PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of mbioJournal InfoAuthorsReviewersBoard of EditorsJournals ASM.orgmBiomBio Article
 
mBio. 2017 Mar-Apr; 8(2): e00102-17.
Published online 2017 March 28. doi:  10.1128/mBio.00102-17
PMCID: PMC5371409

Identification of MupP as a New Peptidoglycan Recycling Factor and Antibiotic Resistance Determinant in Pseudomonas aeruginosa

Howard A. Shuman, Editor
Howard A. Shuman, University of Chicago;

ABSTRACT

Peptidoglycan (PG) is an essential cross-linked polymer that surrounds most bacterial cells to prevent osmotic rupture of the cytoplasmic membrane. Its synthesis relies on penicillin-binding proteins, the targets of beta-lactam antibiotics. Many Gram-negative bacteria, including the opportunistic pathogen Pseudomonas aeruginosa, are resistant to beta-lactams because of a chromosomally encoded beta-lactamase called AmpC. In P. aeruginosa, expression of the ampC gene is tightly regulated and its induction is linked to cell wall stress. We reasoned that a reporter gene fusion to the ampC promoter would allow us to identify mutants defective in maintaining cell wall homeostasis and thereby uncover new factors involved in the process. A library of transposon-mutagenized P. aeruginosa was therefore screened for mutants with elevated ampC promoter activity. As an indication that the screen was working as expected, mutants with transposons disrupting the dacB gene were isolated. Defects in DacB have previously been implicated in ampC induction and clinical resistance to beta-lactam antibiotics. The screen also uncovered murU and PA3172 mutants that, upon further characterization, displayed nearly identical drug resistance and sensitivity profiles. We present genetic evidence that PA3172, renamed mupP, encodes the missing phosphatase predicted to function in the MurU PG recycling pathway that is widely distributed among Gram-negative bacteria.

IMPORTANCE

The cell wall biogenesis pathway is the target of many of our best antibiotics, including penicillin and related beta-lactam drugs. Resistance to these therapies is on the rise, particularly among Gram-negative species like Pseudomonas aeruginosa, a problematic opportunistic pathogen. To better understand how these organisms resist cell wall-targeting antibiotics, we screened for P. aeruginosa mutants defective in maintaining cell wall homeostasis. The screen identified a new factor, called MupP, involved in the recycling of cell wall turnover products. Characterization of MupP and other components of the pathway revealed that cell wall recycling plays important roles in both the resistance and the sensitivity of P. aeruginosa to cell wall-targeting antibiotics.

INTRODUCTION

Pseudomonas aeruginosa is an opportunistic Gram-negative pathogen capable of growth in diverse environments (1). In hospitals, it causes a number of serious infections (2, 3). The key drugs in our arsenal for treating these infections are the beta-lactam antibiotics, including cephalosporins, monobactams, and carbapenems, which target the biogenesis of the peptidoglycan (PG) cell wall (4). Resistance to these antibiotics is on the rise among Gram-negative bacteria like P. aeruginosa and is often associated with multidrug resistance phenotypes. A frequent mechanism of resistance to beta-lactams is overproduction of the chromosomally encoded beta-lactamase called AmpC, which inactivates penicillins, cephalosporins, and monobactams (5,8).

AmpC is a broadly distributed group I, class C cephalosporinase produced by most Enterobacteriaceae family members and many nonfermenting Gram-negative bacilli in addition to P. aeruginosa (9). In the absence of stress, AmpC production is relatively low in wild-type strains (10). However, in the presence of certain beta-lactams, such as cefoxitin (Fox) and imipenem (beta-lactamase inducers), ampC expression is highly activated (10). Although they are sensitive to hydrolysis by AmpC, antipseudomonal penicillins like piperacillin (Pip) and cephalosporins like ceftazidime (Caz) are effective because they avoid ampC induction (11). However, mutants defective in ampC regulation that constitutively produce high levels of beta-lactamase have been isolated in the clinic and can cause failures of antimicrobial therapy (7, 12,16).

The mechanism of ampC regulation is intimately connected to the PG synthesis and recycling pathways (Fig. 1) (17). PG synthesis begins in the cytoplasm with the formation of UDP–N-acetylmuramic acid (UDP-MurNAc) from UDP–N-acetylglucosamine (UDP-GlcNAc) through the action of the enzymes MurA and MurB. A pentapeptide (pep5) is added to UDP-MurNAc in several steps, forming UDP-MurNAc-pep5. The phospho-MurNAc-pep5 moiety of this intermediate is then transferred to the lipid carrier undecaprenol phosphate (Und-P), forming lipid I. GlcNAc from UDP-GlcNAc is then added to form lipid II, which is the final precursor and contains the MurNAc-pep5-GlcNAc monomeric unit of PG. After lipid II is translocated (18) to expose the disaccharide-peptide on the outer surface of the cytoplasmic membrane, it is polymerized and cross-linked into the PG layer by penicillin-binding proteins (PBPs) (19) and SEDS family proteins (20) to expand the existing matrix.

FIG 1
Simplified pathways for PG synthesis and recycling and the link to ampC regulation. (A) The PG matrix consists of glycan chains with the repeating unit of MurNAc (M) and GlcNAc (G). Attached to the MurNAc sugars is a pep5 (l-Ala-γ-d-Glu-meso-diaminopimelic ...

Far from being inert, the PG layer is constantly remodeled during cell growth. Roughly 40% of the PG layer is turned over per generation in Escherichia coli (21). The liberated fragments are primarily generated by the action of endopeptidases (EPs) that cleave the peptide cross-links and lytic transglycosylases (LTs) that cleave the sugar backbone. Rather than hydrolyzing the glycans, LTs promote the formation of 1,6-anhydro linkages in MurNAc such that the main PG degradation products released from the matrix are GlcNAc-1,6-anhMurNAc peptides (21) (Fig. 1). These anhydro-muropeptides are subsequently transported into the cytoplasm by the permease AmpG (22) and possibly AmpP in P. aeruginosa (23), where they are further broken down into their basic components by a succession of enzymes (21, 24) (Fig. 1). The glycosidase NagZ removes the GlcNAc moiety (25, 26), and the amidase AmpD removes the stem peptide from the NagZ-processed product or the incoming disaccharide (27, 28). The released peptides are further processed to tripeptides by the l,d-carboxypeptidase LdcA and reattached to UDP-MurNAc for recycling by Mpl (29, 30) (Fig. 1). Recycling of the PG sugars is carried out by one of two possible pathways in Gram-negative bacteria (Fig. 1). The first pathway was discovered in E. coli and ultimately converts GlcNAc and 1,6-anhMurNAc to glucosamine-1-phosphate (GlcN-1P) for the regeneration of UDP-GlcNAc by the de novo biosynthesis pathway involving GlmU (21, 31, 32) (Fig. 1). The second pathway was discovered recently and is more broadly conserved among Gram-negative bacteria, including P. aeruginosa (33). It uses the enzymes AmgK and MurU to more directly convert 1,6-anhMurNAc back to UDP-MurNAc, thus bypassing de novo biosynthesis (33, 34).

The main regulator of ampC expression is AmpR. In nonstressed cells, it associates with the PG precursor UDP-MurNAc-pep5 and functions as a repressor (35, 36). Beta-lactams inhibit PG cross-linking by the PBPs, causing the formation of uncross-linked glycans that are rapidly degraded by LTs into turnover products (37). The resulting accumulation of anhydro-muropeptides in the cytoplasm is thought to compete with UDP-MurNAc-pep5 for binding to AmpR and convert the regulator into an activator of ampC transcription (10, 38,41). Following AmpC production and export to the periplasm, the beta-lactam molecules are inactivated by hydrolysis and homeostasis is restored, eventually resulting in a decrease in cytoplasmic anhydro-muropeptide levels and repression of ampC (42).

Because it functions as a key sensor of PG homeostasis, we reasoned that an ampC promoter fusion to lacZ might serve as a useful tool to identify new P. aeruginosa factors involved in cell wall synthesis, repair, and recycling. To this end, we mutagenized a strain encoding a chromosomally integrated PampC::lacZ fusion (43) with a transposon and plated the resulting mutant library on plates containing X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside). Colonies displaying increased blue color, indicative of PampC::lacZ induction, were isolated, and the locations of transposon insertions in these isolates were mapped. As an indication that the screen was working as expected, mutants with transposons disrupting dacB were isolated. DacB defects have previously been implicated in ampC induction and clinical resistance to beta-lactam antibiotics (7, 14). The screen also uncovered murU and PA3172 mutants that, upon further characterization, displayed nearly identical drug resistance and sensitivity profiles. We present genetic evidence that PA3172, renamed mupP, encodes the missing phosphatase enzyme previously predicted (33) to function in the broadly distributed MurU pathway for PG recycling. Biochemical results in a parallel study by the Mayer group support this designation (44).

RESULTS

Identification of transposon mutants that induce ampC expression.

To identify new factors involved in PG homeostasis, recycling, and remodeling, we took advantage of the connection between ampC induction and cell wall stress (10, 28). A strain bearing a PampC::lacZ expression construct at the attB locus (43) was generated to search for mutants displaying a constitutive ampC induction phenotype. To test the activity of the reporter and its responsiveness to cell wall defects, we deleted the dacB gene in the reporter strain. DacB is a cell wall carboxypeptidase that trims the peptide within PG (45, 46). Its inactivation was previously shown to cause constitutive expression of ampC (7). As expected, the ΔdacB mutant reporter strain formed dark blue colonies on LB agar containing X-Gal. Reporter activity in this background was abolished upon inactivation of the AmpG permease, indicating that PampC::lacZ induction in the ΔdacB background requires the import of PG turnover products, as has been shown previously for the native ampC locus (47). On the basis of its behavior in these mutant backgrounds, we concluded that the PampC::lacZ reporter strain was functional and appropriate for use in screening for cell wall homeostasis mutants.

Cells of the reporter strain CF263 (PAO1 PampC::lacZ) were mutagenized with a transposon carrying a tetracycline (Tet) resistance cassette that was delivered by conjugation from E. coli. The resulting mutant library was then plated on agar containing X-Gal to identify constitutive PampC mutants. Colonies displaying increased blue color, indicative of lacZ induction, arose at a frequency of approximately 10−5. Following purification, isolates were grown in liquid medium to measure beta-galactosidase activity relative to that of the parental strain. The transposon insertion sites were then mapped for strains confirmed to have elevated lacZ expression. As an indication that the screen was working as expected, two mutants were isolated that each possessed a different insertion in the dacB gene. In addition to these strongly induced alleles, we also isolated mutants that formed light blue colonies on X-Gal agar and had mildly elevated beta-galactosidase activity (Fig. 2). Mapping revealed that these isolates had transposon insertions in the murU and PA3172 genes. The absence of ampD mutants (14) among our isolates indicates that the screen is not yet saturated and further screening should yield additional mutants that activate the ampC reporter.

FIG 2
PampC::lacZ expression in mupP and murU deletion strains. (A) Cultures (5 µl) of strains PAO1 (wild type [WT]), CF268 (ΔdacB mutant), CF706 (ΔanmK mutant), CF594 (ΔmupP mutant), CF600 (ΔamgK mutant), and ...

MurU is an α-1-phosphate uridyl transferase that converts MurNAc-1P to UDP-MurNAc in the Pseudomonas PG recycling pathway (33) (Fig. 1). The PA3172 gene is annotated as encoding a phosphoglycolate phosphatase, and its product was found to possess phosphatase activity against small-molecule substrates with a phosphate moiety (48). This activity of PA3172 was intriguing because a phosphatase was previously predicted to function in the MurU PG recycling pathway but has remained unidentified (33) (Fig. 1). Because of its biochemical activity and the similar PampC::lacZ induction phenotypes displayed by mutants with murU and PA3172 inactivated, we hypothesized that PA3172 may encode the missing recycling phosphatase. Results presented below and those from a parallel study by the Mayer group (44) support this hypothesis. We therefore have renamed the PA3172 gene mupP for MurNAc-6P phosphatase.

Deletion of mupP increases ampC expression and promotes beta-lactam resistance similar to other PG recycling mutants.

To confirm their involvement in ampC overexpression, in-frame deletions of murU and mupP were generated in the reporter strain along with deletions in genes coding for other members of the MurU recycling pathway (anmK and amgK). When these mutants were spotted onto agar containing X-Gal, they gave rise to zones of growth with a light blue color relative to wild-type or ΔdacB mutant cells, which appeared white or dark blue, respectively (Fig. 2A). Quantification of beta-galactosidase activity confirmed that mutants defective for mupP displayed a similar level of lacZ expression as a ΔmurU mutant strain (Fig. 2B). To monitor the effects of these mutations on native ampC induction, the set of deletions in mupP and recycling genes was also generated in an otherwise wild-type background. The deletion strains all showed elevated resistance to the antipseudomonal beta-lactams Caz and cefotaxime (Ctx), with resistance being intermediate compared to that of a ΔdacB mutant (Fig. 3A). Normal beta-lactam sensitivity was restored to ΔmurU and ΔmupP mutant cells by the expression of the corresponding gene from a plasmid (Fig. 3B), indicating that the phenotype was caused by the inactivation of MurU or MupP and was not an effect of the deletions on the expression of nearby genes. Elevated drug resistance in ΔmurU and ΔmupP mutant cells was dependent on ampC and its transcriptional regulator ampR (Fig. 4), consistent with resistance arising from ampC induction. Finally, ampC induction in the recycling mutants was confirmed by directly measuring basal levels of AmpC enzymatic activity by using the reporter substrate nitrocefin (Fig. 5). Notably, inactivation of MupP yielded a level of AmpC activity in cell extracts equivalent to that of strains with defects in the known recycling enzymes MurU, AnmK, and AmgK (Fig. 5A). These strains also retained the ability to induce high levels of AmpC production in response to treatment with the strong inducer Fox (Fig. 5B). As expected from the intermediate drug resistance phenotype, the level of induction of the recycling-defective strains was much less than that of the highly resistant ΔdacB mutant. We conclude that mutants with the MurU recycling pathway disrupted have elevated beta-lactam resistance because of ampC induction and that mutants with defects in MupP share this phenotype.

FIG 3
Beta-lactam resistance of strains with PG recycling factors deleted. (A) Cultures of strains PAO1 (wild type [WT]), CF155 (ΔdacB mutant), CF550 (ΔanmK mutant), CF592 (ΔmupP mutant), CF596 (ΔamgK mutant), and CF488 (Δ ...
FIG 4
AmpR and AmpC are required for the beta-lactam resistance phenotype of ΔmurU and ΔmupP mutant strains. Cultures of strains PAO1 (wild type [WT]), CF155 (ΔdacB) mutant, CF488 (ΔmurU mutant), CF690 (ΔmurU Δ ...
FIG 5
AmpC activity in strains with PG recycling factors deleted. Assay of nitrocefin hydrolysis by cells of PAO1 (wild type [WT]), CF155 (ΔdacB mutant), CF550 (ΔanmK mutant), CF592 (ΔmupP mutant), CF596 (ΔamgK mutant), and CF488 ...

MupP-defective strains are Fos hypersensitive.

Strains with the recycling gene murU, amgK or anmK inactivated were previously shown to be hypersensitive to the antibiotic fosfomycin (Fos) (33, 34). This drug targets MurA activity and thus blocks the conversion of UDP-GlcNAc into UDP-MurNAc as part of the de novo PG precursor synthesis pathway (Fig. 1) (49). A functional MurU pathway bypasses MurA in the conversion of cell wall turnover products into UDP-MurNAc (Fig. 1). It therefore reduces the need for MurA activity, thereby increasing Fos resistance. We reasoned that if MupP is indeed part of the MurU pathway, its inactivation should also result in Fos hypersensitivity. Plating of serial dilutions of ΔmupP mutant cells on LB agar with or without Fos revealed a hypersensitivity phenotype that mimicked that of mutants with other components of the MurU pathway deleted (Fig. 6A). As with a murU mutant, normal Fos resistance was restored to the ΔmupP mutant strain by expression of the mupP gene in trans from a plasmid (Fig. 6B). This result reinforces the phenotypic similarity of ΔmupP mutant cells and mutants with changes in known components of the MurU recycling pathway.

FIG 6
Fos sensitivity of a ΔmupP mutant. (A) Cultures of strains PAO1 (wild type [WT]), CF155 (ΔdacB mutant), CF550 (ΔanmK mutant), CF592 (ΔmupP mutant), CF596 (ΔamgK mutant), and CF488 (ΔmurU mutant) were serially ...

Expression of mupP allows reconstitution of the full MurU pathway in E. coli.

E. coli lacks the MurU pathway and is therefore relatively sensitive to Fos. Instead, it uses the MurQ enzyme to convert MurNAc-6P to GlcNAc-6P for reentry into the de novo pathway (Fig. 1). In a ΔmurQ mutant, MurNAc recycling is blocked at MurNAc-6P. The Mayer group was previously able to partially reconstitute the P. putida MurU pathway in an E. coli ΔmurQ mutant, as assessed by increased Fos resistance (33). They did so by expressing amgK and murU from a plasmid. Because the MurNAc-6P phosphatase remained unidentified at the time, Fos resistance was only restored by supplying MurNAc in the medium for uptake and entry into the pathway. This result suggested that the E. coli ΔmurQ mutant cells were unable to process endogenous MurNAc-6P for use in the recycling pathway by amgK and murU. Thus, if MupP is indeed the MurNAc-6P phosphatase in the MurU pathway, coexpression of mupP with amgK and murU in E. coli ΔmurQ mutant cells should result in increased Fos resistance without the need for externally added MurNAc. Indeed, expression of wild-type mupP in conjunction with amgK and murU promoted increased Fos resistance to E. coli ΔmurQ mutant cells. Increased resistance was not observed when mupP was expressed alone or when a predicted MupP catalytic mutant protein, MupP(D12A) (48), was produced in tandem with AmgK and MurU (Fig. 7). On the basis of these results and the similar phenotypes displayed by mupP mutants and mutants defective in PG recycling, we conclude that MupP is the missing phosphatase acting in the MurU pathway. Consistent with this conclusion, MupP is co-conserved with AmgK and MurU in a range of proteobacteria but absent in others like the enterobacteria that lack the MurU pathway (Fig. 8).

FIG 7
Reconstitution of the complete MurU pathway in E. coli. E. coli strain CF752 (MG1655 ΔmurQ) harboring pUC18 (vector) or pCF436 (Plac::amgK-murU) along with the compatible vector pCF826 (Plac::mupP) or pCF836 (Plac::mupP[D12A]), ...
FIG 8
Phylogenetic tree showing AnmK, MupP, AmgK, and MurU protein occurrence and co-conservation. The phylogenetic tree shown was constructed with iTOL (55) and a diversity set of 1,773 strains. The names of the relevant bacterial classes, orders, or families ...

DISCUSSION

Many Gram-negative bacteria encode an inducible AmpC beta-lactamase that provides resistance to beta-lactam antibiotics (42). The ampC gene is normally repressed by AmpR when cell wall biogenesis is proceeding normally but is expressed when an elevated level of PG turnover products accumulates in the cytoplasm as a result of a beta-lactam-induced block in PG cross-linking (35,37). Thus, expression of ampC is tuned to respond when the balance of cell wall synthesis and degradation is upset. We therefore employed a lacZ reporter fused to the ampC promoter in P. aeruginosa to screen for mutants with PG homeostasis defects with the goal of identifying new factors involved in the process. The screen was successful and identified mupP (PA3172), a gene of previously unknown function, as encoding a new enzyme involved in PG recycling.

Recycling of PG turnover products in Gram-negative bacteria is carried out by one of two possible pathways, (i) the MurQ pathway used by E. coli and its relatives, in which the sugars of PG turnover products are funneled back into the de novo PG precursor synthesis pathway, or (ii) the MurU pathway, which more directly converts MurNAc from PG turnover products to UDP-MurNAc and bypasses de novo synthesis (Fig. 1) (33). Transposon insertion or mupP deletion mutant strains displayed ampC induction phenotypes that were identical to those of mutants defective for MurU and other members of the MurU pathway. Additionally, co-expression of mupP with murU and amgK was sufficient to reconstitute the MurU pathway in E. coli, which is normally reliant on the MurQ pathway and de novo synthesis. On the basis of these results, we conclude that MupP is likely to be the missing MurNAc-6P phosphatase enzyme previously predicted to be functioning in the MurU pathway (33). In support of this designation, the Mayer group has biochemically characterized MupP from Pseudomonas putida (44). They report in a parallel study that MupP specifically hydrolyzes MurNAc-6P to MurNAc in vitro. What remains unclear is why the MurU pathway converts MurNAc-6P to MurNAc before the AmgK kinase adds a phosphate back to form MurNAc-1P. In theory, the conversion of MurNAc-6P to MurNAc-1P could easily be catalyzed in a single step by a sugar phosphomutase. We therefore speculate that the less efficient pathway involving MupP and the formation of unphosphorylated MurNAc is likely to have additional physiological roles beyond PG recycling. Further studies are required to determine if and why the production of a steady-state pool of MurNAc might be beneficial for bacteria that utilize the MurU PG recycling pathway.

Mutants with the PG recycling enzyme AmpD or the PG remodeling factor DacB inactivated have previously been identified as ampC inducers (7, 13, 14). Defects in either enzyme are thought to promote the accumulation in the cytoplasm of anhMurNAc peptides, which convert AmpR to an activator of ampC expression. A blockade in PG sugar recycling by the MurU pathway has not previously been implicated in ampC induction or elevated beta-lactam resistance. The mechanism by which inactivation of the MurU pathway stimulates increased ampC expression is not known. However, it seems unlikely that the failure to recycle the MurNAc sugars would prevent proper peptide cleavage from anhMurNAc peptides by AmpD such that the inducers would accumulate appreciably to activate AmpR. Instead, we favor the idea that inhibition of the MurU pathway reduces the steady-state level of UDP-MurNAc-pep5 because of limitations in UDP-MurNAc production. Because UDP-MurNAc-pep5 competes with anhMurNAc-pep5 for binding to AmpR (35), decreased UDP-MurNAc-pep5 levels would alter the repressor/activator ratio and allow basal levels of anhMurNAc-pep5 to associate with AmpR to activate ampC expression and promote beta-lactam resistance. Although additional experimentation is required to test this hypothesis, the Fos hypersensitivity caused by inactivation of the MurU pathway is consistent with a defect in UDP-MurNAc production in mutant cells.

The identification of a new cell wall recycling factor by the PampC::lacZ reporter screen validates the utility of this approach for uncovering novel players involved in the maintenance of cell wall homeostasis in P. aeruginosa and likely other Gram-negative bacteria. The screen reported here was not saturated, suggesting that additional PG biogenesis factors will be discovered upon continued screening. The identification and characterization of such factors will add to our growing understanding of the mechanisms by which bacteria build and maintain their cell wall and help us identify vulnerabilities in the process to exploit for antibiotic targeting.

MATERIALS AND METHODS

Media, bacterial strains, and plasmids.

P. aeruginosa PAO1 cells were grown in LB (1% tryptone, 0.5% yeast extract, 0.5% NaCl). When necessary, the medium was supplemented with 1 mM IPTG (isopropyl-β-d-thiogalactopyranoside), 5% sucrose, or 50 µg/ml X-Gal. For plasmid maintenance or integration, gentamicin (Gm) and Tet were used at a concentration of 50 μg/ml. For AmpC beta-lactamase induction, Fox was used at a concentration of 50 μg/ml. Unless otherwise indicated, antibiotics for viability/sensitivity assays were used at 25 (Fos), 4 (Caz), or 25 (Ctx) μg/ml.

E. coli cells were grown in LB. When necessary, the medium was supplemented with 100 μM IPTG. Unless otherwise indicated, the antibiotic concentrations used for E. coli were 25 (chloramphenicol and kanamycin), 10 (Gm), and 2 (Fos) μg/ml. The bacterial strains and plasmids used in this study are listed in Tables S1 to S3 in the supplemental material. Detailed descriptions of the strain and plasmid construction procedures can be found in Text S1.

10.1128/mBio.00102-17.2

TABLE S1 

P. aeruginosa strains used in this study. Download TABLE S1, PDF file, 0.05 MB.

Copyright © 2017 Fumeaux and Bernhardt.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
10.1128/mBio.00102-17.3

TABLE S2 

E. coli strains used in this study. Download TABLE S2, PDF file, 0.1 MB.

Copyright © 2017 Fumeaux and Bernhardt.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
10.1128/mBio.00102-17.4

TABLE S3 

Plasmids used in this study. Download TABLE S3, PDF file, 0.1 MB.

Copyright © 2017 Fumeaux and Bernhardt.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
10.1128/mBio.00102-17.1

TEXT S1 

Supplemental methods and references. Download TEXT S1, PDF file, 0.2 MB.

Copyright © 2017 Fumeaux and Bernhardt.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Viability assays.

For viability assays with P. aeruginosa or E. coli, overnight cell cultures were normalized to an optical density at 600 nm (OD600) of 0.05 and subjected to serial 10-fold dilution. Five-microliter volumes of the 10−1 through 10−6 dilutions were then spotted onto the indicated agar and incubated at 30°C (P. aeruginosa) or 37°C (E. coli) for ~24 h prior to imaging. Fos MICs was determined by the broth microdilution method. Overnight cell cultures were normalized to an OD600 of 0.0005 in LB and different concentrations of Fos and grown for ~24 h at 30°C. The MIC was defined as the lowest concentration that inhibited growth.

Screening for mutants that induce ampC expression.

P. aeruginosa strain CF263 (PAO1 [PampC::lacZ]) was transposon mutagenized by mating with the E. coli donor SM10(λpir) harboring mariner transposon delivery vector pIT2 (50). The transposon confers Tet resistance. Mating mixtures were plated on LB agar supplemented with Tet (50 µg/ml) to select for transposon mutants and nalidixic acid (25 µg/ml) to select against the E. coli donor. The resulting collection of colonies was resuspended in LB broth and stored at −80°C. Dilutions of the library were plated on LB containing X-Gal (40 µg/ml) to identify mutants with a constitutively active PampC::lacZ reporter. The screen was not saturated, as indicated by the absence of ampD mutants among the isolates identified. We are therefore continuing to mine the library for additional mutants that induce the PampC::lacZ reporter.

Mapping of transposon insertion sites.

Transposon insertions were mapped by arbitrarily primed PCR (50). Transposon-chromosomal DNA junctions were amplified from mutant chromosomal DNA with primers Rnd1-PA (5′ GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT 3′) and LacZ211 (5′ TGC GGG CCT CTT CGC TAT TA 3′). The resulting PCR was used for a second PCR with primers Rnd2-PA (5′ GGCCACGCGTCGACTAGTAC 3′) and LacZ148 (5′ GGG TAA CGC CAG GGT TTT CC 3′). The final PCR product was sequenced with transposon-specific primer LacZ-124L (5′ CAG TCA CGA CGT TGT AAA ACG ACC). The transposon-chromosomal DNA junction was identified in the sequencing reads by a nucleotide BLAST search (51) against the PAO1 genome (52).

β-Galactosidase assays.

β-Galactosidase assays were performed at room temperature. Cells from 100 μl of culture at an OD600 of 0.1 to 0.6 were lysed with 30 μl of chloroform and mixed with 700 μl of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4 heptahydrate). Each reaction mixture then received 200 μl of o-nitrophenyl-β-d-galactopyranoside (4 mg/ml in 0.1 M KPO4, pH 7.0), and the reaction was timed. When a medium yellow color developed, the reaction was stopped with 400 μl of 1 M Na2CO3. The OD420 of the supernatant was determined, and the units of activity were calculated with the equation U = (OD420 × 1,000)/[OD660 [center dot] time (in minutes) [center dot] volume of culture (in milliliters)].

AmpC beta-lactamase activity assay.

AmpC activity was assessed by nitrocefin hydrolysis. Overnight bacterial cultures were subcultured 1:20 in 3 ml of LB and grown for 2 h at 30°C and 200 rpm. Cultures were split 1:1 in 2 ml of LB with or without 50 μg/ml (final concentration) Fox and incubated for an additional 1.5 h at 30°C and 200 rpm. Following incubation, 1 ml of culture was pelleted at 2,300 × g for 5 min, washed once with 1 ml of 50 mM sodium phosphate buffer (pH 7.0), and resuspended in 1 ml of the same cold buffer. Samples were placed on ice and lysed at 4°C by sonication with a microprobe (Q800R2; QSonica, Newtown, CT). Sonicated samples were centrifuged at 12,000 × g for 5 min at 4°C, and supernatants were collected. The protein concentration was determined with a Bradford assay (53) with bovine serum albumin (BSA) as the standard (G-Biosciences/Geno Technology Inc., Saint Louis, MO). Nitrocefin hydrolysis assays were performed with 96-well plates. Each reaction mixture had a final volume of 250 μl of 50 mM sodium phosphate buffer (pH 7.0) containing 10 μg of protein and 20 μg of nitrocefin (Thermo Fischer Scientific Oxoid, Waltham, MA). Nitrocefin hydrolysis was monitored by measuring the absorbance at 486 nm every 5 min for 2 h at 30°C.

Phylogenetic analysis.

A phylogenetic tree showing the distribution of the MurU pathway proteins and MurQ in a diverse set of 1,773 bacterial taxa was constructed. The amino acid sequences of all of the members of the MurU pathway, AnmK, and MurQ were used as queries in a BLASTp search against the NCBI nonredundant database (54) with an E value cutoff of 10−26. A list of all of the taxa for which significant BLAST results were found was then sorted. We used a complex and diverse set of 1,773 bacterial taxa called representative genomes that is available on NCBI (ftp://ftp.ncbi.nlm.nih.gov/blast/db/, Representative_Genomes.00.tar.gz). The phylogenetic tree was constructed with PhyloT (http://phylot.biobyte.de/), and BLASTp results were plotted against the tree. The occurrence of a MupP protein is indicated by red, that of MurU is indicated by green, that of Amgk is indicated by blue, that of AnmK is indicated by purple, and that of MurQ is indicated by yellow. The tree was visualized and annotated with iToL (http://itol.embl.de/) (55).

ACKNOWLEDGMENTS

We thank all of the members of the Bernhardt and Rudner labs for advice and helpful discussions. Special thanks to Christoph Mayer and his group for communicating their results prior to publication and for coordinating the submission of manuscripts with us. Special thanks to Stephen Lory and Simon Dove for help with P. aeruginosa methods and for providing strains and expert advice.

This work was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health (R33 AI111713 and R01 AI083365). C.F. was supported in part by a postdoctoral fellowship from the Swiss National Science Foundation (project P2GEP3_162073). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Footnotes

For a companion article on this topic, see https://doi.org/10.1128/mBio.00092-17.

Citation Fumeaux C, Bernhardt TG. 2017. Identification of MupP as a new peptidoglycan recycling factor and antibiotic resistance determinant in Pseudomonas aeruginosa. mBio 8:e00102-17. https://doi.org/10.1128/mBio.00102-17.

REFERENCES

1. Silby MW, Winstanley C, Godfrey SAC, Levy SB, Jackson RW 2011. Pseudomonas genomes: diverse and adaptable. FEMS Microbiol Rev 35:652–680. doi:.10.1111/j.1574-6976.2011.00269.x [PubMed] [Cross Ref]
2. Obritsch MD, Fish DN, MacLaren R, Jung R 2004. National surveillance of antimicrobial resistance in Pseudomonas aeruginosa isolates obtained from intensive care unit patients from 1993 to 2002. Antimicrob Agents Chemother 48:4606–4610. doi:.10.1128/AAC.48.12.4606-4610.2004 [PMC free article] [PubMed] [Cross Ref]
3. Leibovici L, Shraga I, Drucker M, Konigsberger H, Samra Z, Pitlik SD 1998. The benefit of appropriate empirical antibiotic treatment in patients with bloodstream infection. J Intern Med 244:379–386. doi:.10.1046/j.1365-2796.1998.00379.x [PubMed] [Cross Ref]
4. Mesaros N, Nordmann P, Plésiat P, Roussel-Delvallez M, Van Eldere J, Glupczynski Y, Van Laethem Y, Jacobs F, Lebecque P, Malfroot A, Tulkens PM, Van Bambeke F 2007. Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millennium. Clin Microbiol Infect 13:560–578. doi:.10.1111/j.1469-0691.2007.01681.x [PubMed] [Cross Ref]
5. Lister PD, Wolter DJ, Hanson ND 2009. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin Microbiol Rev 22:582–610. doi:.10.1128/CMR.00040-09 [PMC free article] [PubMed] [Cross Ref]
6. Cabot G, Ocampo-Sosa AA, Tubau F, Maciá MD, Rodríguez C, Moya B, Zamorano L, Suárez C, Peña C, Martínez-Martínez L, Oliver A, Spanish Network for Research in Infectious Diseases (REIPI) 2011. Overexpression of AmpC and efflux pumps in Pseudomonas aeruginosa isolates from bloodstream infections: prevalence and impact on resistance in a Spanish multicenter study. Antimicrob Agents Chemother 55:1906–1911. doi:.10.1128/AAC.01645-10 [PMC free article] [PubMed] [Cross Ref]
7. Moya B, Dötsch A, Juan C, Blázquez J, Zamorano L, Haussler S, Oliver A 2009. Beta-lactam resistance response triggered by inactivation of a nonessential penicillin-binding protein. PLoS Pathog 5:e1000353. doi:.10.1371/journal.ppat.1000353 [PMC free article] [PubMed] [Cross Ref]
8. Juan C, Moyá B, Pérez JL, Oliver A 2006. Stepwise upregulation of the Pseudomonas aeruginosa chromosomal cephalosporinase conferring high-level beta-lactam resistance involves three AmpD homologues. Antimicrob Agents Chemother 50:1780–1787. doi:.10.1128/AAC.50.5.1780-1787.2006 [PMC free article] [PubMed] [Cross Ref]
9. Bush K, Jacoby GA, Medeiros AA 1995. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother 39:1211–1233. doi:.10.1128/AAC.39.6.1211 [PMC free article] [PubMed] [Cross Ref]
10. Fisher JF, Mobashery S 2014. The sentinel role of peptidoglycan recycling in the β-lactam resistance of the Gram-negative Enterobacteriaceae and Pseudomonas aeruginosa. Bioorg Chem 56:41–48. doi:.10.1016/j.bioorg.2014.05.011 [PMC free article] [PubMed] [Cross Ref]
11. Livermore DM. 1995. Beta-lactamases in laboratory and clinical resistance. Clin Microbiol Rev 8:557–584. [PMC free article] [PubMed]
12. Giwercman B, Lambert PA, Rosdahl VT, Shand GH, Høiby N 1990. Rapid emergence of resistance in Pseudomonas aeruginosa in cystic fibrosis patients due to in-vivo selection of stable partially derepressed beta-lactamase producing strains. J Antimicrob Chemother 26:247–259. doi:.10.1093/jac/26.2.247 [PubMed] [Cross Ref]
13. Juan C, Gutiérrez O, Oliver A, Ayestarán JI, Borrell N, Pérez JL 2005. Contribution of clonal dissemination and selection of mutants during therapy to Pseudomonas aeruginosa antimicrobial resistance in an intensive care unit setting. Clin Microbiol Infect 11:887–892. doi:.10.1111/j.1469-0691.2005.01251.x [PubMed] [Cross Ref]
14. Juan C, Maciá MD, Gutiérrez O, Vidal C, Pérez JL, Oliver A 2005. Molecular mechanisms of beta-lactam resistance mediated by AmpC hyperproduction in Pseudomonas aeruginosa clinical strains. Antimicrob Agents Chemother 49:4733–4738. doi:.10.1128/AAC.49.11.4733-4738.2005 [PMC free article] [PubMed] [Cross Ref]
15. Livermore DM. 1987. Clinical significance of beta-lactamase induction and stable derepression in Gram-negative rods. Eur J Clin Microbiol 6:439–445. doi:.10.1007/BF02013107 [PubMed] [Cross Ref]
16. Moyá B, Beceiro A, Cabot G, Juan C, Zamorano L, Alberti S, Oliver A 2012. Pan-β-lactam resistance development in Pseudomonas aeruginosa clinical strains: molecular mechanisms, penicillin-binding protein profiles, and binding affinities. Antimicrob Agents Chemother 56:4771–4778. doi:.10.1128/AAC.00680-12 [PMC free article] [PubMed] [Cross Ref]
17. Typas A, Banzhaf M, Gross CA, Vollmer W 2011. From the regulation of peptidoglycan synthesis to bacterial growth and morphology. Nat Rev Microbiol 10:123–136. doi:.10.1038/nrmicro2677 [PubMed] [Cross Ref]
18. Sham LT, Butler EK, Lebar MD, Kahne D, Bernhardt TG, Ruiz N 2014. Bacterial cell wall. MurJ is the flippase of lipid-linked precursors for peptidoglycan biogenesis. Science 345:220–222. doi:.10.1126/science.1254522 [PMC free article] [PubMed] [Cross Ref]
19. Sauvage E, Kerff F, Terrak M, Ayala JA, Charlier P 2008. The penicillin-binding proteins: structure and role in peptidoglycan biosynthesis. FEMS Microbiol Rev 32:234–258. doi:.10.1111/j.1574-6976.2008.00105.x [PubMed] [Cross Ref]
20. Cho H, Wivagg CN, Kapoor M, Barry Z, Rohs PDA, Suh H, Marto JA, Garner EC, Bernhardt TG 19 September 2016. Bacterial cell wall biogenesis is mediated by SEDS and PBP polymerase families functioning semi-autonomously. Nat Microbiol doi:.10.1038/nmicrobiol.2016.172 [PMC free article] [PubMed] [Cross Ref]
21. Park JT, Uehara T 2008. How bacteria consume their own exoskeletons (turnover and recycling of cell wall peptidoglycan). Microbiol Mol Biol Rev 72:211–227, table of contents. doi:.10.1128/MMBR.00027-07 [PMC free article] [PubMed] [Cross Ref]
22. Cheng Q, Park JT 2002. Substrate specificity of the AmpG permease required for recycling of cell wall anhydro-muropeptides. J Bacteriol 184:6434–6436. doi:.10.1128/JB.184.23.6434-6436.2002 [PMC free article] [PubMed] [Cross Ref]
23. Kong KF, Aguila A, Schneper L, Mathee K 2010. Pseudomonas aeruginosa β-lactamase induction requires two permeases, AmpG and AmpP. BMC Microbiol 10:328. doi:.10.1186/1471-2180-10-328 [PMC free article] [PubMed] [Cross Ref]
24. Johnson JW, Fisher JF, Mobashery S 2013. Bacterial cell-wall recycling. Ann N Y Acad Sci 1277:54–75. doi:.10.1111/j.1749-6632.2012.06813.x [PMC free article] [PubMed] [Cross Ref]
25. Cheng Q, Li H, Merdek K, Park JT 2000. Molecular characterization of the beta-N-acetylglucosaminidase of Escherichia coli and its role in cell wall recycling. J Bacteriol 182:4836–4840. doi:.10.1128/JB.182.17.4836-4840.2000 [PMC free article] [PubMed] [Cross Ref]
26. Vötsch W, Templin MF 2000. Characterization of a beta-N-acetylglucosaminidase of Escherichia coli and elucidation of its role in muropeptide recycling and beta-lactamase induction. J Biol Chem 275:39032–39038. doi:.10.1074/jbc.M004797200 [PubMed] [Cross Ref]
27. Höltje JV, Kopp U, Ursinus A, Wiedemann B 1994. The negative regulator of beta-lactamase induction AmpD is a N-acetyl-anhydromuramyl-l-alanine amidase. FEMS Microbiol Lett 122:159–164. doi:.10.1111/j.1574-6968.1994.tb07159.x [PubMed] [Cross Ref]
28. Jacobs C, Joris B, Jamin M, Klarsov K, Van Beeumen J, Mengin-Lecreulx D, van Heijenoort J, Park JT, Normark S, Frère JM 1995. AmpD, essential for both beta-lactamase regulation and cell wall recycling, is a novel cytosolic N-acetylmuramyl-l-alanine amidase. Mol Microbiol 15:553–559. doi:.10.1111/j.1365-2958.1995.tb02268.x [PubMed] [Cross Ref]
29. Mengin-Lecreulx D, van Heijenoort J, Park JT 1996. Identification of the mpl gene encoding UDP-N-acetylmuramate: l-alanyl-gamma-d-glutamyl-meso-diaminopimelate ligase in Escherichia coli and its role in recycling of cell wall peptidoglycan. J Bacteriol 178:5347–5352. doi:.10.1128/jb.178.18.5347-5352.1996 [PMC free article] [PubMed] [Cross Ref]
30. Templin MF, Ursinus A, Höltje JV 1999. A defect in cell wall recycling triggers autolysis during the stationary growth phase of Escherichia coli. EMBO J 18:4108–4117. doi:.10.1093/emboj/18.15.4108 [PubMed] [Cross Ref]
31. Mengin-Lecreulx D, van Heijenoort J 1994. Copurification of glucosamine-1-phosphate acetyltransferase and N-acetylglucosamine-1-phosphate uridyltransferase activities of Escherichia coli: characterization of the glmU gene product as a bifunctional enzyme catalyzing two subsequent steps in the pathway for UDP-N-acetylglucosamine synthesis. J Bacteriol 176:5788–5795. doi:.10.1128/jb.176.18.5788-5795.1994 [PMC free article] [PubMed] [Cross Ref]
32. Mengin-Lecreulx D, van Heijenoort J 1993. Identification of the glmU gene encoding N-acetylglucosamine-1-phosphate uridyltransferase in Escherichia coli. J Bacteriol 175:6150–6157. doi:.10.1128/jb.175.19.6150-6157.1993 [PMC free article] [PubMed] [Cross Ref]
33. Gisin J, Schneider A, Nägele B, Borisova M, Mayer C 2013. A cell wall recycling shortcut that bypasses peptidoglycan de novo biosynthesis. Nat Chem Biol 9:491–493. doi:.10.1038/nchembio.1289 [PubMed] [Cross Ref]
34. Borisova M, Gisin J, Mayer C 2014. Blocking peptidoglycan recycling in Pseudomonas aeruginosa attenuates intrinsic resistance to fosfomycin. Microb Drug Resist 20:231–237. doi:.10.1089/mdr.2014.0036 [PMC free article] [PubMed] [Cross Ref]
35. Vadlamani G, Thomas MD, Patel TR, Donald LJ, Reeve TM, Stetefeld J, Standing KG, Vocadlo DJ, Mark BL 2015. The β-lactamase gene regulator AmpR is a tetramer that recognizes and binds the d-Ala-d-Ala motif of its repressor UDP-N-acetylmuramic acid (MurNAc)-pentapeptide. J Biol Chem 290:2630–2643. doi:.10.1074/jbc.M114.618199 [PMC free article] [PubMed] [Cross Ref]
36. Jacobs C, Frère JM, Normark S 1997. Cytosolic intermediates for cell wall biosynthesis and degradation control inducible beta-lactam resistance in Gram-negative bacteria. Cell 88:823–832. doi:.10.1016/S0092-8674(00)81928-5 [PubMed] [Cross Ref]
37. Cho H, Uehara T, Bernhardt TG 2014. Beta-lactam antibiotics induce a lethal malfunctioning of the bacterial cell wall synthesis machinery. Cell 159:1300–1311. doi:.10.1016/j.cell.2014.11.017 [PMC free article] [PubMed] [Cross Ref]
38. Lindquist S, Galleni M, Lindberg F, Normark S 1989. Signalling proteins in enterobacterial AmpC beta-lactamase regulation. Mol Microbiol 3:1091–1102. doi:.10.1111/j.1365-2958.1989.tb00259.x [PubMed] [Cross Ref]
39. Jacobs C, Huang LJ, Bartowsky E, Normark S, Park JT 1994. Bacterial cell wall recycling provides cytosolic muropeptides as effectors for beta-lactamase induction. EMBO J 13:4684–4694. [PubMed]
40. Lee M, Dhar S, De Benedetti S, Hesek D, Boggess B, Blázquez B, Mathee K, Mobashery S 2016. Muropeptides in Pseudomonas aeruginosa and their role as elicitors of β-lactam-antibiotic resistance. Angew Chem Int Ed Engl 55:6882–6886. doi:.10.1002/anie.201601693 [PMC free article] [PubMed] [Cross Ref]
41. Dik DA, Domínguez-Gil T, Lee M, Hesek D, Byun B, Fishovitz J, Boggess B, Hellman LM, Fisher JF, Hermoso JA, Mobashery S 2017. Muropeptide binding and the X-ray structure of the effector domain of the transcriptional regulator AmpR of Pseudomonas aeruginosa. J Am Chem Soc 139:1448–1451. doi:.10.1021/jacs.6b12819 [PubMed] [Cross Ref]
42. Jacoby GA. 2009. AmpC beta-lactamases. Clin Microbiol Rev 22:161–182, table of contents. doi:.10.1128/CMR.00036-08 [PMC free article] [PubMed] [Cross Ref]
43. Caille O, Zincke D, Merighi M, Balasubramanian D, Kumari H, Kong KF, Silva-Herzog E, Narasimhan G, Schneper L, Lory S, Mathee K 2014. Structural and functional characterization of Pseudomonas aeruginosa global regulator AmpR. J Bacteriol 196:3890–3902. doi:.10.1128/JB.01997-14 [PMC free article] [PubMed] [Cross Ref]
44. Borisova M, Gisin J, Mayer C 2017. The N-acetylmuramic acid 6-phosphate phosphatase MupP completes the Pseudomonas peptidoglycan recycling pathway leading to intrinsic fosfomycin resistance. mBio 8:e00092-17. doi:.10.1128/mBio.00092-17 [PMC free article] [PubMed] [Cross Ref]
45. Korat B, Mottl H, Keck W 1991. Penicillin-binding protein 4 of Escherichia coli: molecular cloning of the dacB gene, controlled overexpression, and alterations in murein composition. Mol Microbiol 5:675–684. doi:.10.1111/j.1365-2958.1991.tb00739.x [PubMed] [Cross Ref]
46. Lee M, Hesek D, Blázquez B, Lastochkin E, Boggess B, Fisher JF, Mobashery S 2015. Catalytic spectrum of the penicillin-binding protein 4 of Pseudomonas aeruginosa, a nexus for the induction of β-lactam antibiotic resistance. J Am Chem Soc 137:190–200. doi:.10.1021/ja5111706 [PMC free article] [PubMed] [Cross Ref]
47. Zamorano L, Reeve TM, Juan C, Moyá B, Cabot G, Vocadlo DJ, Mark BL, Oliver A 2011. AmpG inactivation restores susceptibility of pan-beta-lactam-resistant Pseudomonas aeruginosa clinical strains. Antimicrob Agents Chemother 55:1990–1996. doi:.10.1128/AAC.01688-10 [PMC free article] [PubMed] [Cross Ref]
48. Chan WY, Wong M, Guthrie J, Savchenko AV, Yakunin AF, Pai EF, Edwards EA 2010. Sequence- and activity-based screening of microbial genomes for novel dehalogenases. Microb Biotechnol 3:107–120. doi:.10.1111/j.1751-7915.2009.00155.x [PMC free article] [PubMed] [Cross Ref]
49. Kahan FM, Kahan JS, Cassidy PJ, Kropp H 1974. The mechanism of action of fosfomycin (phosphonomycin). Ann N Y Acad Sci 235:364–386. doi:.10.1111/j.1749-6632.1974.tb43277.x [PubMed] [Cross Ref]
50. Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, Will O, Kaul R, Raymond C, Levy R, Chun-Rong L, Guenthner D, Bovee D, Olson MV, Manoil C 2003. Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 100:14339–14344. doi:.10.1073/pnas.2036282100 [PubMed] [Cross Ref]
51. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ 1990. Basic local alignment search tool. J Mol Biol 215:403–410. doi:.10.1016/S0022-2836(05)80360-2 [PubMed] [Cross Ref]
52. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, Olson MV 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959–964. doi:.10.1038/35023079 [PubMed] [Cross Ref]
53. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. doi:.10.1016/0003-2697(76)90527-3 [PubMed] [Cross Ref]
54. Pruitt KD, Tatusova T, Maglott DR 2005. NCBI reference sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res 33:D501–D504. doi:.10.1093/nar/gki025 [PMC free article] [PubMed] [Cross Ref]
55. Letunic I, Bork P 2011. Interactive Tree of Life v2: online annotation and display of phylogenetic trees made easy. Nucleic Acids Res 39:W475–W478. doi:.10.1093/nar/gkr201 [PMC free article] [PubMed] [Cross Ref]

Articles from mBio are provided here courtesy of American Society for Microbiology (ASM)