PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of moloncolLink to Publisher's site
 
Mol Oncol. 2016 December; 10(10): 1532–1541.
Published online 2016 September 20. doi:  10.1016/j.molonc.2016.09.001
PMCID: PMC5423132

miRߚ634 exhibits antiߚtumor activities toward hepatocellular carcinoma via Rab1A and DHX33

Chris Zhiyi Zhang, 1 , 2 , Yun Cao, 1 , 2 , Jia Fu, 1 , 2 Jing-Ping Yun,corresponding author 1 , 2 and Mei-Fang Zhangcorresponding author 1 , 2

Abstract

Deregulation of microRNAs contributes to the aberrant growth of hepatocellular carcinoma (HCC). Here, we showed that miR‐634 expression was frequently decreased in HCC. Low miR‐634 expression was significantly associated with larger tumor size, poorer tumor differentiation, advanced TNM stage, vascular invasion, absence of tumor capsule and unfavorable overall survival. Overexpression of miR‐634 markedly attenuated cell viability, colony formation, tumor growth and metastasis, whereas miR‐634 inhibition resulted in the opposite phenotypes. Furthermore, re‐introduction of miR‐634 induced cell apoptosis in vitro and in vivo. Mechanistically, miR‐634 inhibited the expression of Rab1A and DHX33 via directly binding to the 3′‐UTR of both genes. In clinical samples, the expression of Rab1A or DHX33 was reversely correlated with miR‐634. Re‐expression of Rab1A or DHX33 abrogated the miR‐634‐mediated inhibition of cell proliferation and migration. Collectively, our data suggest a tumor suppressor role of miR‐634 in HCC. The newly identified miR‐634/Rab1A or miR‐634/DHX33 axis serves as a potential therapeutic target for the clinical management.

Keywords: miR-634, Rab1A, DHX33, Metastasis, Hepatocellular carcinoma

Highlights

  • miR‐634 expression is markedly decreased in hepatocellular carcinoma (HCC) and closely associated with poor outcomes.
  • miR‐634 overexpression attenuated the cell viability, colony formation, tumor growth and metastasis.
  • miR‐634 suppressed cell growth and metastasis by directly targeting the 3′‐UTR of Rab1A and DHX33.

1. Introduction

Deregulation of microRNAs is frequently found in human cancers (Lin and Gregory, 2015). microRNA exerts oncogene or tumor suppressor function via targeting the 3′‐UTR of genes involved in cell proliferation, apoptosis and migration (Bruce and Liu, 2014; Jonas and Izaurralde, 2015). These deregulated microRNAs participate in the initial and progression of human cancer and therefore serve as potential biomarkers for prognosis and therapeutic targets (Abba et al., 2016; Nana‐Sinkam and Croce, 2014). For example, miR‐634 has been demonstrated to suppress the progression of malignancies, such as prostate cancer (Ostling et al., 2011) and esophageal squamous cell carcinoma (Fujiwara et al., 2015). In our previous studies, miR‐625 and miR‐137 inhibited tumor metastasis in hepatocellular carcinoma (HCC) via the down‐regulation of IGF2BP1 and AKT2, respectively (Liu et al., 2014; Zhou et al., 2015).

Rab1A, a small GTPase, controls vesicle trafficking from the endoplasmic reticulum (ER) to the Golgi apparatus. Accumulating studies showed that Rab1A played an important role in human cancers. Shimada et al. reported that Rab1A was aberrant expressed in human tongue cancer (Shimada et al., 2005). Recently, Rab1A has been identified as an mTORC1 activator to promote colorectal cancer and HCC (Thomas et al., 2014; Xu et al., 2015). Rab1A is a direct target of miR‐221 and miR‐15b‐5p, and accelerated the progression of prostate cancer and HCC (Sun et al., 2014; Yang et al., 2015).

DEAH‐box helicase 33 (DHX33), a member of the DEAH box family of ATP‐dependent RNA helicases that are essential for RNA metabolism, has been implicated in the progression of human diseases. Biologically, DHX33 controls 47S rRNA transcription to modulate the biosynthesis of ribosome RNA (rRNA). DHX33 functions as a sensor for cytosolic RNA to activate the NLRP3 inflammasome, triggered by the ubiquitination of DHX33 at lysine 63 by TRIM33. Our previous study showed DHX33 expression was increased in HCC and associated with tumor progression.

In this study, miR‐634 expression and its clinical significance in HCC were determined. The role of miR‐634 and the underlying mechanism in HCC progression were investigated.

2. Materials and methods

2.1. Patients and specimens

A cohort of 130 pairs of paraffin‐embedded HCC tissues and their corresponding nontumorous liver tissues was obtained between Jan 2011 to Dec 2011 from Sun Yat‐sen University Cancer Center, Guangzhou, China. Another 31 HCC cases, along with the adjacent liver tissues and venous metastases (tumor cells that had invaded into the portal veins), were collected. None of the patients had received radiotherapy or chemotherapy before surgery. This project was approved by the Sun Yat‐sen University Cancer Center Institute Research Ethics Committee.

2.2. Cell culture and transfection

HepG2 and Bel‐7402 cells were obtained from the Cell Resource Center, Chinese Academy of Science Committee (Shanghai, China), and maintained in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Gaithersburg, MD, USA) supplemented with 10% heat‐inactivated fetal bovine serum (FBS, Hyclone, Logan, UT) in a humidified incubator at 37 °C and 5% CO2. Cells were transfected with miR‐634 mimics, inhibitor or sponge with Lipofectamine 2000, according to the instruction.

2.3. Quantitative real‐time polymerase chain reaction

Total RNA was extracted using the Trizol Reagent (Invitrogen, Carlsbad, CA, USA). For miR‐634 detection, reverse‐transcribed cDNA was synthesised with the miRCURY LNATMuniversal cDNA synthesis Kit (Exiqon, Vedbaek, Denmark). Quantitative RT‐PCR (qRT‐PCR) was performed with the miRCURY LNA TMSYBR Green master mix (Exiqon, Vedbaek, Denmark) with the Stratagene Mx3000P Real‐Time PCR system (Agilent Technologies, Inc., Santa Clara, CA, USA). Expression levels were normalised against the endogenous snRNA U6 control. The relative expression ratio of miR‐634 in HCC specimens was calculated by the −[open triangle]CT method. For mRNA analyses, cDNA was synthesised using Moloney murine leukaemia virus reverse transcriptase (Promega, Madison, WI, USA). RT‐PCR was carried out with the following cycling conditions: 95 °C for 10 min, 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s and a final extension of 10 min at 72 °C. The sequences of the PCR primers are as following: Rab1A, forward: 5′‐GGGAAAACAATCAAGCTTCAAA‐3′ and reverse: 5′‐CTGGAGGTGATTGTTCGAAAT‐3′; DHX33, forward: 5′‐TGCGTGAAGCAATTTCAGAC‐3′ and reverse: 5′‐AGGTCGACATCCATGGTAGC‐3′; β‐actin, forward: 5′‐TGGCACCCAGCACAATGAA‐3′ and reverse: 5′‐CTAAGTCATAGTCCGCCTAGA AGCA‐3′.

2.4. 3‐(4, 5‐Dimethylthiazol‐2‐yl)‐2, 5‐diphenyltetrazolium bromide and colony formation assays

Cells were seeded in 96‐well plates and cultured for 5 days. Then, 20 μl of 3‐(4,5‐dimethyl‐2‐thiazolyl)‐2,5‐diphenyl‐2‐H‐tetrazolium bromide (MTT) (5 mg/ml, AMRESCO, Solon, OH, USA) was added for 4 h at 37 °C. The formazan crystals were dissolved in DMSO (120 μl/well). The absorbance at 490 nm of each sample was measured. The cell growth rates were calculated according to the absorbance values.

2.5. Transwell assay

A total of 3 × 104 cells were re‐suspended in 200 μl of serum‐free medium and placed in the upper compartment of a Transwell chamber (Corning; 24‐well insert, pore size: 8 μm). The lower chamber was filled with 15% foetal bovine serum as a chemoattractant and incubated for 48 h for the migration assay. The cells on the upper surface of the membrane were removed, and the cells on the lower surface were fixed and stained with 0.1% crystal violet. Five visual fields of each insert were randomly chosen and counted under a light microscope.

2.6. Western blot

Total proteins were extracted and separated by 10% SEMS‐PAGE and then transferred onto PVDF membrane (Millipore, Bedford, MA). Equal amounts of protein (30 μg) were resolved by SDS‐PAGE and then electrophoretically transferred onto PVDF membranes. After blocked in 5% non‐fat milk 1 h at room temperature, the membranes were incubated with appropriately diluted primary antibodies overnight at 4 °C. After washed thrice with TBST, The blotted membranes were incubated with anti‐DHX33 antibody (1:1000, sc‐137424, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti‐DHX33 antibody (1:1000, sc‐311, Santa Cruz Biotechnology, Santa Cruz, CA, USA). The membranes were incubated with HRP‐conjugated secondary antibody at 1:20,000 dilutions for 1 h at room temperature. The membranes were visualized by the enhanced Phototope TM‐HRP Detection Kit and exposed to Kodak medical X‐ray processor (Carestream Health,USA). Anti‐GAPDH (1:1000, Santa Cruz, CA, USA) was used as a loading control.

2.7. Luciferase reporter assay

For the luciferase reporter assay, Bel‐7402 cells were co‐transfected with 20 mM miR‐634 mimic or the negative control and 500 ng of psiCHECK‐2‐Rab1A‐3′‐UTR‐WT, psiCHECK‐2‐DHX33‐3′‐UTR‐WT or corresponding mutant reporter. Cells were collected 48 h after transfection and analysed with the Dual‐Luciferase Reporter Assay System (Promega, CA, USA). Luciferase activity was detected by the GloMax fluorescence reader (Promega). The psiCHECK‐2 vector that provided the constitutive expression of Renilla luciferase was co‐transfected as an internal control.

2.8. Animal model

Male BALB/c‐nude mice (4‐weeks age, six mice per group) were subcutaneously injected with 1 × 107 cells with miR‐634 overexpression or sponge into the right flanks. Tumors formed by HCC cells were measured with calipers and calculated with the formula: Volume (mm3) = [width2 (mm2) × length (mm)]/2. At day 32, tumors were dissected and weighed. For metastasis model, approximately 5 × 105 cells were injected via the tail vein. After 6 weeks, mice were sacrificed. The lungs were fixed in 4% paraformaldehyde and stained with hematoxylin and eosin (HE). Lung metastasis was counted and quantified in random selection of high‐power fields. All animal studies were approved by the Medical Experimental Animal Care Commission of Sun Yat‐sen University Cancer Center.

2.9. Statistical analysis

Data from three separate experiments are presented as mean ± SED. The Student's t‐test was used for comparisons between groups unless otherwise noted. Kaplan–Meier analyses were used for survival analysis. Differences were considered significant for P‐values less than 0.05.

3. Results

3.1. miR‐634 expression is decreased in hepatocellular carcinoma and associated with disease progression

We have previously examined the expression profile of microRNAs in HCC tissues and their corresponding nontumorous livers (Zhou et al., 2015). miR‐634 was significantly down‐regulated in HCC tissues (Zhou et al., 2015). To further confirm the decrease of miR‐634, 130 pairs of paraffin‐embedded human primary HCC and corresponding nontumorous liver specimens were collected. We found that miR‐634 expression was markedly reduced in HCC tissues, compared with the nontumorous tissues (Figure 1A). In 36.9% (48/130) of samples, at least two‐folded reduction of miR‐634 expression in HCC tissues was noticed, whereas only 8.5% (11/130) was recorded for at least two‐folded increase (Figure 1B).

Figure 1

miR‐634 expression is decreased in HCC and associated with poor outcomes. A. Expression of miR‐634 in 130 paired HCC and the corresponding adjacent nontumorous tissues (NT) was determined (Wilcoxon match pairs test). B. Comparison of ...

The relationship between miR‐634 expression and clinicopathological features was determined. Patients with HCC were divided into high or low miR‐634 group, according to the median of miR‐634 expression. Low miR‐634 expression was closely correlated with larger tumor size (P < 0.001), worse tumor differentiation (P = 0.001), advanced TNM stage (P = 0.035), vascular invasion (P = 0.012) and absence of tumor capsule (P = 0.011) (Table 1). This suggests miR‐634 expression is associated with the aggressive HCC features and metastatic properties. We also found that miR‐634 expression was further decreased in metastatic tissues, compared the primary tumor in 31 HCC cases (Figure 1C). Kaplan–Meier analysis indicated that patients with low miR‐634 expression were likely to survive longer than those with high miR‐634 expression (Figure 1D). Collectively, these data indicate that miR‐634 was involved in the tumor progression of HCC.

Table 1

Correlation between miR‐634 expression and clinicopathological features.

3.2. miR‐634 suppresses tumor growth and metastasis in vitro and in vivo

Given that the expression of miR‐634 was closely associated with tumor progression, we next investigated the role of miR‐634 in HCC. miR‐634 mimics were stably transfected into HepG2 and Bel‐7402 cells (Figure 2A). Cell viabilities were dramatically reduced by miR‐634 overexpression (Figure 2B). miR‐634 expression was blocked by its inhibitor (Figure 2C). The inhibitory of miR‐634 resulted in a slight increase of cell proliferation in both cell lines (Figure 2D). Colony formation assay was used to further demonstrate the suppressive effect of miR‐634 on cell growth. Re‐expression of miR‐634 significantly decreased the number and size of the colonies, whereas miR‐634 inhibition enhanced the abilities of colony formation (Figure 2E). On the other hand, the activity of miR‐634 toward the cell migration in HCC was evaluated by Transwell assay. Results showed that miR‐634 re‐introduction into HCC cells led to less cell migration, but miR‐634 inhibition caused more cell migration (Figure 2F).

Figure 2

miR‐634 inhibits cell proliferation and migration in vitro. A. miR‐634 expression levels were examined in HepG2 and Bel‐7402 cells transfected with miR‐634 mimics for 24 h. B. Cell viabilities were ...

We next confirmed the inhibitory effect of miR‐634 on HCC in vivo. Compared with the control groups, tumors formed by cells with miR‐634 overexpression were much smaller and lighter, whereas tumors formed by cells with miR‐634 sponge were much bigger and heavier (Figure 3A&B). For the metastasis model, more lung nodules were found in miR‐634 inhibition group; however, almost no lung metastasis was depicted in miR‐634 overexpression group (Figure 3C and D). Collectively, our data reveal that miR‐634 is capable of suppressing tumor progression in HCC.

Figure 3

miR‐634 suppresses tumor growth and metastasis in vitro. A. HepG2 cells stably expressing miR‐634 or its sponge were injected into the right flank of null mice. The size of xenograft was measured every other day. The tumor growth ...

3.3. miR‐634 induces cell apoptosis in HCC

We next determined the potential mechanism through which miR‐634 suppressed cell growth in HCC. Hoechst 33342 staining showed that DNA fragmentation and nuclear condensation were frequently observed in miR‐634‐expressing cells (Figure 4A). Flow cytometry analysis using Annexin V/PI staining demonstrated the cell apoptosis was induced by miR‐634 overexpression in HCC cells (Figure 4B). The percentages of apoptotic cells were increased from 2.0 ± 0.5% to 20.3 ± 6.7% and 3.1 ± 0.3% to 18.9 ± 5.2%, respectively in HepG2 and Bel‐7402 cells. In xenografts, HE staining indicated more DNA fragmentation and nuclear condensation occurred in miR‐634‐expressing tumors (Figure 4C). TUNEL assays further confirmed that cell apoptosis was marked increased in tumors with miR‐634 overexpression (Figure 4C).

Figure 4

miR‐634 induces cell apoptosis in HCC. A. Cells were transfected with miR‐634 mimics for 48 h and stained with Hoechst 33342 dye. DNA fragmentation and nuclear condensation (indicated by arrows) were observed under a fluorescence ...

3.4. miR‐634 targets the 3′‐UTR of Rab1A and DHX33 in HCC

Bioinformatics analyses in three searching programs were performed to identify the targets of miR‐634. Indicated by the Venn diagram, 58 genes were revealed as the potential targets of miR‐634 (Supplementary Figure 1A). A putative binding site for miR‐634 was identified in the 3′‐UTR of Rab1A or DHX33 (Supplementary Figure 1B and C). Reporter plasmid vectors containing wild‐type or mutant seed sequence within the fragments of each 3′‐UTR were constructed. The luciferase activity of wild‐type reporter containing seed sequences of 3′‐UTR of Rab1A or DHX33 was significantly reduced by miR‐634 transfection in Bel‐7402 cells, whereas it remains unchanged in mutant reporters (Figure 5A). Overexpression of miR‐634 in HCC cells decreased, while inhibition of miR‐634 increased the mRNA levels of Rab1A and DHX33 (Figure 5B and C). Consistent with these data, the protein levels of Rab1A and DHX33 were reduced by miR‐634 re‐expression (Figure 5D). In clinical samples, the expression of miR‐634 was inversely correlated with the expression of Rab1A (r = −0.5771, P = 0.0032) and DHX33 (r = −0.5786, P = 0.0031) (Figure 5E). Taken together, we conclude that miR‐634 down‐regulates the expression of Rab1A and DHX33 by directly targeting the 3′‐UTRs.

Figure 5

miR‐634 targets Rab1A and DHX33 in HCC. A. Bel‐7402 cells were co‐transfected with miR‐634 and wild‐type or mutant Rab1A/DHX33 3′‐UTR fused to the Renilla luciferase vector. The relative firefly ...

3.5. miR‐634 inhibits cell growth by downregulation of Rab1A and DHX33

Since Rab1A and DHX33 have been reported to promote cell growth in cancer cells, we next investigated whether miR‐634 inhibits cell proliferation and migration through Rab1A and DHX33. MTT assays showed that overexpression of Rab1A or DHX33 significantly attenuated the miR‐634‐induced reduction of cell viabilities in both HepG2 and Bel‐7402 cells (Figure 6A). The abrogation of miR‐634‐mediated effect on cell proliferation by Rab1A or DHX33 was further verified by colony formation. Re‐expression of Rab1A or DHX33, to some extent, recovered the ability of colony formation in HCC cells (Figure 6B). Furthermore, the suppression of cell migration by miR‐634 was abolished by re‐introduction of Rab1A or DHX33. Transwell assays showed the migrated cells were increased in cells co‐transfected with miR‐634 and Rab1A or DHX33 (Figure 6C). Therefore, our data suggest that miR‐634 down‐regulates Rab1A and DHX33 to suppress cell growth in HCC.

Figure 6

miR‐634 exerts antitumor effects through Rab1A and DHX33. A. HepG2 and Bel‐7402 cells were transfected with empty vector, miR‐634 mimics, miR‐634 + Rab1A, or miR‐634 + DHX33 for ...

4. Discussion

Hepatocellular carcinoma (HCC) is one of the most‐lethal cancers, causing more than half a million people dead every year (Torre et al., 2015; Zhang et al., 2016). The high mortality of HCC is due to the uncontrolled growth and metastasis of cancer cells. Identification of factors that contribute to the uncontrolled growth of HCC is of significance in clinical management. Here, we showed that miR‐634 was frequently down‐regulated in HCC and associated with poor outcomes. miR‐634 exhibited anti‐HCC activities toward cell proliferation and migration by its targeting of Rab1A and DHX33. Furthermore, miR‐634 induced cell apoptosis in HCC to attenuate cell growth. Our data therefore suggest miR‐634 as a tumor suppressor in HCC and a potential biomarker for clinical therapy.

Invasion and metastasis are two independent hallmarks of cancer (Hanahan and Weinberg, 2011). The uncontrolled growth of cancer cells was majorly due to the dysregulation of factors that are of oncogenic and tumor suppressive activities. In this study, miR‐634 decrease was frequently observed in HCC and associated with malignant features, including larger tumor size, worse tumor differentiation, advanced TNM stage, vascular invasion and absence of tumor capsule. Low expression of miR‐634 was correlated with poor survival of HCC patients. This suggests miR‐634 was likely involved in HCC progression. Our in vitro and in vivo data confirmed that miR‐634 overexpression inhibited the cell proliferation and migration, whereas its inhibition led to opposite phenotypes. Östling et al. showed miR‐634 bound to the 3′‐UTR of androgen receptor (AR) and attenuated androgen‐induced proliferation of prostate cancer cells (Ostling et al., 2011). Jeansonne et al. reported that miR‐634 targeted mTOR signaling to suppress the tumor growth of glioblastoma (Jeansonne et al., 2013). Leivonen and colleagues found miR‐634 arrested breast cancer cell growth by inhibition of human epidermal growth factor receptor 2 (HER2) (Leivonen et al., 2014). Collectively, these data indicate miR‐634 serves as a tumor suppressor in human cancers.

Rab1A and DHX33 were identified as the direct targets of miR‐634 in HCC. The oncogenic characteristics of Rab1A in HCC have been illustrated. Xu et al. showed that Rab1A was frequently up‐regulated and enhanced hyperactive AA‐mTORC1 signaling to promote malignant growth and metastasis of HCC (Xu et al., 2015). Yang et al. provided evidence that Rab1A inhibition abolished cell proliferation and migration in HCC and could be targeted by miR‐15b‐5p (Yang et al., 2015). It has been shown that DHX33 depletion blocks the transforming properties of oncogenic RasV12 (Zhang et al., 2013). DHX33 silence in MEF cells led to cell cycle arrest (Zhang et al., 2011). In our previous study, DHX33 expression was significantly increased in HCC tissues, and correlated with poor outcomes (Tian et al., 2016). These data suggest DHX33 may function as an oncogene to promote cancer growth. Overexpression of miR‐634 significantly inhibited the mRNA and protein expressions of Rab1A and DHX33. In clinical samples, miR‐634 expression was significantly correlated with the expression of Rab1A and DHX33.

In this study, miR‐634 overexpression caused cell apoptosis in HCC. The ability of inducing apoptosis of miR‐634 has been confirmed in previous studies. Fujiwara et al. showed miR‐634 targeted a serial of apoptotic factors to activate mitochondrial apoptosis pathway in cancer cells (Fujiwara et al., 2015). Cong et al. found that miR‐634 overexpression induced apoptosis in cervical cancer cells by inhibitory of mTOR pathway (Cong et al., 2015). Rab1A, one of the identified targets of miR‐634 in our study, has been shown to be essential to the development of HCC. Its inhibition in HCC cells led to endoplasmic reticulum stress (ERS) and apoptosis (Yang et al., 2015). Furthermore, miR‐634 was found to be able to enhance the lethal effect of sorafenib and cisplatin on HCC cells in our study by increasing apoptotic cells (unpublished data). This is in line with other studies in nasopharyngeal carcinoma (Peng et al., 2014) and esophageal squamous cell carcinoma (Fujiwara et al., 2015). Collectively, our study suggests that miR‐634 serves as a prognostic factor, and that miR‐634 stimuli could be a potential therapeutic strategy for HCC treatment.

Conflict of interest

None.

Supporting information

The following is the supplementary data related to this article:

Supplementary Figure 1A. Venn diagram showing the potential miR‐634 targets predicted by miRDB, Targetscan and miRanda. (B, C). Putative binding site of miR‐634 and Rab1A/DHX33 was shown. Schematic of the construction of wild‐type or mutant pGL3‐Rab1A/DHX33 3′UTR vectors is indicated.

Acknowledgments

This project was supported by the National Natural Science Foundation of China (No. 81572405, 81472380 and 81301735).

1. 

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.molonc.2016.09.001.

Notes

Zhang Chris Zhiyi, Cao Yun, Fu Jia, Yun Jing-Ping, Zhang Mei-Fang, (2016), miR-634 exhibits anti-tumor activities toward hepatocellular carcinoma via Rab1A and DHX33, Molecular Oncology, 10, doi: 10.1016/j.molonc.2016.09.001.

Contributor Information

Jing-Ping Yun, nc.gro.ccusys@pjnuy.

Mei-Fang Zhang, nc.gro.ccusys@fmgnahz.

References

  • Abba M.L., Patil N., Leupold J.H., Moniuszko M., Utikal J., Niklinski J., Allgayer H., 2016. MicroRNAs as novel targets and tools in cancer therapy. Cancer Lett. 10.1016/j.canlet.2016.03.043 [PubMed]
  • Bruce J.P., Liu F.F., 2014. MicroRNAs in nasopharyngeal carcinoma. Chin J. Cancer. 33, 539–544. [PubMed]
  • Cong J., Liu R., Wang X., Jiang H., Zhang Y., 2015. MiR-634 decreases cell proliferation and induces apoptosis by targeting mTOR signaling pathway in cervical cancer cells. Artif. Cells Nanomed Biotechnol. 1–8. [PubMed]
  • Fujiwara N., Inoue J., Kawano T., Tanimoto K., Kozaki K., Inazawa J., 2015. miR-634 activates the mitochondrial apoptosis pathway and enhances chemotherapy-induced cytotoxicity. Cancer Res.. 75, 3890–3901. [PubMed]
  • Hanahan D., Weinberg R.A., 2011. Hallmarks of cancer: the next generation. Cell. 144, 646–674. [PubMed]
  • Jeansonne D., Pacifici M., Lassak A., Reiss K., Russo G., Zabaleta J., Peruzzi F., 2013. Differential effects of microRNAs on glioblastoma growth and migration. Genes (Basel). 4, 46–64. [PubMed]
  • Jonas S., Izaurralde E., 2015. Towards a molecular understanding of microRNA-mediated gene silencing. Nat. Rev. Genet.. 16, 421–433. [PubMed]
  • Leivonen S.K., Sahlberg K.K., Makela R., Due E.U., Kallioniemi O., Borresen-Dale A.L., Perala M., 2014. High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol. Oncol.. 8, 93–104. [PubMed]
  • Lin S., Gregory R.I., 2015. MicroRNA biogenesis pathways in cancer. Nat. Rev. Cancer. 15, 321–333. [PubMed]
  • Liu L.L., Lu S.X., Li M., Li L.Z., Fu J., Hu W., Yang Y.Z., Luo R.Z., Zhang C.Z., Yun J.P., 2014. FoxD3-regulated microRNA-137 suppresses tumour growth and metastasis in human hepatocellular carcinoma by targeting AKT2. Oncotarget. 5, 5113–5124. [PubMed]
  • Nana-Sinkam S.P., Croce C.M., 2014. MicroRNA regulation of tumorigenesis, cancer progression and interpatient heterogeneity: towards clinical use. Genome Biol.. 15, 445 [PubMed]
  • Ostling P., Leivonen S.K., Aakula A., Kohonen P., Makela R., Hagman Z., Edsjo A., Kangaspeska S., Edgren H., Nicorici D., Bjartell A., Ceder Y., Perala M., Kallioniemi O., 2011. Systematic analysis of microRNAs targeting the androgen receptor in prostate cancer cells. Cancer Res.. 71, 1956–1967. [PubMed]
  • Peng X., Cao P., He D., Han S., Zhou J., Tan G., Li W., Yu F., Yu J., Li Z., Cao K., 2014. MiR-634 sensitizes nasopharyngeal carcinoma cells to paclitaxel and inhibits cell growth both in vitro and in vivo. Int. J. Clin. Exp. Pathol.. 7, 6784–6791. [PubMed]
  • Shimada K., Uzawa K., Kato M., Endo Y., Shiiba M., Bukawa H., Yokoe H., Seki N., Tanzawa H., 2005. Aberrant expression of RAB1A in human tongue cancer. Br. J. Cancer. 92, 1915–1921. [PubMed]
  • Sun T., Wang X., He H.H., Sweeney C.J., Liu S.X., Brown M., Balk S., Lee G.S., Kantoff P.W., 2014. MiR-221 promotes the development of androgen independence in prostate cancer cells via downregulation of HECTD2 and RAB1A. Oncogene. 33, 2790–2800. [PubMed]
  • Thomas J.D., Zhang Y.J., Wei Y.H., Cho J.H., Morris L.E., Wang H.Y., Zheng X.F., 2014. Rab1A is an mTORC1 activator and a colorectal oncogene. Cancer Cell. 26, 754–769. [PubMed]
  • Tian Q.H., Zhang M.F., Luo R.G., Fu J., He C., Hu G., Zeng J.S., 2016. DHX33 expression is increased in hepatocellular carcinoma and indicates poor prognosis. Biochem. Biophys. Res. Commun.. 473, 1163–1169. [PubMed]
  • Torre L.A., Bray F., Siegel R.L., Ferlay J., Lortet-Tieulent J., Jemal A., 2015. Global cancer statistics, 2012. CA Cancer J. Clin.. 65, 87–108. [PubMed]
  • Xu B.H., Li X.X., Yang Y., Zhang M.Y., Rao H.L., Wang H.Y., Zheng X.F., 2015. Aberrant amino acid signaling promotes growth and metastasis of hepatocellular carcinomas through Rab1A-dependent activation of mTORC1 by Rab1A. Oncotarget. 6, 20813–20828. [PubMed]
  • Yang Y., Hou N., Wang X., Wang L., Chang S., He K., Zhao Z., Zhao X., Song T., Huang C., 2015. miR-15b-5p induces endoplasmic reticulum stress and apoptosis in human hepatocellular carcinoma, both in vitro and in vivo, by suppressing Rab1A. Oncotarget. 6, 16227–16238. [PubMed]
  • Zhang J., Zhou Z.G., Huang Z.X., Yang K.L., Chen J.C., Chen J.B., Xu L., Chen M.S., Zhang Y.J., 2016. Prospective, single-center cohort study analyzing the efficacy of complete laparoscopic resection on recurrent hepatocellular carcinoma. Chin J. Cancer. 35, 25 [PubMed]
  • Zhang Y., Forys J.T., Miceli A.P., Gwinn A.S., Weber J.D., 2011. Identification of DHX33 as a mediator of rRNA synthesis and cell growth. Mol. Cell Biol. 31, 4676–4691. [PubMed]
  • Zhang Y., Saporita A.J., Weber J.D., 2013. P19ARF and RasV(1)(2) offer opposing regulation of DHX33 translation to dictate tumor cell fate. Mol. Cell Biol. 33, 1594–1607. [PubMed]
  • Zhou X., Zhang C.Z., Lu S.X., Chen G.G., Li L.Z., Liu L.L., Yi C., Fu J., Hu W., Wen J.M., Yun J.P., 2015. miR-625 suppresses tumour migration and invasion by targeting IGF2BP1 in hepatocellular carcinoma. Oncogene. 34, 965–977. [PubMed]

Articles from Molecular Oncology are provided here courtesy of Wiley-Blackwell