with scramble shRNA (sequence GTCACTCACCCTTCGGTTATT) or a shRNA targeting exon 2 of Rack1 (sequence GGTCACTCCCACTTCGTTATT). Transduction was performed at 0.45 ng/µl of lentiviral titer in the presence of polybrene. RNAs were collected on the third day.

2.2. RNA sequencing and data analysis

RNA samples were sequenced in an Illumina HiSeq. 2500 following manufacture׳s recommendations. In brief, libraries were prepared by selecting polyadenylated mRNA using the TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA). Samples were tagged with barcode sequences for subsequent identification, amplified by PCR and quantified by qPCR using the QPCR Library Quantification Kit (Agilent Technologies, Santa Clara, CA). 4 libraries were sequenced in paired-ends 2×100 bp in three Illumina lanes. The full data sets have been submitted to NCBI Sequence Read Archive (SRA) under Accession.

Acknowledgements

This work was funded by a grant from Institut National de la Recherche Agronomique (IPRM-RACK) (INRA- Crédits incitatifs du département de génétique animale) to GE.

Footnotes

Transparency documentTransparency data associated with this article can be found in the online version at doi:10.1016/j.dib.2017.07.006.

Transparency document. Supplementary material

Supplementary material

References

1. Campagne C., Reyes-Gomez E., Picco M.E., Loiodice S., Salaun P., Ezagal J., Bernex F., Commère P.H., Pons S., Esquerre D., Bourneuf E., Estellé J., Maskos U., Lopez-Bergami P., Aubin-Houzelstein G., Panthier J.J., Egidy G. RACK1 cooperates with NRASQ61K to promote melanoma in vivo. Cell Signal. 2017 in press. [PubMed]
2. Campagne C., Reyes-Gomez E., Loiodice S., Gadin S., Ezagal J., Bernex F., Abitbol M., Louise A., Beermann F., Panthier J.J. Haplosufficiency of PAX3 for melanoma development in Tyr: NrasQ61K; Cdkn2a−/− mice allows identification and sorting of melanoma cells using a Pax3GFP reporter allele. Melanoma Res. 2016;26:12–20. [PubMed]

Articles from Data in Brief are provided here courtesy of Elsevier