PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Free Radic Biol Med. Author manuscript; available in PMC 2018 January 1.
Published in final edited form as:
PMCID: PMC5209302
NIHMSID: NIHMS831558

Ammonia Promotes Endothelial Cell Survival via the Heme Oxygenase-1-Mediated Release of Carbon Monoxide

Abstract

Although endothelial cells produce substantial quantities of ammonia during cell metabolism, the physiologic role of this gas in these cells is not known. In this study, we investigated if ammonia regulates the expression of heme oxygenase-1 (HO-1), and if this enzyme influences the biological actions of ammonia on endothelial cells. Exogenously administered ammonia, given as ammonium chloride or ammonium hydroxide, or endogenously generated ammonia stimulated HO-1 protein expression in cultured human and murine endothelial cells. Dietary supplementation of ammonia also induced HO-1 protein expression in murine arteries. The increase in HO-1 protein by ammonia in endothelial cells was first detected 4 hours after ammonia exposure and was associated with the induction of HO-1 mRNA, enhanced production of reactive oxygen species (ROS), and increased expression and activity of NF-E2-related factor-2 (Nrf2). Ammonia also activated the HO-1 promoter and this was blocked by mutating the antioxidant responsive element or by overexpressing dominant-negative Nrf2. The induction of HO-1 expression by ammonia was dependent on ROS formation and prevented by N-acetylcysteine or rotenone. Finally, prior treatment of endothelial cells with ammonia inhibited tumor necrosis factor-α -stimulated cell death. However, silencing HO-1 expression abrogated the protective action of ammonia and this was reversed by the administration of carbon monoxide but not bilirubin or iron. In conclusion, this study demonstrates that ammonia stimulates the expression of HO-1 in endothelial cells via the ROS-Nrf2 pathway, and that the induction of HO-1 contributes to the cytoprotective action of ammonia by generating carbon monoxide. Moreover, it identifies ammonia as a potentially important signaling gas in the vasculature that promotes endothelial cell survival.

Keywords: ammonia, endothelial cells, heme oxygenase-1, carbon monoxide, cytoprotection

Graphical Abstract

An external file that holds a picture, illustration, etc.
Object name is nihms831558f8.jpg

Introduction

Ammonia is a colorless, pungent, and diffusable gas that plays a central role in nitrogen metabolism [1]. Ammonia is continuously produced during cell metabolism from the breakdown of purines, pyrimidines, polyamines, and the deamination of several amino acids. It is also produced by urease-producing bacteria present in the saliva and gastrointestinal tract [2,3]. Ammonia plays an important physiologic role in the body as it provides usable forms of nitrogen required for the synthesis of DNA, RNA, and proteins. In addition, ammonia regulates whole body acid-base balance through its excretion by the kidney [4]. The liver is the major site of ammonia degradation where ammonia is principally metabolized to urea via the hepatic urea cycle or, alternatively, converted to glutamine by glutamine synthetase [5]. Disturbances in ammonia metabolism secondary to liver disease or inborn errors of the urea cycle leading to hyperammonemia are of pathological importance and may cause neurological diseases and hepatic encephalopathy [6,7].

Recently, endogenously produced ammonia has been suggested to function as a signaling gas much like nitric oxide [8]. Indeed, a signaling role for ammonia has emerged in the brain where pathophysiologically relevant concentrations of this gas stimulate the production of reactive oxygen species (ROS), the activation of mitogen-activated protein kinase and phosphatidylinositol-3-kinase, and the nitration, S-nitrosylation, and O-GlcNAcylation of proteins, which collectively contributes to ammonia-mediated alterations in brain cell function and viability [913]. However, the actions of ammonia are not restricted to the central nervous system. Ammonia exerts important actions in the cardiovascular system where it dilates human cerebrovascular smooth muscle and regulates cardiac function [14,15]. While physiological or low concentrations of ammonia elicit positive inotropic effects in isolated perfused hearts, high concentrations of the gas had a toxic effect. Interestingly, endothelial cells generate substantial amounts of ammonia via the catabolism of glutamine by the enzyme glutaminase [1618]. Abundant glutaminase activity has been detected in endothelial cells, resulting in high rates of ammonia synthesis that are dependent on extracellular glutamine levels. Nevertheless, the functional significance of this gas in these cells is not known.

The endothelium plays a critical role in maintaining vascular homeostasis by regulating vascular tone, thrombosis, vascular permeability, and inflammation. Significantly, loss and/or dysfunction of endothelial cells contribute to the development of vascular disease and its attendant clinical complications (19). Recently, heme oxygenase-1 (HO-1) has emerged as a key protein that protects against vascular disease, in part, by promoting endothelial cell viability and function [see 2022]. HO-1 is a highly inducible enzyme that cleaves heme at the α-methene bridge to generate carbon monoxide (CO), iron, and biliverdin, which is subsequently reduced by biliverdin reductase to bilirubin. The induction of HO-1 by various forms of cellular stress provides an effective defense mechanism against endothelial cell injury [2326]. The cytoprotection afforded by HO-1 involves multiple mechanisms, including the catabolism of toxic free heme to the antioxidants biliverdin and bilirubin, and the generation of CO which possesses potent anti-apoptotic properties [2527].

Interestingly, ammonia has been demonstrated to stimulate the expression of HO-1 in rat cerebral endothelial cells [28]; however, the signaling pathway responsible for inducing HO-1 expression as well as the functional significance of this observation remains to be established. In the present study, we characterized the interaction between ammonia and HO-1 in vascular endothelium. We now show that ammonia, either exogenously administered or endogenously produced, also stimulates the expression of HO-1 in human umbilical vein endothelial cells (HUVECs) and murine aortic endothelial cells (MAECs) and smooth muscle cells (MASMCs). In addition, we found that in vivo administration of ammonia induces the expression of HO-1 in murine arteries. Significantly, we determined that the induction of HO-1 occurs via the activation of the ROS-NF-E2-related factor-2 (Nrf2) signaling cascade. Moreover, we discovered that ammonia protects against endothelial cell death via the HO-1-mediated generation of CO. These findings establish ammonia as novel regulator of endothelial cell survival, and identify important new regulatory and functional interactions between signaling gases in the vasculature.

Methods and Materials

Materials

Ammonium chloride (NH4Cl), heparin, trypan blue, agarose, trypsin, Tris, HEPES, N-acetyl-L-cysteine (NAC), cycloheximide, penicillin, L-glutamine, gelatin, streptomycin, Nonidet P40, dithiothreitol, bromophenol blue, SDS, NaCl, EDTA, DMSO, glycerol, matrigel, and Triton X-100, were from Sigma–Aldrich (St. Louis, MO). Ammonium hydroxide (NH4OH) was from Fischer Scientific (Houston, TX). Phenylmethylsulfonyl fluoride (PMSF), aprotinin, leupeptin, and pepstatin A were from Roche Applied Sciences (Indianapolis, IN). M199 medium, bovine calf serum, 5-(and-6)-chloromethyl-2,7-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA), and lipofectamine were from Invitrogen Corporation (Carlsbad, CA). LY294002 was from Calbiochem (La Jolla, CA). Tumor necrosis factor-α (TNFα) was from Genzyme (Boston, MA). Endothelial cell growth factor was from Becton Dickinson (Bedford, MA). A polyclonal antibody against HO-1 was from Assay Designs (Ann Arbor, MI, USA), antibodies against Nrf2, platelet-endothelial cell adhesion molecule-1 (PECAM-1), and β-actin were from Santa Cruz (Santa Cruz, CA), and antibodies against glycogen synthase kinase-3β (GSK3β) and phospho (ser-9)-GSK3β (GSK3β-P) were from Cell Signaling Technologies (Danvers, MA). [32P]dCTP (3000Ci/mmol) was from Amersham (Arlington Heights, IL).

Cell culture

HUVECs were purchased from Lonza Incorporated (Allendale, NJ) and propagated on gelatin-coated plates in M199 medium supplemented with 20% bovine calf serum, 2mM L-glutamine, 50µg/ml endothelial cell growth factor, 90µg/ml heparin, and 100U/ml of penicillin and streptomycin. MAECs were isolated from 10 week old male C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME) by plating thoracic aortas on matrigel-coated plates, purifying MAEC outgrowth using a PECAM-1 antibody, and characterized as endothelial cells by positive staining to PECAM-1, as we previously described [29]. MAECs were grown in endothelial basal medium supplemented with 10% fetal bovine serum, 50µg/ml gentamicin, 50µg/ml amphotericin, 1µg/ml hydrocortisone, 10ng/ml human epidermal growth factor, and 6µg/ml bovine extract (Lonza Incorporated, Allendale, NJ). MASMCs were isolated from cultured explants of mouse aortas. Briefly, aortas were excised, washed in PBS, and adventitia removed using forceps under microscopic guidance. Vessels were then cut longitudinally, endothelium removed by gentle scrapping, minced with scissors, and placed in culture plates. MASMCs were grown in complete essential medium containing 10% fetal calf serum, Earle’s salts, 2mM L-glutamine and 100U/ml of penicillin and streptomycin, and characterized by morphological and immunological criteria, as we previously described [30]. For the glutamine-deprivation experiments, HUVECs were extensively washed with PBS and then incubated in glutamine-free media containing 20% dialyzed serum for 24 hours prior to their use. All cells were cultured in an atmosphere of 95% air and 5% CO2 at 37°C.

Animal studies

Hyperammonemia was induced in 10-week old male C57BL/6J mice by adding NH4Cl (0.28M) in the drinking water [31]. Control animals received tap water. Mice were housed under controlled temperature and humidity, with ad libitum access to water and standard rodent chow. Based on a previous study [32], we estimated that mice received approximately 1mmol NH4Cl/day. After 7 days of treatment, animals were sacrificed and blood collected by exsanguination in tubes containing EDTA, and plasma obtained by centrifugation [33]. In addition, the thoracic aorta was harvested, cleaned of blood and fat, and snap-frozen in liquid nitrogen. All experimental procedures were approved by the institutional animal care and use committee and conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).

CO exposure

In some experiments, HUVEC were exposed to CO by placing cells in a previously described environmental chamber [34]. In this system, gas from stock tanks containing 1% CO or 5% CO2 in air were combined in a stainless steel mixing cylinder and delivered (1 L/min) into a humidified 37 °C incubator. CO concentrations in the chamber were continuously monitored by electrochemical detection using a CO analyzer (Interscan, Chatsworth, CA).

Western blotting

Cells or vessels were lysed in buffer (125 mM Tris [pH 6.8], 12.5% glycerol, 2% SDS, and bromophenol blue), sonicated, boiled at 100°C for 5 minutes, and centrifuged at 13,000g for 10 minutes. Proteins were subjected to gel electrophoresis and transferred to nitrocellulose membranes. Protein blots were blocked with PBS containing Triton X-100 (0.25%) and nonfat milk (5%) and then incubated with antibodies against HO-1 (1:1,500), Nrf2 (1:200), GSK3β-P (1:375), GSK3β (1:300), or β-actin (1:1000). Membranes were then washed, incubated with horseradish peroxidase-conjugated secondary antibodies, and developed with commercial chemoluminescence reagents (Amersham, Arlington Heights, IL). Blots were then stripped of antibodies by incubating membranes with a stripping solution (10% SDS and 100mM mercaptoethanol in 62.5mm Tris buffer, pH 6.8) for 30 minutes at 50°C, before reprobing with complementary antibodies. Protein expression was quantified by densitometry and normalized with respect to β-actin or GSK3β.

Northern blotting

Total RNA was loaded onto agarose gels, separated by electrophoresis, and transferred to Gene Screen Plus membranes. Membranes were prehybridized in rapid hybridization buffer (Amersham, Arlington Heights, IL) and then incubated overnight at 68°C in hybridization buffer containing [32P]DNA probes (1 × 108 cpm) for Nrf2 or 18S mRNA [24,25,35]. Following hybridization and high stringency washing, membranes were exposed to X-ray film, and mRNA expression quantified by densitometry and normalized with respect to 18 S rRNA.

Real-time polymerase chain reaction

Total RNA was extracted with TRIzol reagent (Life Technologies, Grand Island, NY) and transcribed to cDNA with a reverse transcription kit (Bio-Rad Laboratories, Hercules, CA). Real-time PCR was performed with SYBR Green Supermix in a SYBER Green Cycler iQ 5RT-PCR detection system (Bio-Rad Laboratories, Hercules, CA). The primer sequences were as follows: HO-1, forward GTACTTTGGTGCCTACTCCA and reverse CGGCCCGAACATAGTAATTC. Transcript levels were quantified using the ΔΔCT method and normalized to 18 S rRNA, as previously described [29].

HO activity

HO activity was determined by absorbance spectroscopy [29]. Cells were sonicated in MgCl2 (2mM) and phosphate (100mM) buffer (pH 7.4) and centrifuged at 18,000g for 15 minutes at 4°C. Supernatants were added to a reaction mixture containing NADPH (0.8mM), glucose-6-phosphate (2mM), glucose-6-phosphate dehydrogenase (0.2U), rat liver cytosol (2mg), and hemin (20µM). The reaction was conducted at 37°C in the dark and stopped after an hour by the addition of chloroform. The extracted bilirubin was calculated by the difference in absorption between 464 and 530nm with an extinction coefficient of 40mM−1cm−1.

HO-1 reporter activity

HO-1 promoter activity was examined using luciferase reporter constructs that were provided by Dr. Jawed Alam (Ochsner Clinic Foundation, New Orleans, LA). These constructs consisted of the wild type enhancer (E1) that contains three antioxidant responsive elements (ARE) core sequences coupled to a minimum HO-1 promoter as well as the mutant enhancer (M739) that has mutations in its three ARE sequences. Transfection efficiency was ascertained by introducing a plasmid encoding Renilla luciferase (Promega, Madison, WI) into cells. Cells were transfected with plasmids using lipofectamine (Invitrogen Corporation, Carlsbad, CA), incubated for 48 hours, and then exposed to NH4Cl for 6 hours. Firefly luciferase activity was determined using a Glomax luminometer (Promega, Madison, WI) and normalized to Renilla luciferase activity, and this ratio was expressed as fold induction over control cells.

Small interference RNA

HO-1 was silenced by transfecting cells with HO-1 small interference RNA (siRNA) (0.1µM) or a non-targeting (NT) siRNA (0.1µM) that was purchased from Dharmacon (Lafayette, CO), as we previously reported [25,29,35].

Nrf2 activation

Cells were collected in lysis buffer (10 mM HEPES, pH 7.9, 10mM KCl, 0.1mM EDTA, 0.5mM PMSF, 10µg/ml aprotonin, 10µg/ml leupeptin, 10µg/ml pepstatin A, 0.5 mM dithiothreitol, and 0.4% Nonidet P-40) and then centrifuged at 14,000 × g for 3 minutes. Nuclear pellets were suspended in extraction buffer (20mM HEPES, pH 7.9, 0.4M NaCl, 1.0mM EDTA, 1mM dithiothreitol, 10µg/ml aprotonin, 10µg/ml leupeptin, 10 µg/ml pepstatin A, and 10% glycerol), and centrifuged at 14,000 × g for 5 minutes. The supernatant was collected and Nrf2 activity determined by measuring the binding of Nrf2 to the ARE using the ELISA-based TransAM Nrf2 kit (Active Motif, Carlsbad, CA). Bound protein was detected using an antibody specific to DNA-bound Nrf2, visualized by colorimetric reaction catalyzed by horseradish peroxidase-conjugated secondary antibody, and absorbance measured at 405 nm.

Measurement of TNFα

TNFα levels in the culture media were determined by ELISA using a commercially available kit (Invitrogen Corporation, Carlsbad, CA), as we previously described [36].

Measurement of intracellular ROS

Intracellular ROS was monitored using the cell-permeable probe CM-H2DCFDA. Cells were grown to confluence and treated with ammonia in the presence and absence of NAC or rotenone. Following treatment cells were incubated with CM-H2DCFDA (10µM) for 30 minutes at 37°C. The cells were then washed with PBS and fluorescence quantified by microplate fluorimetry with excitation at 485nm and emission at 530nm, as previously described [37]. Mean values from each treatment were expressed as a fraction relative to untreated control cells.

Measurement of ammonia

Ammonia concentration was determined using an ammonia assay kit (Sigma-Aldrich, St. Louis, MO), according to manufacturer’s instructions. This assay measures the reductive amination of α-ketoglutarate to glutamate in the presence of glutamate dehydrogenase and NADH. Samples were mixed with ammonia assay reagent at room temperature for 10 minutes and then absorbance of the reaction mixture measured by spectroscopy at 340nm. Concentrations were determined relative to a standard curve obtained using aqueous solutions of ammonia.

Cell viability

Cell viability was evaluated by monitoring the uptake of the membrane-impermeable dye trypan blue. Cells were incubated with trypsin (0.25%), collected, diluted (1:4) with trypan blue and examined by microscopy. Viability was determined by the ability of cells to exclude the stain, as we previously reported [25,29,38].

Statistical analyses

Results are expressed as mean ± SEM. Statistical analyses were performed with the use of a Student’s two-tailed t-test and an analysis of variance with the Tukey post hoc test when more than two treatment regimens were compared. P values < 0.05 were considered statistically significant.

Results

Treatment of HUVECs with ammonia stimulated the expression of HO-1 protein. The induction of HO-1 protein was delayed with a significant increase in HO-1 protein detected 4 hours after administration of the ammonia donor, NH4Cl, and levels progressively increased over 24 hours (Fig. 1A). The increase in HO-1 protein observed after 24 hours was dependent on the concentration of NH4Cl, with higher concentrations evoking larger rises in HO-1 protein (Fig. 1B). The induction of HO-1 protein by NH4Cl was mimicked by another ammonia donor, NH4OH (Fig. 1C). The stimulation of HO-1 protein expression by NH4OH was not an indirect consequence of altered pH as NaOH had no effect on HO-1 levels (Fig. 1D). The ammonia donors also increased HO-1 mRNA expression and HO activity in HUVECs (Fig. 1E and F).

Figure 1
Ammonia increases HO-1 expression in HUVECs. (A) NH4Cl (5.0mM) stimulates a time-dependent increase in HO-1 protein. (B) NH4Cl exposure for 24 hours stimulates a concentration-dependent increase in HO-1 protein. (C) NH4OH exposure for 24 hours stimulates ...

Generation of ammonia by HUVECs also modulated HO-1 protein expression. Treatment of glutamine-restricted HUVECs with the ammonia scavenger, methyl pyruvate [39], caused a marked decline in ammonia levels in the culture medium and this was associated with a significant reduction in HO-1 protein (Fig. 2A and B). In contrast, addition of a physiologically relevant concentration of glutamine (500µM) to these cells evoked a marked rise in ammonia production and HO-1 protein expression. Both these effects of glutamine were prevented by methyl pyruvate, demonstrating that endothelial HO-1 levels are regulated in a dynamic manner by endogenous ammonia synthesis. Treatment of MAECs or MASMCs with NH4Cl likewise evoked an increase in HO-1 protein (Fig. 3A and B). Moreover, supplementation of the drinking water of mice with NH4Cl resulted in a marked increase in plasma ammonia that was paralleled by an elevation in aortic HO-1 protein expression (Fig. 3C and D).

Figure 2
Endogenous ammonia (NH3) production regulates HO-1 expression in HUVECs. (A) Glutamine (GTN;500µM) stimulates NH3 formation in GTN-deprived endothelial cells. The NH3 scavenger methyl pyruvate (MP;10mM) blocks basal and GTN-stimulated NH3 synthesis. ...
Figure 3
Ammonia stimulates HO-1 protein in MAECs, MASMCs, and murine arteries. (A) NH4Cl exposure for 24 hours stimulates HO-1 protein expression in MAEC. (B) NH4Cl exposure for 24 hours stimulates HO-1 protein expression in MASMCs. (C and D) Administration of ...

We next explored the molecular mechanism by which ammonia stimulates HO-1 expression. Incubation of HUVECs with the transcriptional inhibitor actinomycin D abolished basal and NH4Cl-induced HO-1 protein expression (Fig. 4A), suggesting that ammonia-mediated increases in HO-1 expression required de novo RNA synthesis. Ammonia also activated the HO-1 promoter and this was prevented by mutating the ARE sequences in the promoter (Fig. 4B). In addition, modification of the ARE sequences attenuated baseline promoter activity. Since we previously demonstrated that the transcription factor Nrf2 plays a predominant role in endothelial HO-1 gene activation [25,29,35], the role of Nrf2 was examined. Transfection of the HUVECs with a dominant-negative mutant of Nrf2 (dnNrf2) that had its activation domain removed inhibited basal and NH4Cl-mediated increases in HO-1 promoter activity (Fig. 4B). Furthermore, NH4Cl stimulated an increase in Nrf2 protein and mRNA beginning 2 and 8 hours, respectively, following NH4Cl treatment (Fig. 4C and D). NH4Cl also promoted the activation of Nrf2, as reflected by the binding of nuclear Nrf2 to the ARE (Fig. 4E). Since the GSK3β-mediated phosphorylation of Nrf2 targets the protein for ubiquitination and degradation by the E3 ligase, β-transducin repeats containing protein (β-TrCP) [40,41], we examined the possibility that ammonia increases Nrf2 expression by blocking GSK3β activity. Given that GSK3β activity is inhibited by the phosphorylation of serine-9, the ability of ammonia to stimulate the phosphorylation of this serine residue was determined. However, NH4Cl had no effect on GSK3β phosphorylation. Alternatively, inhibition of phosphatidylinositol-3-kinase-Akt signaling pathway, a known negative regulator of GSK3β activity [42], by LY294002 stimulated GSK3β activity as revealed by a prominent decrease in the phosphorylation of GSK3β, affirming that alterations in GSK3β activity could be monitored by this assay.

Figure 4
Ammonia stimulates HO-1 promoter activity via the Nrf2/ARE complex in HUVECs. (A) Ammonia-mediated HO-1 gene expression requires de novo RNA synthesis. Effect of actinomycin D (ActD; 0.10µg/ml) on NH4Cl (5.0mM for 8 hour)-mediated increase in ...

In subsequent experiments, we determined the upstream signaling pathway responsible for the induction of HO-1. Since oxidative stress is an established activator of Nrf2 [35], the role of ROS in the stimulation of HO-1 expression was investigated. Treatment of HUVECs with NH4Cl resulted in a concentration-dependent increase in ROS production (Fig. 5A). The NH4Cl-mediated rise in ROS formation was detected within one hour of treatment and persisted for 24 hours (Fig. 5B). The increase in oxidative stress by ammonia was not accompanied by any change in cell viability (Fig. 5C). Pretreatment of HUVECs with the antioxidant NAC or the mitochondrial electron transport chain inhibitor rotenone prevented the increase in intracellular ROS by NH4Cl (Fig. 6A). In addition, NAC blocked the NH4Cl-mediated induction of HO-1 protein (Fig. 6B) and activation of Nrf2, as reflected by the diminished binding of nuclear Nrf2 to the ARE (Fig. 6C). We also investigated the cellular source of ROS accountable for the induction of HO-1 by ammonia. While incubation of endothelial cells with rotenone blocked the NH4Cl-mediated increases in HO-1 protein expression (Fig. 6D), the NADPH oxidase inhibitor, apocynin, or the xanthine oxidase inhibitor, allopurinol, had no effect on HO-1 expression (Fig. 6E and F).

Figure 5
Ammonia stimulates oxidative stress in HUVECs. (A) NH4Cl exposure for 8 hours increases intracellular ROS production in a concentration-dependent manner. (B) NH4Cl (5.0mM) exposure increases ROS production in a time-dependent fashion. (C) NH4Cl exposure ...
Figure 6
Ammonia-induced HO-1 expression is dependent on oxidative stress in HUVECs. (A) Effect of N-acetyl-L-cysteine (NAC; 10mM) or rotenone (Rot;5µM) on NH4Cl (5.0mM for 8 hours)-mediated intracellular ROS production. (B) Effect of NAC (10mM) on NH ...

Finally, the functional significance of the induction of HO-1 by ammonia was investigated. Since HO-1 protects against endothelial injury [2426], the pro-survival potential of ammonia was examined. Treatment of HUVECs with TNFα and cycloheximide stimulated a marked reduction in the number of viable cells (Fig. 7A). Notably, pretreatment of endothelial cells with ammonia (5mM) for 24 hours attenuated the cytokine-mediated loss of cell viability. Consistent with previous reports [43,44], we found that HUVEC did not basally release TNFα in the culture media and ammonia exposure (5mM) for 24 hours failed to stimulate TNFα synthesis in these cells. To determine if the protective action of NH4Cl involved HO-1, HUVECs were transfected with HO-1 siRNA or NT siRNA. HO-1 siRNA effectively silenced the expression of HO-1 whereas NT siRNA was without effect, demonstrating the efficacy and specificity of the knockdown approach (Fig. 7B). Significantly, HO-1 siRNA abolished the ability of NH4Cl to block cytokine-mediated cell death while NT siRNA failed to modulate cell viability (Fig. 7A). In the absence of NH4Cl, HO-1 or NT siRNA had no effect on cell viability. Finally, we determined which of the HO-1 products was able to restore cell viability in HO-1-silenced endothelial cells. While the exogenous administration of CO could substitute for the loss of HO-1, and reverse the negative effect of TNFα on cell viability, bilirubin and iron failed to restore endothelial cell survival (Fig. 7A). CO also inhibited cytokine-mediated endothelial cell death in the absence of NH4Cl, while bilirubin and iron had no effect (Fig. 7C).

Figure 7
Ammonia inhibits inflammatory stress-induced cell death in HUVECs via the HO-1-mediated production of CO. (A). Ammonia promotes endothelial cell survival via the induction of HO-1 and release of CO. HUVEC were transfected with HO-1 siRNA (0.1 µM) ...

Discussion

In the present study, we identified ammonia as a potent inducer of HO-1 gene expression in vascular endothelium. The induction of HO-1 is observed in human and murine endothelial cells and mouse arteries, requires the production of ROS, and is mediated by the Nrf2-ARE complex. Significantly, we also found that ammonia protects against endothelial cell death in a HO-1-dependent fashion that relies on the generation of CO. These findings establish ammonia as a novel regulator of endothelial cell survival and identify ammonia as a potentially important signaling gas in the circulation.

Treatment of HUVECs with two distinct ammonia donors (NH4Cl and NH4OH) stimulates the expression of HO-1. The induction of HO-1 is dependent on the concentration and duration of ammonia exposure. A significant elevation of HO-1 protein is detected after 4 hours, and this progressively increases during 24 hours of ammonia exposure. The induction of HO-1 is also observed in MAECs indicating that ammonia stimulates endothelial HO-1 expression across animal species. In addition, the stimulation of HO-1 expression by ammonia is not restricted to endothelial cells, as a significant elevation in HO-1 expression is observed in MASMCs. Significantly, we also found that endogenous ammonia production is coupled to HO-1 expression in endothelial cells. Removal of ammonia by the ammonia scavenger methyl pyruvate results in a marked decline in HO-1 protein whereas an increase in ammonia synthesis following the addition of glutamine is paralleled by a marked rise in HO-1 protein. Thus, ammonia functions in an autocrine manner to drive endothelial HO-1 expression. Moreover, the ability of glutamine to stimulate endothelial ammonia synthesis is in-line with a previous study [16] and may provide a mechanism by which this amino acid is able to induce the expression of HO-1 in various experimental models [4547].

Using a dietary mouse model of hyperammonemia, we also show that in vivo administration of ammonia increases arterial HO-1 content. The concentration of plasma ammonia noted in our animal model (~200µM) is comparable or lower than that reported in certain pathological states, including patients with urea cycle defects, liver failure, and organic acidemia as well as the tumor microenvironment [1,6,7,48,49], suggesting that the induction of HO-1 occurs in many of these metabolic disorders as well as cancer. Consistent with this notion, increases in HO-1 have been detected in the brain following acute ammonia intoxication of rats and in animal models of hepatic encephalopathy and cancer [4952].

The induction of HO-1 by ammonia is dependent on de novo RNA synthesis and likely involves the transcriptional activation of the gene. We found that the transcriptional inhibitor, actinomycin D prevents the increase in HO-1 expression by ammonia. In addition, ammonia directly stimulates HO-1 promoter activity. The induction of HO-1 gene transcription requires the presence of AREs since mutation of this responsive element abolishes the increase in promoter activity by ammonia. While numerous transcription factors bind to AREs, we previously reported that Nrf2 plays a fundamental role in ARE-dependent HO-1 gene expression in endothelial cells [25,29,35]. In agreement with this earlier work, we found that ammonia stimulates Nrf2 protein and mRNA expression, and nuclear Nrf2 binding to the AREs. Interestingly, ammonia-mediated increases in Nrf2 protein precede elevations in Nrf2 mRNA, suggesting that this gas stimulates both de novo synthesis and stability of the protein. Moreover, transfection of endothelial cells with a dominant-negative Nrf2 construct nullifies the activation of HO-1 promoter activity in response to ammonia. Thus, recruitment of Nrf2 plays an essential role in mediating HO-1 gene transcription in endothelial cells and may underlie the induction by ammonia of other Nrf2-targeted genes that are involved in glutathione synthesis [53]. Finally, the discovery that ammonia, like nitric oxide, CO, and hydrogen sulfide, activates Nrf2 highlights the critical role this transcription factor plays in mediating the genomic actions of signaling gases [5456].

The ability of ammonia to stimulate HO-1 expression is dependent on oxidative stress. Incubation of HUVECs with ammonia evokes a marked increase in ROS production. This finding mirrors previous work in other cells including astrocytes, neurons, dendritic cells, and epithelial cells [9,12,27,57]. Significantly, the antioxidant NAC blocks the ammonia-mediated generation of ROS, the induction of HO-1, and the activation of Nrf2. While activation of NADPH oxidase and xanthine oxidase have been linked to the production of ROS by ammonia [58,59], they do not mediate the induction of HO-1 as pharmacological blockade of either enzyme fails to inhibit the expression of HO-1. Instead, it appears that a mitochondrial pathway underlies the ammonia-mediated increase in HO-1 expression, as the induction of ROS formation and HO-1 expression by ammonia is attenuated by the mitochondrial electron transport chain complex I inhibitor, rotenone, implicating ROS production from this organelle in the induction of HO-1. Although the mechanism by which ammonia activates Nrf2 is not known, it presumably involves the oxidation of specific cysteine residues in Kelch-like erythroid cell-derived protein-1 (Keap1) that mediate the release and/or inhibition of Keap1-dependent ubiquitination and degradation of Nrf2 [60]. Given that ammonia has no effect on GSK3β activity, diminished proteasomal degradation of Nrf2 by β-TrCP seems unlikely.

Although ammonia is a well-known neurotoxin [6,7,61,62] that also adversely affects lung, heart, and skeletal muscle function [15,58,59], the administration of high concentrations of ammonia (up to 5 mM) had no detrimental effect on human endothelial cell viability. This observation is consistent with other studies performed in mouse and rat brain endothelial cell lines [63,64], suggesting that the toxic effects of ammonia may be cell-specific. Surprisingly, we show that ammonia pretreatment markedly reduces endothelial cell death in response to TNFα and cycloheximide. We also found that the cytoprotection provided by ammonia is dependent on HO-1 since depletion of the enzyme abrogates the protection by ammonia. These results are in-line with earlier studies demonstrating that the induction of HO-1 promotes endothelial cell survival in response to a host of inimical stimuli [2226]. Significantly, exogenous administration of the HO-1 product CO, but not bilirubin or iron, can substitute for HO-1 and restore the viability of cytokine-challenged endothelial cells, suggesting that CO mediates the protective action of HO-1. Consistent with this notion, CO is the only HO-1 product capable of blocking cytokine-induced apoptosis in the absence of ammonia pretreatment. The damaging effect of TNFα and cycloheximide on endothelial cells occurs via the caspase-mediated induction of apoptosis (65). Ample evidence from our laboratory and others indicates that HO-1-derived CO is a potent inhibitor of apoptosis [2426,29] and that it suppresses cytokine-mediated apoptosis via the activation of p38 mitogen-activated kinase and expression of a subset of nuclear factor-κB-dependent anti-apoptotic genes (26,66). Consistent with our findings, ammonia also protects against the lethal actions of TNFα in immortalized renal epithelial cells and improves survival of glutamine-starved hybridoma cells [49,67], demonstrating that the cytoprotective action of ammonia extends beyond endothelial cells. While endothelial cells possess different functional and metabolic properties than tumor or transformed cells, endothelial cells are highly plastic and can assume a highly proliferative and motile state during tissue repair and angiogenesis and, intriguingly, share some key metabolic similarities with tumor cells. Both cell types rely on glycolysis for a majority of their energy requirements (68) and have extremely high rates of glutaminolysis that favors the production of ammonia (1618). This latter finding highlights the need for further studies investigating the role of this gas both in tumorigenic and non-tumorigenic cells.

Our finding that ammonia stimulates HO-1 expression in HUVEC and MAEC is consistent with an earlier report in rat cerebral microvascular endothelial cells [28] and demonstrates that ammonia induces HO-1 in both the macro and microcirculation. However, ammonia can evoke disparate responses in endothelial cell types. While ammonia fails to stimulate TNFα synthesis in HUVEC, a significant increase in TNFα production is observed rat cerebral microvascular endothelial cells [69]. The differential inflammatory response to ammonia between peripheral conduit and brain microvascular endothelial cells may reflect differences in their sensitivity to inflammatory stimuli as well as in their structural and functional properties. Brain microvascular endothelial cells constitute the blood-brain barrier (BBB) and interact with glial cells in maintaining cerebral homeostasis by regulating barrier permeability, transport, and metabolic functions. However, BBB function is impaired in hyperammonemia secondary to acute liver failure due to the degradation of tight junction proteins by matrix metalloproteinase-9 [7072]. Similarly, ammonia reduces tight junction expression and increases paracellular permeability of rat brain endothelial cells in a matrix metalloproteinase-dependent fashion [73,74]. Interestingly, inducers of HO-1 have been shown to protect the cerebral vasculature against BBB dysfunction and neurological deficits in stroke, and improve BBB function after intracerebral hemorrhage [75,76]. Moreover, curcumin antagonizes increases in BBB permeability via the HO-1-mediated restoration of tight junction proteins and HO-1 also stabilizes the blood-spinal cord barrier after acute injury in mice [77,78]. Collectively, these findings raise the possibility that the induction of HO-1 in cerebral endothelial cells may function in an adaptive manner to preserve BBB and limit brain edema in hyperammonemic states.

Cerebral microvascular endothelial cells are intimately associated with astrocytes forming a gliovascular complex that manages BBB integrity [79]. However, the functional integrity of this complex may be compromised by dysfunctional endothelial cells in hyperammonemic conditions. In particular, ammonia-treated cerebral endothelial cells were shown to cause swelling of astrocytes in a paracrine fashion that depends on ammonia-induced free radical production and the activation of nuclear factor-kB by endothelial cells [28]. Interestingly, the induction of HO-1 in cerebral endothelial cells is also observed in this environment [28]. Since HO-1 has been demonstrated to correct endothelial dysfunction in various pathologic states [8082], the upregulation of HO-1 in this setting may play a role in dampening this harmful endothelial cell-initiated intercellular signaling pathway.

The ability of ammonia to preserve endothelial cell viability in response to inflammatory mediators raises the possibility that ammonia may be used for therapeutic effect in various inflammatory states, including solid organ transplantation and ischemic reperfusion injury. In particular, exposure of donor organs to ammonia prior to transplantation may mitigate endothelial cell death and dysfunction, and contribute to organ survival. In addition, local or systemic administration of ammonia as a preconditioning stimulus may promote organ function following ischemia-reperfusion. Indeed, we have recently shown that preconditioning of animals with another potentially toxic signaling gas, hydrogen sulfide, can ameliorate inflammation following ischemia-reperfusion of the small intestine [83]. Aside from counteracting the destruction of endothelial cells, ammonia may also preserve blood flow and fluidity following organ transplantation or ischemia-reperfusion through the induction of HO-1, since this enzymes evokes vasodilatory, anti-inflammatory, and anti-thrombotic actions in the circulation [1921].

In conclusion, the present study demonstrates that ammonia induces HO-1 gene expression in human and murine endothelial cells via the activation of the ROS-Nrf2 signaling pathway. In addition, it found that ammonia inhibits cytokine-mediated endothelial cell death via the induction of HO-1 and release of CO. These results establish ammonia as a novel regulator of endothelial cell survival and reveals critical new regulatory and functional interactions between signaling gases in the vasculature.

Highlights

  • Ammonia stimulates HO-1 expression in endothelial cells via the ROS-Nrf2 pathway
  • Glutamine induces HO-1 expression in endothelial cells via the formation of ammonia
  • Ammonia enhances endothelial cell viability via the HO-1-mediated release of CO
  • Ammonia is an important signaling gas that promotes endothelial cell survival

Acknowledgments

This work was supported by the National Heart, Lung, and Blood Institute of the National Institutes of Health under award number R01HL59976 and the American Heart Association Midwest Affiliate under award number 15GRNT25250015.

Abbreviations

HO-1
heme oxygenase-1
Nrf2
NF-E2-related factor-2
ROS
reactive oxygen species
CO
carbon monoxide
HUVECs
human umbilical vein endothelial cells
MAECs
mouse aortic endothelial cells
MASMCs
mouse aortic smooth muscle cells
NH4Cl
ammonium chloride
NH4OH
ammonium hydroxide
NAC
N-acetyl-L-cysteine
PMSF
phenylmethylsulfonyl fluoride
CM-H2DCFDA
5-(and-6)-chloromethyl-2,7-dichlorodihydrofluorescein diacetate acetyl ester
GSK3β
glycogen synthase kinase-3β
GSK3β-P
phospho (ser-9)- glycogen synthase kinase-3β
TNFα
tumor necrosis factor-α
PECAM-1
platelet-endothelial cell adhesion molecule-1
ARE
antioxidant responsive elements
siRNA
small interference RNA
dnNrf2
dominant-negative mutant of Nrf2
β-TrCP
β-transducin repeats containing protein

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Adeva MM, Sauto G, Blanco N, Donapetry C. Ammonium metabolism in humans. Metab Clin Exp. 2012;61:1495–1511. [PubMed]
2. Kopstein J, Wrong OM. The origin and fate of salivary urea and ammonium in man. Clin Sci Mol Med. 1977;52:9–17. [PubMed]
3. Aoyagi T, Engstrom GW, Evans WB, Summerskill WH. Gastrointestinal urease in man. I. Activity of mucosal urease. Gut. 1966;7:631–635. [PMC free article] [PubMed]
4. Kim HY. Renal handling of ammonium and acid base regulation. Electrolyte Blood Press. 2009;7:9–13. [PMC free article] [PubMed]
5. Meijer AJ, Lamers WH, Chamuleau RAFM. Nitrogen metabolism and ornithine cycle function. Physiol Rev. 1990;70:701–748. [PubMed]
6. Haberle J. Clinical practice: the management of hyperammonemia. Eur. J. Pediatri. 2011;170:21–34. [PubMed]
7. Buttersworth RF, Giguere JF, Michaud J, Lavoie J, Layrargues GP. Ammonia: a key factor in the pathogenesis of hepatic encephalopathy. Neurochem Pathol. 1987;6:1–12. [PubMed]
8. Wang R. Gasotransmitters: growing pains and joys. Trends Biochem Sci. 2014;39:227–232. [PubMed]
9. Dai H, Song D, Xu J, Li B, Hertz L, Peng L. Ammonia-induced Na,K-ATPase/ouabain-mediated EGF receptor transactivation, MAPK/ERK and PI3K/AKT signaling and ROS formation cause astrocyte swelling. Neurochem Int. 2013;63:610–625. [PubMed]
10. Widmer R, Kaiser B, Engels M, Jung T, Grune T. Hyperammonemia causes protein oxidation and enhanced proteasomal activity in response to mitochondrial mediated oxidative stress in rat primary astrocytes. Arch Biochem Biophys. 2007;464:1–11. [PubMed]
11. Karababa A, Gorg B, Schliess F, Haussinger D. O-GlcNAcylation as a novel ammonia-induced posttranslational protein modification in cultured rat astrocytes. Metab Brain Dis. 2014;29:975–982. [PubMed]
12. Skowronska M, Albrecht J. Oxidative and nitrosative stress in ammonia neurotoxicity. Neurochem Int. 2013;62:731–737. [PubMed]
13. Schleiss F, Gorg B, Fischer R, Desjardins P, Bidmon HJ, Herrmann A, Buttersworth RF, Zilles K, Haussinger D. Ammonia induces MK-801-sensitive nitration and phosphorylation of protein tyrosine residues in rat astrocytes. FASEB J. 2001;16:739–741. [PubMed]
14. Andersson KE, Brandt L, Hindfeldt B, Ljunggren B. Cerebrovascular effects of ammonia in vitro. Acta Physiol Scand. 1981;113:349–353. [PubMed]
15. Zhang Q, Meng Z. The inotropic effects of ammonia on isolated perfused rat hearts and the mechanisms involved. J Exp Med. 2011;214:4048–4054. [PubMed]
16. Wu G, Haynes TE, Li H, Meininger CJ. Glutamine metabolism in endothelial cells: ornithine synthesis from glutamine via pyrroline-5-carboxylate synthase. Comp Biochem Physiol Part A. 2000:115–123. [PubMed]
17. Cornicelli JA, Witte LD, Goodman DS. Inhibition of LDL degradation in cultured human fibroblasts induced by endothelial cell-conditioned medium. Arteriosclerosis. 1983;3:560–567. [PubMed]
18. Leighton B, Curi R, Hussein A, Newsholme EA. Maximum activities of some key enzymes of glycolysis, glutaminolysis, Krebs cycle and fatty acid utilization in bovine pulmonary endothelial cells. FEBS Lett. 1987;225:93–96. [PubMed]
19. Ross R. Atherosclerosis - an inflammatory disease. N. Engl. J. Med. 1999;340:115–126. [PubMed]
20. Durante W, Johnson FK, Johnson RA. Role of carbon monoxide in cardiovascular function. J Cell Mol Med. 2006;10:672–686. [PMC free article] [PubMed]
21. Durante W. Targeting heme oxygenase-1 in vascular disease. Curr Drug Targets. 2010;11:1504–1516. [PMC free article] [PubMed]
22. Durante W. Protective role of heme oxygenase-1 against inflammation in atherosclerosis. Front Biosci. 2011;16:2372–2388. [PubMed]
23. Motterlini R, Foresti R, Intaglietta M, Winslow RM. NO-mediated activation of heme oxygenase: Endogenous cytoprotection against oxidative stress to endothelium. Am J Physiol. 1996;270:H107–H114. [PubMed]
24. Yachie A, Niida Y, Wada T, Igarishi N, Kaneda H, Toma T, Ohta K, Kasahara Y, Koizumi S. Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J Clin Invest. 1999;103:129–135. [PMC free article] [PubMed]
25. Wei Y, Liu XM, Peyton KJ, Wang H, Johnson FK, Johnson RA, Durante W. Hypochlorous acid-induced heme oxygenase-1 gene expression promotes human endothelial cell survival. Am J Physiol Cell Physiol. 2009;297:C907–C915. [PubMed]
26. Liu XM, Peyton KJ, Shebib AR, Wang H, Korthuis RJ, Durante W. Activation of AMPK stimulates heme oxygenase-1 gene expression and human endothelial cell survival. Am J Physiol Heart Circ Physiol. 2011;300:H84–H93. [PubMed]
27. Brouard S, Otterbein LE, Anrather J, Tobiasch E, Bach FH, Choi AM, Soares MP. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med. 2000;192:1015–1026. [PMC free article] [PubMed]
28. Jayakumar AR, Tong XY, Ospel J, Norenberg MD. Role of cerebral endothelial cells in the astrocyte swelling and brain edema associated with acute hepatic encephalopathy. Neuroscience. 2012:305–316. [PMC free article] [PubMed]
29. Liu XM, Peyton KJ, Durante W. Physiological cyclic strain promotes endothelial cell survival via the induction of heme oxygenase-1. Am J Physiol Heart Circ Physiol. 2013;302:H1634–H1643. [PubMed]
30. Durante W, Schini VB, Catovsky S, Kroll MH, Vanhoutte PM, Schafer AI. Plasmin potentiates induction of nitric oxide synthesis by interleukin-1beta in vascular smooth muscle cells. Am J Physiol. 1993;264:H617–H624. [PubMed]
31. Leibrock CB, Alesutan I, Voelkl J, Pakladok T, Michael D, Schleiher E, Kamyabi-Moghaddam Z, Quintanilla-Martinez L, Kuro-o M, Lang F. NH4Cl treatment prevents tissue calcification in klotho deficiency. J Am Soc Nephrol. 2015;26:2423–2433. [PubMed]
32. Nowik M, Kampik NB, Mihailova M, Eladari D, Wagner CA. Induction of metabolic acidosis with ammonium chloride (NH4Cl) in mice and rats – species differences and technical considerations. Cell Physiol Biochem. 2010;26:1059–1072. [PubMed]
33. Johnson FK, Peyton KJ, Liu XM, Azam MA, Shebib AR, Johnson RA, Durante W. Arginase promotes endothelial dysfunction and hypertension in obese rats. Obesity. 2015;23:383–390. [PMC free article] [PubMed]
34. Liu XM, Peyton KJ, Ensenat D, Wang H, Schafer AI, Alam J, Durante W. Endoplasmic reticulum stress stimulates heme oxygenase-1 gene expression in vascular smooth muscle Role in cell survival. J Biol Chem. 2005;280:872–877. [PubMed]
35. Chang CF, Liu XM, Peyton KJ, Durante W. Heme oxygenase-1 counteracts contrast media-induced endothelial cell dysfunction. Biochem Pharmacol. 2014;87:303–311. [PMC free article] [PubMed]
36. Zhang W, Jones AW, Wang M, Durante W, Korthuis RJ. Preconditioning with soluble guanylate cyclase activation prevents postischemic inflammation and reduces nitrate tolerance to heme oxygenase-1 knockout mice. Am J Physiol Heart Circ Physiol. 2013;305:H521–H532. [PubMed]
37. Durante W, Peyton KJ, Schafer AI. Platelet-derived growth factor stimulates heme oxygenase-1 gene expression and carbon monoxide production in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 1999;19:2666–2672. [PubMed]
38. Liu XM, Peyton KJ, Shebib AR, Hong W, Durante W. Compound C stimulates heme oxygenase-1 gene expression via the Nrf2-ARE pathway to preserve human endothelial cell survival. Biochem Pharmacol. 2011;82:371–379. [PMC free article] [PubMed]
39. Cheong H, Lindsten T, Wu J, Lu C, Thompson CB. Ammonia-induced autophagy is independent of ULK1/ULK2 kinases. Proc Natl Acad Sci USA. 2011;108:11121–11126. [PubMed]
40. Rada P, Rojo AI, Evrard-Todeschi N, Innamorato NG, Cotte A, Jaworksi T, Tobon-Velasco JC, Devijver H, Garcia-Mayoral MF, Van Leuven F, Hayes JD, Bertho G, Quadrado A. Structural and functional characterization of Nrf2 degradation by the glycogen synthase kinase-3/β-TrCP axis. Mol Cell Biol. 2012;32:3486–3499. [PMC free article] [PubMed]
41. Biswas C, Shah N, Muthu M, La P, Fernando AP, Sengupta S, Yang G, Dennery PA. Nuclear heme oxygenase-1 (HO-1) modulates subcellular distribution and activation of Nrf2, impacting metabolic anti-oxidant defenses. J. Biol. Chem. 2014;289:26882–26894. [PMC free article] [PubMed]
42. Cross DAE, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin-mediated protein kinase B. Nature. 1995;378:785–789. [PubMed]
43. Ranta V, Orpana A, Carpen O, Turpeinen U, Ylikorkala O, Viinikka L. Human vascular endothelial cells produce tumor necrosis factor-alpha in response to Proinflammatory cytokine stimulation. Crit Care Med. 1999;27:2184–2187. [PubMed]
44. Imaizumi T, Itaya H, Fujita K, Kudoh D, Kudoh S, Mori K, Fujimoto K, Matsumiya T, Yoshida H, Satoh K. Expression of tumor necrosis factor-alpha in cultured human endothelial cells stimulated with lipopolysaccharide or interleukin-1 alpha. Arterioscler Thromb Vasc Biol. 2000;20:410–415. [PubMed]
45. Umeda K, Takahashi T, Inoue K, Shimizu H, Maeda S, Morimatsu H, Omori E, Akagi R, Katayama H, Morita K. Prevention of hemorrhagic shock-induced intestinal tissue injury by glutamine via heme oxygenase-1 induction. Shock. 2009;31:40–49. [PubMed]
46. Uehara K, Takahashi T, Fujii H, Schmizu H, Omari E, Matsumi M, Yokoyama M, Morita K, Akagi R, Sassa S. The lower intestinal tract-specific induction of heme oxygenase-1 by glutamine protects against endotoxemic intestinal injury. Crit Care Med. 2005;33:381–390. [PubMed]
47. Zhang SC, Shi Q, Feng YN, Fang J. Tissue-protective effect of glutamine on hepatic ischemia-reperfusion injury via the induction of heme oxygenase-1. Pharmacology. 2013;91:59–68. [PubMed]
48. Chow SL, Gandhi V, Krywawych S, Clayton PT, Leonard JV, Morris AAM. The significance of high plasma ammonia value. Arch Dis Child. 2004;89:585–586. [PMC free article] [PubMed]
49. Eng CH, Yu K, Lucas J, White E, Abraham RT. Ammonia derived from glutaminolysis is a diffusable regulator of autophagy. Sci Signal. 2010;3:ra31. [PubMed]
50. Warskulat U, Gorg B, Bidmon HJ, Muller HW, Schliess F, Haussinger D. Ammonia-induced heme oxygenase-1 expression in cultured rat astrocytes and rat brain in vivo. Glia. 2002;40:324–336. [PubMed]
51. Wang QM, Yin XY, Duan ZJ, Guo SB, Sun XY. Role of the heme oxygenase/carbon monoxide pathway in the pathogenesis and prevention of hepatic encephalopathy. Mol Med Rep. 2013;8:67–74. [PubMed]
52. Loboda A, Jozkowicz A, Dulak J. HO-1/CO system in tumor growth, angiogenesis and metabolism – targeting HO-1 as an anti-tumor therapy Vascul. Pharmacol. 2015;74:11–22. [PubMed]
53. Hilgier W, Wegrzynowicz M, Ruszkiewicz J, Oja SS, Saransaari P, Albrecht J. Direct exposure to ammonia and hyperammonemia increase the extracellular accumulation and degradation of astroglia-derived glutathione in the rat prefrontal cortex. Toxicol Sci. 2010;117:163–168. [PubMed]
54. Liu XM, Peyton KJ, Ensenat D, Wang H, Hannink M, Alam J, Durante W. Nitric oxide stimulates heme oxygenase-1 gene expression via the Nrf2/ARE complex to promote smooth muscle cell survival. Cardiovasc Res. 2007;75:381–389. [PMC free article] [PubMed]
55. Lee BS, Heo J, Kim YM, Shim SM, Pae HO, Kim YM, Chung HT. Carbon monoxide mediates heme oxygenase-1 induction via Nrf2 activation in hepatoma cells. Biochem Biophys Res Commun. 2006;343:965–972. [PubMed]
56. Calvert JW, Jha S, Gundewar S, Elrod JW, Ramachandran A, Pattillo CB, Kevil CG, Lefer DJ. Hydrogen sulfide mediates cardioprotection through Nrf2 signaling. Circ Res. 2009;105:365–374. [PMC free article] [PubMed]
57. Luo C, Shen G, Liu N, Gong F, Wei X, Yao S, Liu D, Teng X, Ye N, Zhang N, Zhou X, Li J, Yang L, Zhao X, Yang L, Xiang R, Wei Y. Ammonia drives dendritic cells into dysfunction. J Immunol. 2014;193:1080–1089. [PubMed]
58. Reinehr R, Gorg B, Becker S, Qvartskhava N, Bidmon HJ, Selbach O, Haas HL, Schliess F, Haussinger D. Hypoosmotic swelling and ammonia increase oxidative stress by NADPH oxidase in cultured astrocytes and vital brain slices. Glia. 2007;55:758–771. [PubMed]
59. Kosenko E, Venediktova N, Kaminsky Y, Montoliu C, Vicente Felipo Sources of oxygen radicals in brain acute ammonia intoxication in vivo. Brain Res. 2003:193–200. [PubMed]
60. Zhang DD, Hannink M. Distinct cysteine residues in keap1 are required for keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventative agents and oxidative stress. Mol Cell Biol. 2003;23:137–151. [PMC free article] [PubMed]
61. Thrane VR, Thrane A, Wang F, Cotrina ML, Smith NA, Chen M, Xu W, Kang N, Fujita T, Nagelhus EA, Nedergaard M. Ammonia triggers neuronal disinhibition and seizures by impairing astrocyte potassium buffering. Nat Med. 2013;19:1643–1650. [PMC free article] [PubMed]
62. Bai G, Rama Rao KV, Murthy CR, Panickar AS, Jayakumar AR, Norenberg MD. Ammonia induces the mitochondrial permeability transition in primary cultures of rat astrocytes. J Neurosci Res. 2001;66:981–991. [PubMed]
63. Perkins MW, Wong B, Tressler J, Coggins A, Rodriguez A, Devorak J, Sciuto AM. Assessment of inhaled acute ammonia-induced lung injury in rats. Inhal Toxicol. 2016;28:71–79. [PubMed]
64. McDaniel J, Davuluri G, Hill EA, Moyer M, Runkana A, Prayson R, van Lunteren E, Dasarathy S. Hyperammonemia results in reduced muscle function independent of muscle mass. Am J Physiol Gastrointest Liver Physiol. 2016;310:G163–G179. [PubMed]
65. Slowik MR, Min W, Ardito T, Karsan A, Kashgarian M, Prober JS. Evidence that tumor necrosis factor triggers apoptosis in human endothelial cells by interleukin-1-converting enzyme-like protease-dependent and independent pathways. Lab Invest. 1997;77:257–267. [PubMed]
66. Brouard S, Berberat PO, Tobiasch E, Seldon MP, Bach FH, Soares MP. Heme oxygenase-1-derived carbon monoxide requires the activation of transcription factor NF-kappa B to protect endothelial cells from tumor necrosis factor-alpha-mediated apoptosis. J Biol Chem. 2002;277:17950–17961. [PubMed]
67. Abusneina A, Gauthier ER. Ammonium ions improve the survival of glutamine-starved hybridoma cells. Cell Biosci. 2016;6:23. [PMC free article] [PubMed]
68. De Bock K, Georgiadou M, Schoors S, Kuchnio A, Wong BW, Cantelmo AR, Quaegebeur A, Ghesquire B, Cauwenberghs S, Eelen G, Phng LK, Betz I, Tembuyser B, Brepoels K, Welti J, Geudens I, Segura I, Cruys B, Bifari F, Decimo I, Blanco R, Wyns S, Vangindertael J, Rocha S, Collins RT, Munck S, Daelemans D, Imamura H, Rider M, Van Veldhoven PP, Schuit F, Bartrons R, Hofkens J, Fraisl P, Telang S, DeBerardinis RJ, Schoonjans L, Vinckier S, Chesney J, Gerhardt H, Dewerchin M, Carmeliet P. Role of PFKFB3-driven glycolysis in vessel sprouting. Cell. 2013;154:651–663. [PubMed]
69. Jayakumar AR, Tong XY, Curtis KM, Ruiz-Cordero R, Abreu MT, Norenberg MD. Increased toll-like receptor 4 in cerebral endothelial cells contributes to the astrocyte swelling and brain edema in acute hepatic encephalopathy. J Neurochem. 2014;128:890–903. [PMC free article] [PubMed]
70. Nguyen JH, Yamamoto S, Steers J, Sevelever D, Lin W, Shimojima N, Castenedes-Casey M, Genco P, Golde T, Richelson E, McKinney M, Eckman CB. Matrix metaooproteinase-9 contributes to brain extravasation and edema in fulminant hepatic failure mice. J Hepatol. 2006;44:1105–1114. [PMC free article] [PubMed]
71. Cauli O, Lopez-Larrubia P, Rodrigo R, Agusti A, Boix J, Nieto-Charques L, Cerdan S, Felipo V. Brain region-selective mechanisms contribute to the progression of cerebral alterations in acute liver failure in rats. Gastroenterology. 2011;140:638–645. [PubMed]
72. Chen F, Ohashi N, Li W, Eckman C, Nguyen JH. Disruptions of occludin and claudin-5 in brain endothelial cells in vitro and in brains of mice with acute liver failure. Hepatology. 2009;50:1914–1923. [PMC free article] [PubMed]
73. Belanger M, Asashima T, Ohtsuki S, Yamaguchi H, Ito S, Terasaki T. Hyperammonemia induces transport of taurine and creatine and suppresses claudin-12 gene expression in brain capillary endothelial cells in vitro. Neurochem Int. 2007:95–101. [PubMed]
74. Skowronska M, Zielinska M, Wojcik-Stanaszek L, Ruszkiewicz J, Milatovic D, Aschner M, Albrecht J. Ammonia increases paracellular permeability of rat brain endothelial cells by a mechanism encompassing oxidative/nitrosative stress and activation of matrix metalloproteinases. J Neurochem. 2012;121:125–134. [PMC free article] [PubMed]
75. Alfieri A, Srivastava S, Siow RC, Cash D, Modo M, Duchen MR, Fraser PA, Williams SC, Mann GE. Sulforaphane preconditioning of the Nrf2/HO-1 defense pathway protects the cerebral vasculature against blood-brain barrier disruption and neurological deficits in stroke. Free Radic Biol Med. 2013;65:1012–1022. [PubMed]
76. Lu X, Chen-Roetling J, Regan RF. Systemic hemin therapy attenuates blood-brain barrier disruption after intracerebral hemorrhage. Neurobiol Dis. 2014;70:245–251. [PMC free article] [PubMed]
77. Wang YF, Gu YT, Qin GH, Zhong L, Meng YN. Curcumin ameliorates the permeability of the blood-brain barrier during hypoxia by upregulating heme oxygenase-1 expression in brain microvascular endothelial cells. J Mol Neurosci. 2013;51:344–351. [PubMed]
78. Lin Y, Vreman HJ, Wong Rj, Tjoa T, Yamauchi T, Noble-Haeusslein LJ. Heme oxygenase-1 stabilizes the blood-spinal cord barrier and limits oxidative stress and white matter damage in the acutely injured murine spinal cord. J Cereb Blood Flow Metab. 2007;27:1010–1021. [PubMed]
79. Wolburg H, Noell S, Mack A, Wolberg-Buchholz K, Fallier-Becker P. Brain endothelial cells and the gliovascular compartment. Cell Tissue Res. 2009;335:75–96. [PubMed]
80. Kawamura K, Ishikawa K, Wada Y, Kimura S, Matsumoto H, Kohro T, Itabe H, Kodama T, Maruyama Y. Bilirubin from heme oxygenase-1 attenuates vascular endothelial cell activation and dysfunction. Arterioscler Thromb Vasc Biol. 2005;25:155–160. [PubMed]
81. Liu J, Wang L, Tian XY, Liu L, Wong WT, Zhang Y, Han QB, Ho HM, Wang N, Wong SL, Chen ZY, Yu J, Ng CF, Yao X, Huang Y. Unconjugated bilirubin mediates heme oxygenase-1-induced vascular benefits in diabetic mice. Diabetes. 2015;64:1564–1575. [PubMed]
82. Han F, Guo Y, Xu L, Hou N, Han F, Sun X. Induction of heamoxygenase-1 directly improves endothelial function in isolated aortas from obese rats through the Ampk-pi3k/Akt-Enos pathway. Cell Physiol Biochem. 2015;36:1480–1490. [PubMed]
83. Zuidema MY, Peyton KJ, Fay WP, Durante W, Korthuis RJ. Antecedent hydrogen sulfide elicits an anti-inflammatory phenotype in postischemic murine small intestine: role of heme oxygenase-1. Am J Physiol Heart Circ Physiol. 2011;301:H888–H894. [PubMed]