PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jcmPermissionsJournals.ASM.orgJournalJCM ArticleJournal InfoAuthorsReviewers
 
J Clin Microbiol. 2017 February; 55(2): 442–449.
Published online 2017 January 25. Prepublished online 2016 November 23. doi:  10.1128/JCM.01970-16
PMCID: PMC5277513

Superiority of Digital Reverse Transcription-PCR (RT-PCR) over Real-Time RT-PCR for Quantitation of Highly Divergent Human Rhinoviruses

Alexander J. McAdam, Editor
Alexander J. McAdam, Boston Children's Hospital;

ABSTRACT

Human rhinoviruses (HRV) comprise 3 species representing more than 150 genotypes. As an important human respiratory pathogen, molecular detection is an indispensable tool for diagnosis and surveillance. However, the sequence diversity of HRV genotypes poses challenges for developing robust molecular methods that detect all genotypes with equal efficiencies. This study compares the accuracies of reverse transcription-quantitative PCR (RT-qPCR) and reverse transcription-digital PCR (RT-dPCR) for quantifying HRV RNA using genotype-specific primers and probes and a consensus primer/probe set targeting the 5′ noncoding region of HRV. When using consensus primers and probes for the quantification of HRV, RT-dPCR outperformed RT-qPCR by consistently and accurately quantifying HRV RNAs across more genotype groups, despite the presence of up to 2 target-sequence mismatches within the primer or probe binding region. Because it does not rely on amplification efficiency, which can be affected by sequence mismatches in primer/probe binding regions, RT-dPCR may be the optimal molecular method for future HRV quantification studies and for quantitating other viruses with high sequence diversity.

KEYWORDS: human rhinovirus, digital PCR, qPCR

INTRODUCTION

Human rhinoviruses (HRV) are important human respiratory pathogens that are small positive-sense RNA viruses within the family Picornaviridae. There are more than 150 genotypes of HRV that have been recognized within species A, B, and C of the genus Enterovirus (1). Molecular assays, such as reverse-transcription PCR (RT-PCR), are the most useful methods for detecting HRV in clinical samples (2,4). Most HRV RT-PCR assays target the conserved 5′ noncoding region (NCR), which exhibits the greatest sequence homology among the HRV genotypes. However, even in the 5′ NCR, consensus primer and probe sets must be designed with degenerate and modified bases or multiple oligonucleotides to amplify all HRV genotypes (5,7).

Although qualitative detection of HRV by RT-PCR is currently sufficient for determining HRV infection, accurate quantification of HRV RNA in clinical samples is needed for studies associating HRV viral load with viral transmission and with patient symptoms and outcomes. Viral load studies of other respiratory viruses have shown that a correlation exists between viral load and disease severity (8,10). Accurate quantification of HRV will also be required for evaluating the performances of future antiviral drugs. Real-time RT-PCR assays, when accompanied by the amplification of standard curves (RT-qPCR), can be used to quantify the number of viral copies in a sample. However, RT-qPCR assays using quantification with a consensus HRV primer and probe set may not give accurate results for all genotypes due to amplification inefficiencies caused by base mismatches between the primer and probe sequences and the specific viral sequences (11). Digital PCR (dPCR), which quantifies nucleic acids independently of a standard curve and is less affected by PCR efficiency (12, 13), may perform better for quantifying HRV RNA by RT-PCR.

The aim of this study was to investigate the best method for quantifying HRV RNA in clinical specimens. The efficiency and sensitivity of a consensus RT-qPCR assay were compared with those of genotype-specific RT-qPCR assays to determine if consensus RT-qPCR accurately quantifies all genotypes of HRV, including those with sequence differences in the primer and probe binding regions of the consensus assay. Also, to determine if consensus RT-dPCR is more accurate for quantifying all HRV genotypes than is consensus RT-qPCR, we compared quantification results from RT-dPCR with those from RT-qPCR for known amounts of RNA from different HRV genotypes using a consensus set of HRV primers and probe targeting the 5′ NCR.

RESULTS

Amplification of RNA transcripts by RT-qPCR and RT-dPCR using genotype-specific and consensus primers and probes.

HRV RNA transcripts from each of the 16 genotype sequence groups were tested with the genotype-specific primer/probe sets and the consensus primer/probe set by RT-qPCR and RT-dPCR. When the results from type-specific and consensus primer/probe sets were compared in RT-qPCR assays of the transcripts, the genotype-specific assays were more sensitive for HRV detection than were the consensus assays for 5 of the 16 HRV genotype groups (F, I, N, R, and U) using a 10-fold or greater difference in sensitivity as the threshold (Table 1 and Fig. 1). The consensus and genotype-specific RT-qPCR assays showed equivalent sensitivities for ten genotype groups, while the consensus assay was more sensitive than the genotype-specific assay for 1 genotype group (J) (Table 1). However, the RT-dPCR genotype-specific and consensus primer/probe sets performed similarly on all but one of the 16 HRV genotype groups (group N) (Fig. 2). The number of sequence mismatches between the consensus primers and probe and the 16 HRV genotypes ranged from 0 to 2 (Fig. 3 and Table 1). Single mismatches in the forward primer binding region resulted in losses of sensitivity up to 2 logs, depending on the location of the mismatch.

TABLE 1
RT-qPCR LLODs of HRV RNA transcripts by genotype sequence group and number of Con mismatches
FIG 1
Analysis of HRV RNA transcripts by RT-qPCR. RT-qPCR of HRV RNA transcripts for 6 genotype groups (A, F, I, N, R, and U) with consensus (black squares) and genotype-specific (gray circles) primer/probe sets. PCR threshold cycle (CT) values (y axes) are ...
FIG 2
Analysis of HRV RNA transcripts by RT-dPCR. RT-dPCR of HRV RNA transcripts for 6 genotype groups (A, F, I, N, R, and U). HRV log copies/μl with the consensus primer/probe set (y axes) are plotted against the log copies/μl with the genotype-specific ...
FIG 3
Human rhinovirus consensus primer and probe sequences and mismatches for 16 genotype sequence groups within the 5′ NCR.

Amplification of clinical samples by RT-qPCR and RT-dPCR using consensus primers and probe.

We determined the HRV viral loads in RNA extracted from clinical samples positive for 55 different HRV genotypes by RT-qPCR using genotype-specific primers and probe and compared the results with the viral loads determined when amplified by consensus RT-qPCR and RT-dPCR. For clinical samples containing HRV genotypes with sequences that closely matched the consensus primer and probe sequences (e.g., genotype groups A, B, C, and D), quantifications of HRV RNA by RT-qPCR and RT-dPCR performed with the consensus primers and probe showed good agreement with the viral load determined by genotype-specific RT-qPCR (Fig. 4). In contrast, for some HRV genotypes with 1 to 2 mismatches within the consensus primer and probe sequences, RT-qPCR performed using these primers and probe underestimated the viral load by up to 2 logs (Fig. 4). Strikingly, RT-dPCR with the consensus primer/probe set provided more accurate quantifications than did consensus RT-qPCR on multiple samples, particularly within genotype groups I, R, and U (Fig. 4). Four samples within genotype groups I, R, and U showed a ≥1 log improvement in quantitation by RT-dPCR compared with that by RT-qPCR. The viral loads of clinical samples ranged from 0.85 log10 to 7.6 log10 copies with a median of 4.47 log10 copies, and the improvement in quantitation was observed on samples that had viral loads ranging from 0.85 log10 to 5.77 log10 copies.

FIG 4
Analyses of HRV clinical specimens by RT-qPCR and RT-dPCR. The consensus primer/probe set was used in RT-qPCR (black squares) and RT-dPCR (gray circles) on multiple clinical specimens representing genotype sequence groups A, B, C, D, E, I, L, M, R, and ...

DISCUSSION

Although infections with HRV can be determined using qualitative RT-PCR, an accurate quantification method is needed to determine if HRV viral load is associated with viral transmission and pathogenicity and with patient symptoms and outcomes, as has been shown for other respiratory viruses. HRV viral load determinations may also be important for patient management, especially in asymptomatic patients who test positive for HRV at low levels. More importantly, accurate HRV viral load assessments will be necessary for evaluating the performances of potential HRV antiviral drugs. The quantification of HRV by RT-qPCR assays using type-specific primers and probes is accurate. However, these assays must be used on samples for which the HRV genotype is known so that the appropriate primers and probe and standard curve can be included. In this study, we investigated the accuracy of quantifying HRV by RT-qPCR when consensus primers and probes were used and compared the results to those from RT-dPCR.

We showed that the consensus RT-qPCR accurately quantified many HRV genotypes. However, these data also demonstrated that RT-qPCR using consensus primers and probe did not accurately quantify all genotypes of HRV, especially HRV species C, due to the suboptimal amplification of genotypes with sequences that did not exactly match those of the primers and probe. When using consensus primers and probe for quantifying HRV, RT-dPCR outperformed RT-qPCR by consistently and accurately quantifying HRV RNAs across more genotypes. Although we tested a large number of HRV genotypes representing most of the types with sequence mismatches in the consensus primer and probe binding regions, not all HRV genotypes were tested, especially the HRV species C genotypes. Some did not have 5′ NCR sequences available, and for some genotypes, positive specimens were not available for testing. However, the data from 16 genotype sequence groups that represent sequences of 128 genotypes indicated that RT-dPCR quantification of HRV RNA will be useful in future HRV viral quantification studies. The typical workflow for RT-dPCR requires more hands-on technician time than do current RT-qPCR clinical workflows. However, the tradeoff for greater accuracy with only a single consensus primer/probe set offsets the extra few hours in run-time. A final limitation of RT-dPCR in comparison with RT-qPCR is the more limited dynamic range (104 for RT-qPCR compared with 108 for RT-qPCR). However, we did not need to dilute any of the 55 clinical samples tested here to obtain the concentration ranges required for the RT-dPCR assay, so this is not expected to be a major issue.

In this study, we use type-specific and consensus primers and probes to test known copy numbers of a large number of HRV genotypes that represent most of the sequence variation found in the consensus primer and probe binding region. In comparison, other reports on the quantification of HRV used only consensus RT-qPCR assays, quantified from standard curves generated from a single HRV genotype, and tested a limited number of HRV genotypes (14,16). Nevertheless, our findings confirm the results from some of these studies and show that assay quantification ability is linked to target variability and that accurate HRV quantification by a single RT-qPCR assay is not feasible for all HRV genotypes (17, 18).

The sequence diversity of HRV and the availability of well-characterized 5′ NCR target sequences for over 50 genotypes provide a good model for testing the hypothesis that dPCR is more recalcitrant to sequence mismatches within primers and probe than is qPCR. It has been theorized that dPCR is less susceptible to amplification inefficiency caused by primer/probe sequence mismatches because the quantification is derived from a PCR that cycles to endpoint rather than from an amplification curve as in qPCR (13, 19). Until now, there have been limited empirical data to support this hypothesis. However, these HRV data clearly support the aforementioned hypothesis and demonstrate dPCR's advantage in cases of primer/probe sequence mismatch.

However, it should be noted that dPCR did not overcome all sequence mismatch-induced amplification inefficiencies, as evidenced by genotype sequence group N (Fig. 2), which has a single mismatch near the middle of the forward primer. Clearly, the number of mismatches is not a perfect predictor of the amplification inhibition. Other genotype sequence groups with more mismatches than genotype group N did not show amplification inhibition by RT-dPCR. It is likely that the effect of a sequence mismatch on amplification is highly context dependent, given that the 5′ NCR region of HRV harbors significant RNA secondary structure (20). Nonetheless, dPCR is a better alternative to qPCR on templates known to have significant sequence diversity that cannot be avoided during primer and probe design. dPCR should be considered the optimal molecular method for quantifying HRV in clinical specimens and may be applicable to other viruses with high sequence diversity, such as HIV and hepatitis B virus (HBV).

MATERIALS AND METHODS

Type-specific and consensus primers and probes were used in RT-qPCR and RT-dPCR assays for quantifying known genotypes of HRV, including RNA transcripts of specific HRV amplicons and clinical specimens containing whole virus. For consensus RT-PCR, a previously designed HRV primer and probe set was used (5): forward primer, CPY+AGCC+TGCGTGGY; reverse primer, GAAACACGGACACCCAAAGTA; probe, 5′-FAM-TCCTCCGGCCCCTGAATGYGGC-BHQ. The 5′ NCR region sequences for all species A and B HRV and for 43 of 55 species C HRV were aligned and placed into 22 groups according to their sequence homologies to the consensus primers and probe (Table 2 and Fig. 3). For type-specific RT-PCR, 13 primer and probe sets were designed to match the specific sequences within the consensus primer and probe binding regions for 16 of the 22 HRV genotype groups (Table 2). Samples containing representative HRV genotypes from the other 6 genotype groups were not available for testing and therefore were not included in our analysis.

TABLE 2
HRV genotype sequence groups and RT-PCR genotype-specific primer and probe sequences

The 10 different type-specific forward primers were synthesized with T7 polymerase promoter sequences on the 5′ ends. RNA extracted from samples positive for a representative HRV genotype from each of the 16 genotype groups, including 14 serotyped HRV culture isolates and 2 sequenced clinical samples (groups R and U) (Table 2), was reverse transcribed into cDNA and amplified by conventional PCR using the type-specific T7 polymerase promoter-labeled forward primer and type-specific reverse primer. The purified type-specific amplicons were then transcribed into RNA (T7 Megashort script kit; Life Technologies). The type-specific RNA transcripts were purified and quantified as previously described (21) and used to generate standard curves for RT-qPCR. Dilutions of the 16 transcripts (10 to 1e7 copies/reaction for RT-qPCR and 1e2 to 1e6 copies/reaction for RT-dPCR) were amplified using the genotype-specific primers and probes and the consensus primers and probe in one-step RT-qPCR (AgPath one-step RT-PCR; Life Technologies) and one-step RT-dPCR (One-step RT-ddPCR advanced kit; Bio-Rad) assays. Different ranges of quantified viral transcript were used in qPCR versus dPCR to account for the different dynamic ranges of the two assay platforms. RT-qPCR was performed as previously described (5) except that the PCR annealing temperature was lowered to 50°C or 55°C when using the type-specific primers. RT-dPCR was performed as previously described on the QX100 droplet digital PCR instrument (Bio-Rad Laboratories, Hercules, CA), with One-step RT-ddPCR advanced mix replacing the ddPCR Supermix for probes (22, 23) and with the following reaction conditions: 50°C for 60 min, 95°C for 10 min, 40 cycles of 95°C for 30 s and 60°C for 1 min, followed by 98°C for 10 min. The forward and reverse primers were at final concentrations of 500 nM and the probe was at a final concentration of 100 nM. The lower limits of detection (LLOD) were determined for the RT-qPCR consensus and genotype-specific assays by running 8 to 16 PCR replicates of serial dilutions in the lower range of transcripts (10 to 10,000 copies/reaction) and determining a 95% cutoff by probit analysis.

For RT-qPCR and RT-dPCR, HRV RNA was extracted from 60 clinical samples (52 swabs and 8 culture isolates) positive for 55 known HRV genotypes representing the 16 genotype groups (identified by serotyping or sequencing and including 29 species A, 12 species B, and 14 species C) with the Total nucleic acid high performance kit on a MagnaPure LC 2.0 (Roche Diagnostics, Indianapolis, IN). HRV RNA was quantified by RT-qPCR using genotype-specific primers and probes and genotype-specific standard curves. The quantities of HRV RNA in each sample were then compared after quantification by RT-qPCR and RT-dPCR using the consensus primers and probe. The accuracy of RT-qPCR compared with that of RT-dPCR was assessed by determining which assay gave values within at least 1 log10 of the expected value determined by genotype-specific RT-qPCR.

ACKNOWLDEGMENTS

R.H.S. has consulted for Bio-Rad Laboratories on projects unrelated to this article.

REFERENCES

1. Gern JE. 2010. The ABCs of rhinoviruses, wheezing, and asthma. J Virol 84:7418–7426. doi:.10.1128/JVI.02290-09 [PMC free article] [PubMed] [Cross Ref]
2. Mahony JB, Petrich A, Smieja M 2011. Molecular diagnosis of respiratory virus infections. Crit Rev Clin Lab Sci 48:217–249. doi:.10.3109/10408363.2011.640976 [PubMed] [Cross Ref]
3. Buller RS. 2013. Molecular detection of respiratory viruses. Clin Lab Med 33:439–460. doi:.10.1016/j.cll.2013.03.007 [PubMed] [Cross Ref]
4. Jacobs SE, Lamson DM, St George K, Walsh TJ 2013. Human rhinoviruses. Clin Microbiol Rev 26:135–162. doi:.10.1128/CMR.00077-12 [PMC free article] [PubMed] [Cross Ref]
5. Lu X, Holloway B, Dare RK, Kuypers J, Yagi S, Williams JV, Hall CB, Erdman DD 2008. Real-time reverse transcription-PCR assay for comprehensive detection of human rhinoviruses. J Clin Microbiol 46:533–539. doi:.10.1128/JCM.01739-07 [PMC free article] [PubMed] [Cross Ref]
6. Faux CE, Arden KE, Lambert SB, Nissen MD, Nolan TM, Chang AB, Sloots TP, Mackay IM 2011. Usefulness of published PCR primers in detecting human rhinovirus infection. Emerg Infect Dis 17:296–298. doi:.10.3201/eid1702.101123 [PMC free article] [PubMed] [Cross Ref]
7. Sikazwe CT, Chidlow GR, Imrie A, Smith DW 2016. Reliable quantification of rhinovirus species C using real-time PCR. J Virol Methods 235:65–72. doi:.10.1016/j.jviromet.2016.05.014 [PubMed] [Cross Ref]
8. Roussy JF, Carbonneau J, Ouakki M, Papenburg J, Hamelin M, De Serres G, Boivin G 2014. Human metapneumovirus viral load is an important risk factor for disease severity in young children. J Clin Virol 60:133–140. doi:.10.1016/j.jcv.2014.03.001 [PubMed] [Cross Ref]
9. Li CC, Wang L, Eng HL, You HL, Chang LS, Tang KS, Lin YJ, Kuo HC, Lee IK, Liu JW, Huang EY, Yang KD 2010. Correlation of pandemic (H1N1) 2009 viral load with disease severity and prolonged viral shedding in children. Emerg Infect Dis 16:1265–1272. doi:.10.3201/eid1608.091918 [PMC free article] [PubMed] [Cross Ref]
10. DeVincenzo JP, Wilkinson T, Vaishnaw A, Cehelsky J, Meyers R, Nochur S, Harrison L, Meeking P, Mann A, Moane E, Oxford J, Pareek R, Moore R, Walsh E, Studholme R, Dorsett P, Alvarez R, Lambkin-Williams R 2010. Viral load drives disease in humans experimentally infected with respiratory syncytial virus. Am J Respir Crit Care Med 182:1305–1314. doi:.10.1164/rccm.201002-0221OC [PMC free article] [PubMed] [Cross Ref]
11. Hoffman NG, Cook L, Atienza EE, Limaye AP, Jerome KR 2008. Marked variability of BK virus load measurement using quantitative real-time PCR among commonly used assays. J Clin Microbiol 46:2671–2680. doi:.10.1128/JCM.00258-08 [PMC free article] [PubMed] [Cross Ref]
12. Hindson BJ, Ness KD, Masquelier DA, Belgrader P, Heredia NJ, Makarewicz AJ, Bright IJ, Lucero MY, Hiddessen AL, Legler TC, Kitano TK, Hodel MR, Petersen JF, Wyatt PW, Steenblock ER, Shah PH, Bousse LJ, Troup CB, Mellen JC, Wittmann DK, Erndt NG, Cauley TH, Koehler RT, So AP, Dube S, Rose KA, Montesclaros L, Wang S, Stumbo DP, Hodges SP, Romine S, Milanovich FP, White HE, Regan JF, Karlin-Neumann GA, Hindson CM, Saxonov S, Colston BW 2011. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal Chem 83:8604–8610. doi:.10.1021/ac202028g [PMC free article] [PubMed] [Cross Ref]
13. Hall Sedlak R, Jerome KR 2014. The potential advantages of digital PCR for clinical virology diagnostics. Expert Rev Mol Diagn 14:501–507. doi:.10.1586/14737159.2014.910456 [PubMed] [Cross Ref]
14. Xiao Q, Zheng S, Zhou L, Ren L, Xie X, Deng Y, Tian D, Zhao Y, Fu Z, Li T, Huang A, Liu E 2015. Impact of human rhinovirus types and viral load on the severity of illness in hospitalized children with lower respiratory tract infections. Pediatr Infect Dis J 34:1187–1192. doi:.10.1097/INF.0000000000000879 [PubMed] [Cross Ref]
15. Esposito S, Daleno C, Scala A, Castellazzi L, Terranova L, Sferrazza Papa S, Longo MR, Pelucchi C, Principi N 2014. Impact of rhinovirus nasopharyngeal viral load and viremia on severity of respiratory infections in children. Eur J Clin Microbiol Infect Dis 33:41–48. doi:.10.1007/s10096-013-1926-5 [PubMed] [Cross Ref]
16. Esposito D, Chatterjee DK 2006. Enhancement of soluble protein expression through the use of fusion tags. Curr Opin Biotechnol 17:353–358. doi:.10.1016/j.copbio.2006.06.003 [PubMed] [Cross Ref]
17. McLeish NJ, Witteveldt J, Clasper L, McIntyre C, McWilliam Leitch EC, Hardie A, Bennett S, Gunson R, Carman WF, Feeney SA, Coyle PV, Vipond B, Muir P, Benschop K, Wolthers K, Waris M, Osterback R, Johannessen I, Templeton K, Harvala H, Simmonds P 2012. Development and assay of RNA transcripts of enterovirus species A to D, rhinovirus species A to C, and human parechovirus: assessment of assay sensitivity and specificity of real-time screening and typing methods. J Clin Microbiol 50:2910–2917. doi:.10.1128/JCM.01172-12 [PMC free article] [PubMed] [Cross Ref]
18. Schibler M, Yerly S, Vieille G, Docquier M, Turin L, Kaiser L, Tapparel C 2012. Critical analysis of rhinovirus RNA load quantification by real-time reverse transcription-PCR. J Clin Microbiol 50:2868–2872. doi:.10.1128/JCM.06752-11 [PMC free article] [PubMed] [Cross Ref]
19. Vynck M, Trypsteen W, Thas O, Vandekerckhove L, De Spiegelaere W 2016. The future of digital polymerase chain reaction in virology. Mol Diagn Ther 20:437–447. doi:.10.1007/s40291-016-0224-1 [PubMed] [Cross Ref]
20. Bochkov YA, Grindle K, Vang F, Evans MD, Gern JE 2014. Improved molecular typing assay for rhinovirus species A, B, and C. J Clin Microbiol 52:2461–2471. doi:.10.1128/JCM.00075-14 [PMC free article] [PubMed] [Cross Ref]
21. Kuypers J, Wright N, Morrow R 2004. Evaluation of quantitative and type-specific real-time RT-PCR assays for detection of respiratory syncytial virus in respiratory specimens from children. J Clin Virol 31:123–129. doi:.10.1016/j.jcv.2004.03.018 [PubMed] [Cross Ref]
22. Sedlak RH, Cook L, Huang ML, Magaret A, Zerr DM, Boeckh M, Jerome KR 2014. Identification of chromosomally integrated human herpesvirus 6 by droplet digital PCR. Clin Chem 60:765–772. doi:.10.1373/clinchem.2013.217240 [PMC free article] [PubMed] [Cross Ref]
23. Sedlak RH, Cook L, Cheng A, Magaret A, Jerome KR 2014. Clinical utility of droplet digital PCR for human cytomegalovirus. J Clin Microbiol 52:2844–2848. doi:.10.1128/JCM.00803-14 [PMC free article] [PubMed] [Cross Ref]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)