PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2016 November 15; 90(22): 10259–10270.
Published online 2016 October 28. Prepublished online 2016 September 7. doi:  10.1128/JVI.01292-16
PMCID: PMC5105661

Activation of the RLR/MAVS Signaling Pathway by the L Protein of Mopeia Virus

B. Williams, Editor
Hudson Institute of Medical Research

ABSTRACT

The family Arenaviridae includes several important human pathogens that can cause severe hemorrhagic fever and greatly threaten public health. As a major component of the innate immune system, the RLR/MAVS signaling pathway is involved in recognizing viral components and initiating antiviral activity. It has been reported that arenavirus infection can suppress the innate immune response, and NP and Z proteins of pathogenic arenaviruses can disrupt RLR/MAVS signaling, thus inhibiting production of type I interferon (IFN-I). However, recent studies have shown elevated IFN-I levels in certain arenavirus-infected cells. The mechanism by which arenavirus infection induces IFN-I responses remains unclear. In this study, we determined that the L polymerase (Lp) of Mopeia virus (MOPV), an Old World (OW) arenavirus, can activate the RLR/MAVS pathway and thus induce the production of IFN-I. This activation is associated with the RNA-dependent RNA polymerase activity of Lp. This study provides a foundation for further studies of interactions between arenaviruses and the innate immune system and for the elucidation of arenavirus pathogenesis.

IMPORTANCE Distinct innate immune responses are observed when hosts are infected with different arenaviruses. It has been widely accepted that NP and certain Z proteins of arenaviruses inhibit the RLR/MAVS signaling pathway. The viral components responsible for the activation of the RLR/MAVS signaling pathway remain to be determined. In the current study, we demonstrate for the first time that the Lp of MOPV, an OW arenavirus, can activate the RLR/MAVS signaling pathway and thus induce the production of IFN-I. Based on our results, we proposed that dynamic interactions exist among Lp-produced RNA, NP, and the RLR/MAVS signaling pathway, and the outcome of these interactions may determine the final IFN-I response pattern: elevated or reduced. Our study provides a possible explanation for how IFN-I can become activated during arenavirus infection and may help us gain insights into the interactions that form between different arenavirus components and the innate immune system.

INTRODUCTION

Arenaviruses are enveloped viruses with bisegmented, negative-sense, single-stranded RNA genomes comprising a larger (L) and a smaller (S) segment. The S segment encodes the viral glycoprotein precursor (GPC) and the nucleoprotein (NP), and the L segment encodes a small RING finger protein (Z) and the viral RNA-dependent RNA polymerase (RdRp) (L polymerase [Lp]). The GPC is posttranslationally processed into stable signal peptide (SSP), GP1, and GP2, which form spikes on the viral surface and mediate cell entry via receptor-mediated endocytosis (1, 2). NP, the major structural protein, is associated with viral RNA. The Z protein drives arenavirus budding (3) and can influence viral RNA synthesis (4, 5). Lp, similar to other viral RNA-dependent RNA polymerases, mediates both viral genome replication and mRNA transcription (6, 7).

The family Arenaviridae can be divided into two genera, Mammarenavirus and Reptarenavirus (8). Mammarenavirus members can be classified into two groups mainly based on antigenic properties and geographical distribution: Old World (OW) and New World (NW) arenaviruses (8). The OW arenaviruses include Lassa virus (LASV), lymphocytic choriomeningitis virus (LCMV), and Mopeia virus (MOPV), and the NW arenaviruses include Junin virus (JUNV) and Machupo virus (MACV). Arenaviruses cause chronic and asymptomatic infections in rodents, but several arenaviruses, such as LASV, JUNV, and MACV, cause severe hemorrhagic fever (HF) in infected humans (9,11) and are serious threats to public health. There are no FDA-approved vaccines for arenaviruses. Candid#1, a JUNV live-attenuated strain, is an effective vaccine against Argentine HF (12). Another vaccine candidate, ML29, a reassortant containing the L genomic segment of MOPV and the S genomic segment of LASV, has exhibited promising safety and efficacy profiles in animal models, including nonhuman primates (13,15).

The innate immune system, the first line of host defense against virus infection, utilizes pattern recognition receptors (PRRs) to recognize invading viruses and initiate host antiviral responses (16). Three classes of PRRs, namely, Toll-like receptors (TLRs), retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs), and NOD-like receptors (NLRs), are involved in the recognition of virus-specific components (17). During RNA virus infection, cytosolic viral RNAs are initially recognized by the RLRs RIG-I and MDA5 (18). Then, RIG-I and MDA5 translocate to mitochondria, where they activate a downstream mediator, mitochondrial antiviral signaling protein (MAVS) (also called VISA, CARDIF, or IPS-1) (19,22). Activated MAVS triggers intracellular signaling cascades, which result in the nuclear translocation of the transcription factors IRF3, IRF7, and NF-κB and the subsequent production of type I interferons (IFN-I) and proinflammatory cytokines (23).

Distinct interferon responses are observed when hosts are infected with different arenaviruses in vitro (24,26). It has been reported that multiple arenaviruses can suppress IFN-I production in infected cells (27), and this is because most, if not all, arenavirus NP and pathogenic arenavirus Z proteins can disrupt the RLR/MAVS signaling pathway (26,30). However, recent studies have indicated that the NW arenaviruses JUNV and MACV can activate IFN-I production in a RIG-I-dependent manner (24, 25, 31). Considering that the NP and Z proteins possess inhibitory functions, the viral components responsible for the activation of the RLR/MAVS signaling pathway remain to be determined. In order to explain the activation of IFN-I observed in LCMV-infected mice, Zhou et al. performed an experiment to prove that LCMV genomic RNA strongly activates IFN-I production through the RLR/MAVS signaling pathway and that this activation can be blocked by NP (32). Huang et al. found activation of IFN-I in MACV-infected cells, and based on their results, they proposed that the activation may occur in response to a “danger signal” associated with MACV replication rather than in response to an immediate-early signal, such as incoming genomic RNA (25).

MOPV is closely related to LASV, sharing 75% amino acid identity (33). Although MOPV and LASV are isolated from the same reservoir, MOPV is not pathogenic to humans (34). It has been reported that human macrophages produce IFN-I in response to MOPV infection (35), although how this production is activated remains unknown. In the current study, we demonstrate for the first time that the Lp of MOPV, an OW arenavirus, can activate the RLR/MAVS signaling pathway and thus induce the production of IFN-I.

MATERIALS AND METHODS

Cells and viruses.

BHK-21, HEK 293T, HeLa, and Vero E6 cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco) and penicillin-streptomycin. Recombinant vesicular stomatitis virus-green fluorescent protein (rVSV-GFP) and Sendai virus (SeV) were provided by Hong-Bing Shu (Wuhan University, Wuhan, China). SeV was grown in 10-day-old embryonated eggs.

Reagents and antibodies.

Mouse monoclonal antibody against the Myc tag (Sigma); mouse monoclonal antibody against double-stranded RNA (dsRNA) (J2; English & Scientific Consulting Kft); rabbit polyclonal antibody against the Myc tag (Cell Signaling Technology); rabbit polyclonal antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), lamin B1, MAVS, RIG-I, MDA5, and Flag tag (ProteinTech, Wuhan, China); and Cy5-labeled antibody to mouse IgG and DyLight488-labeled antibody to rabbit IgG (KPL) were purchased from the indicated manufacturers.

All small interfering RNA (siRNA) oligonucleotides used in the study were synthesized by GenePharma (Suzhou, China), and the sequences were as follows (5′-3′): siMAVS#1, CCAGAGGAGAAUGAGUAUAAG; siMAVS#2, UUUACCAAGGGUUGGAUAUAU; siRIG-I#1, GCAAGCCUUCCAGGAUUAUAU; siRIG-I#2, AUCACGGAUUAGCGACAAAUU; siRIG-I#3, AGCACUUGUGGACGCUUUAAA; siMDA5#1, CGCAAGGAGUUCCAACCAUUU; siMDA5#2, CCAACAAAGAAGCAGUGUAUA; siMDA5#3, CCAUCGUUUGAGAACGCUCAU. All the primers used for quantitative real-time PCR were synthesized by Sangon Biotech (Shanghai, China).

Constructs.

IFN-stimulated response element (ISRE) and IFN-β promoter and firefly luciferase reporter plasmids (pFL-ISRE and pFL-IFN-β), a Renilla luciferase control plasmid (pRL-TK), and mammalian cell expression plasmids for Flag-IRF3 and Flag-MAVS were provided by Hong-Bing Shu (Wuhan University, Wuhan, China). The plasmid pRF42 was provided by Fei Deng (Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China).

The Lp sequences of MOPV AN20410 (NC_006575.1) and LASV strain Josiah (HQ688672) were obtained from GenBank, and the corresponding cDNAs were chemically synthesized by Sangon Biotech (Shanghai, China). The genes encoding MOPV Lp and LASV Lp (here referred to as LpMOPV and LpLASV, respectively) were subcloned into a pCAGGs expression vector, and the genes encoding LpMOPV, LpLASV, NPLASV, and MAVS were subcloned into a pCMV-Myc expression vector, which has an N-terminal Myc tag. Point mutations in LpMOPV were generated by mutagenic PCR, and the resulting PCR products were subcloned into expression vectors. The antisense S genome of LASV (HQ688672) was constructed by recombinant PCR and subcloned into the pRF42 plasmid (pRF42-SagLASV). The GPC open reading frame (ORF) in pRF42-SagLASV was then replaced with the firefly luciferase ORF in the antisense orientation using an In-Fusion HD cloning kit (Clontech) according to the manufacturer's instructions to obtain pRF42-SagLASVFireflyΔGPC, containing the S minigenome (MG) of LASV (see Fig. 7C). All the plasmids were confirmed by sequence analysis.

FIG 7
The activation of IFN-I by Lp requires its RdRp activity. (A) Alignment of the L proteins of MOPV AN20410, LCMV JN872494, and LASV strain Josiah. Amino acid residues are numbered according to their positions in the L protein of MOPV. Amino acids identical ...

Transfection.

Cells were seeded in plates and then transfected with the indicated amounts of expression plasmids or siRNAs using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. In the same experiment, empty-control plasmid or negative-control RNA interference (RNAi) was added to ensure that each transfection received equivalent amounts of total DNA or RNAi. One or 2 days after transfection, cells were collected, and transfection efficiency was measured by Western blotting (WB) or quantitative real-time PCR.

Reporter assays.

For reporter gene assays, HEK 293T cells seeded in 24-well plates were cotransfected with reporter plasmids and the indicated amounts of expression plasmids or siRNAs. pRL-TK was added to each transfection mixture to normalize the transfection efficiency. One or 2 days after transfection, the cells were lysed, and luciferase assays were performed using a dual-specific luciferase assay kit (Promega).

Replicon system assay.

Our preliminary data indicated that NPLASV and LpMOPV are sufficient to achieve replication and transcription of the LASV S genome. In this study, LASV S MG and NP were used to assess the RdRp activity of LpMOPV. BHK-21 cells seeded in 24-well plates were cotransfected with pRF42-SagLASVFireflyΔGPC, pCMV-Myc-NPLASV, and pCMV-Myc-LpMOPV or mutated LpMOPV. One or 2 days after transfection, the cells were lysed, and luciferase assays were performed using a firefly luciferase assay kit (Promega).

Viral plaque assay.

HEK 293T cells transfected with the indicated plasmids for 24 h were infected with rVSV-GFP at a multiplicity of infection (MOI) of 1, and the culture medium was changed at 1 h postinfection (p.i.). Tissue culture supernatant (TCS) was collected at 12 and 24 h p.i. and added to Vero E6 cells preseeded in 24-well plates. At 1 h p.i., 2% methylcellulose was overlaid, and the plates were incubated for 3 days. The overlay was removed, and the cells were fixed with 4% paraformaldehyde for 30 min and then stained with 1% crystal violet for 30 min. The resultant plaques were counted, averaged, and multiplied by the dilution factor to determine the viral titer as plaque-forming units (PFU) per milliliter.

RNA extraction and quantitative real-time PCR.

Total cellular RNA was extracted with TRIzol reagent (Invitrogen), and small RNA (20 to 200 nucleotides [nt]) was extracted with RNAiso for small RNA (TaKaRa) according to the manufacturer's instructions. Reverse transcription of RNA was performed using a reverse transcription master mix (TaKaRa). Quantitative real-time PCR was performed with an Applied Biosystems Step-One real-time PCR system. SYBR green mix (TaKaRa) and gene-specific primers were used in a 20-μl volume. The intracellular mRNA level of a targeted protein was calculated using GAPDH as the endogenous control and an untreated control sample as the reference.

Subcellular fractionation.

Subcellular fractionation was performed with a nuclear and cytoplasmic protein extraction kit (Beyotime, Shanghai, China) as described previously (36). Briefly, cells were collected and washed with prechilled phosphate-buffered saline (PBS). The cell pellets were resuspended in prechilled buffer A from the nuclear and cytoplasmic protein extraction kit and incubated on ice for 20 min. Then, buffer B was added, and the mixture was vortexed and centrifuged at 500 × g for 5 min. The supernatant was collected as the cytoplasmic fraction. The pellet was resuspended in buffer C, incubated on ice for 10 min, and centrifuged at 13,200 × g for 20 min. The supernatant was then collected as the nuclear fraction.

Western blot analysis.

Equal amounts of protein samples were subjected to SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore). After blocking with Tris-buffered saline–Tween 20 buffer (TBST) containing 5% nonfat milk, the membranes were incubated with primary antibodies and the corresponding horseradish peroxidase-conjugated secondary antibodies (ProteinTech, Wuhan, China). Protein bands were detected by enhanced chemiluminescence (ECL) (Millipore, Billerica, MA). Band intensities were measured with Quantity One software (Thermo).

Immunofluorescence and confocal microscopy.

HeLa cells grown on glass coverslips in 24-well plates were fixed in 4% formaldehyde, permeabilized in 0.3% (vol/vol) Triton X-100 (BioSharp, Hefei, China), and blocked with 5% FBS (Gibco). The cells were then incubated with primary antibodies for 2 h at room temperature and stained with secondary antibodies for 1 h at room temperature. DAPI (4′,6-diamidino-2-phenylindole) (Beyotime, Shanghai, China) was used to visualize cell nuclei. Image acquisition was performed with an A1 MP+ multiphoton confocal microscope (Nikon).

RESULTS

LpMOPV activates IFN-I production.

To investigate the effect of LpMOPV on IFN-I production, HEK 293T cells were cotransfected with pFL-IFN-β and pCMV-Myc-LpMOPV or pCMV-Myc-LpLASV. At 24 h after transfection, the cells were lysed to measure intracellular luciferase activity. The expression of LpMOPV and LpLASV was confirmed by Western blotting (Fig. 1A), and as shown in Fig. 1B, the expression of Myc-LpMOPV activated the IFN-β promoter, while the expression of Myc-LpLASV did not. Additionally, Myc-LpMOPV activated the IFN-β promoter in a dose-dependent manner (Fig. 1C). Furthermore, HEK 293T cells were transfected with pCMV-Myc-LpMOPV, and the intracellular mRNA level of IFNB1 was measured by quantitative real-time PCR. As shown in Fig. 1D, expression of Myc-LpMOPV increased the intracellular IFNB1 mRNA level. These results indicate that intracellular expression of Myc-LpMOPV activates IFN-I production.

FIG 1
LpMOPV activates IFN-I production. (A) HEK 293T cells (1 × 106) were transfected with pCMV-Myc (Vec), pCMV-Myc-LpMOPV, or pCMV-Myc-LpLASV (2 μg each). At 24 h posttransfection, the cells were lysed, and cytosol proteins were subjected ...

The above-described experiments were performed with Myc-tagged LpMOPV. To confirm our results, we performed the same experiment with wild-type LpMOPV using pCAGGs-LpMOPV. Again, we observed activation of the IFN-β promoter in LpMOPV-expressing cells (Fig. 1E). To exclude the possibility that the activation was caused by Lp mRNA, we constructed the mutant plasmid Mycstop-LpMOPV, which contains a stop codon localized 12 bp downstream of the Myc start codon (Fig. 1F). Transfection of this plasmid leads to the production of mRNA containing LpMOPV mRNA without producing the LpMOPV protein. As shown in Fig. 1G, the IFN-β promoter was not activated in the Mycstop-LpMOPV-transfected cells, suggesting that IFN-I production is activated by Lp protein but not Lp mRNA.

LpMOPV activates ISGs and promotes antiviral activity.

After being produced, IFN-I is secreted and then binds to the cell surface receptor IFNAR to initiate a signaling cascade that subsequently induces expression of interferon-stimulated gene (ISG) expression, which is regulated by ISRE sites in the promoter (37). We found that ISRE promoter activity was higher in HEK 293T cells expressing LpMOPV (Fig. 2A), indicating that LpMOPV can activate the ISRE promoter. We then performed quantitative real-time PCR to assess the relative intracellular mRNA levels of several ISGs. As shown in Fig. 2B, intracellular mRNA levels of ISG15, ISG56, and OASL were higher in cells expressing LpMOPV, indicating that LpMOPV can activate ISGs.

FIG 2
LpMOPV activates the ISRE promoter, ISGs, and antiviral activity. (A) LpMOPV activates the ISRE promoter. HEK 293T cells (1 × 105) were transfected with pFL-ISRE (100 ng), pFL-TK (50 ng), and the indicated pCMV-Myc plasmids (200 ng each). At 24 ...

To further explore whether the elevated IFN-I levels are correlated with antiviral activity, we performed virus inhibition assays with VSV. To accomplish this, Myc-LpMOPV-expressing HEK 293T cells were infected with rVSV-GFP. At 12 h p.i., we found only low GFP intensity in LpMOPV-expressing cells (Fig. 2C), suggesting that VSV replication was inhibited. The cell supernatants were collected at 12 and 24 h p.i., and the virus titer in TCS was determined with a plaque assay. As shown in Fig. 2D, the VSV titer in TCS was significantly reduced in cells expressing LpMOPV, suggesting that LpMOPV promotes antiviral activity.

LpMOPV activates the RLR/MAVS signaling pathway via MAVS, RIG-I, and MDA5.

Arenavirus NP inhibits the activation of the RLR/MAVS signaling pathway and therefore blocks nuclear translocation of IRF3 (38), which is a prerequisite for the activation of the IFN-I promoter. We therefore examined whether LpMOPV can activate RLR/MAVS signaling by measuring the nuclear translocation of IRF3. First, HEK 293T cells were cotransfected with Flag-IRF3 and pCMV-Myc-LpMOPV and then collected at 36 h posttransfection. The collected cells were then fractionated into nuclear and cytoplasmic fractions and analyzed by Western blotting. As shown in Fig. 3A, the intensity of IRF3 in the nuclear fraction was much higher in the cells expressing LpMOPV. We also monitored the nuclear translocation of IRF3 using immunofluorescence analysis (IFA). To accomplish this, HeLa cells were transfected with Flag-IRF3 and pCMV-Myc-LpMOPV, and 36 h posttransfection, the cells were fixed and the subcellular localization patterns of IRF3 (green) and Lp (red) were detected by IFA. As shown in Fig. 3B, accumulation of IRF3 was detected in the nuclei of cells expressing Myc-LpMOPV. Both WB and IFA indicated that LpMOPV promotes the nuclear translocation of IRF3.

FIG 3
LpMOPV promotes the nuclear translocation of IRF3. (A) HEK 293T cells were cotransfected with Flag-IRF3 and pCMV-Myc (Vec), pCMV-Myc-NPLASV (NP), or pCMV-Myc-LpMOPV (Lp). At 40 h posttransfection, the cells were collected and then fractionated into nuclear ...

The observed promotion of the nuclear translocation of IRF3 suggests that LpMOPV acts upstream of IRF3. As an important adaptor protein, MAVS is located upstream of IRF3 in the RLR/MAVS signaling pathway (19). We then examined the effects of knockdown or overexpression of MAVS on LpMOPV-mediated IFN-I activation. Two siRNAs against MAVS were designed and shown to decrease intracellular protein expression levels of MAVS and therefore were used in subsequent analyses (Fig. 4A). We found that knockdown of MAVS reduced IFN-β promoter activity in SeV-infected cells (Fig. 4B). Next, HEK 293T cells were cotransfected with plasmids expressing LpMOPV and siRNAs against MAVS. At 24 h p.i., knockdown of MAVS blocked LpMOPV-mediated activation of the IFN-β promoter (Fig. 4C) and reduced intracellular mRNA levels of IFNB1 in LpMOPV-expressing cells (Fig. 4D), while overexpression of MAVS increased IFN-β promoter activity in cells expressing LpMOPV (Fig. 4E), suggesting that MAVS is important for LpMOPV-mediated activation of IFN-I. However, no direct interaction between Myc-LpMOPV and Flag-MAVS was observed in our coimmunoprecipitation experiment. The activation of IFN-β promoter activity by IRF3 or IKK-ε was unaffected by MAVS knockdown (Fig. 4F), possibly because IRF3 and IKK-ε are located downstream of MAVS in the RLR/MAVS signaling pathway. The need for MAVS in the LpMOPV-mediated activation of IFN-I suggests that LpMOPV may have a function upstream of MAVS.

FIG 4
Activation of IFN-I production by LpMOPV requires MAVS. (A) Knockdown efficiencies of siRNAs against MAVS. HEK 293T cells were transfected with negative-control siRNA (NC) or siRNA against MAVS. At 24 h posttransfection, the cells were collected. Intracellular ...

Next, we examined whether RIG-I and MDA5, two proteins upstream of MAVS in the RLR/MAVS signaling pathway, influence IFN-I activation mediated by LpMOPV. First, siRNAs against RIG-I were designed and tested for their knockdown efficiencies (Fig. 5A). We found that knockdown of RIG-I can reduce SeV-induced IFN-β promoter activity (Fig. 5B). Then, HEK 293T cells were cotransfected with plasmids expressing LpMOPV and siRNAs against RIG-I. Activation of IFN-I was assessed by measuring the relative intracellular mRNA levels of IFNB1 and IFN-β promoter activity. As shown in Fig. 5C and andD,D, the knockdown of RIG-I inhibited the LpMOPV-mediated activation of IFN-I production. We also observed that knockdown of MDA5 inhibited LpMOPV-mediated activation of IFN-I production (Fig. 5E to toHH).

FIG 5
Both RIG-I and MDA5 play roles in the LpMOPV-mediated activation of IFN-I. (A) Knockdown efficiencies of siRNAs against RIG-I. HEK 293T cells were transfected with negative-control siRNA (NC) or siRNA against RIG-I. The cells were collected at 24 h posttransfection. ...

Activation of IFN-I by LpMOPV is associated with its RdRp activity.

Our results shown above indicate that both RIG-I and MDA5 play important roles in the LpMOPV-mediated activation of IFN-I, suggesting that LpMOPV may function upstream of both RIG-I and MDA5. MDA5 detects long dsRNA, a typical intermediate formed during the replication of single-stranded RNA viruses, whereas RIG-I detects short, blunt-ended dsRNA and the 5′-triphosphate moiety of viral RNAs (39,42). We therefore explored whether the intracellular expression of LpMOPV alone can produce interferon-inducing RNAs. Both total RNAs and small RNAs were isolated from LpMOPV-expressing cells. We found that the amounts of RNAs that were extracted from LpMOPV-expressing cells and the control cells were virtually identical. The small RNAs extracted from LpMOPV-expressing cells may contain small RNAs produced by Lp and cell factors, while small RNAs extracted from vector-transfected cells may contain only small RNAs produced by cell factors. Then, equal amounts of RNA were transfected into HEK 293T cells. As shown in Fig. 6A, in the small-RNA-transfected group, IFN-β promoter activity was much higher in LpMOPV-expressing cells but not in LpLASV-expressing cells, suggesting that small RNAs generated in LpMOPV-expressing cells can activate the production of IFN-I. However, in the total-RNA-transfected group, no significant activation of the IFN-β promoter was observed in LpMOPV-expressing cells, and this may be because, among the total RNAs transfected, the level of the interferon-inducing small RNAs was not high enough to trigger significant levels of IFN-I production.

FIG 6
LpMOPV generates IFN-I-inducing RNAs. (A) Influence of total RNAs and small RNAs on IFN-β promoter activity. HEK 293T cells were transfected with the indicated plasmids. At 48 h posttransfection, the cells were collected, and intracellular total ...

Because both RIG-I and MDA5 recognize dsRNAs, we next determined whether endogenous dsRNA was present in LpMOPV-expressing cells. HeLa cells were transfected with plasmids expressing LpMOPV, fixed, and incubated with anti-dsRNA J2 antibody, a commercial antibody widely used to detect dsRNA (43). dsRNAs are reportedly difficult to detect in negative-strand RNA virus-infected cells (44), and the dsRNA signal detected by IFA was very weak in LCMV-infected Vero B6 cells (45). As shown in Fig. 6B, the dsRNA signal was weak in LpMOPV-expressing cells, suggesting that the dsRNAs produced by RdRp proteins of arenaviruses may not be easily recognized by the anti-dsRNA antibody or the level of dsRNA may be low. However, the detection of dsRNAs here suggests that expression of LpMOPV alone may result in the production of dsRNAs, even in the absence of viral genomic RNA.

The production of viral RNA during RNA virus replication requires the RdRp activity of the viral polymerase. We therefore explored whether the RdRp activity of LpMOPV is essential for the activation of IFN-I. Three mutants of LpMOPV, D1349A, E1400A, and G1409A, were constructed (Fig. 7A). Western blot analysis indicated that the three mutations did not affect LpMOPV expression (Fig. 7B). The D1349 residue in the SSDD sequence is highly conserved and vital for RdRp activity (46, 47). Alignment of the RdRp domains of LpMOPV and LpLASV indicated that LpMOPV E1400 corresponds to LpLASV E1385, whereas G1409 corresponds to LpLASV G1394 (Fig. 7A), and both LpLASV E1385A and G1394A can reduce RdRp activity (47). To determine if LpMOPV D1349A, E1400A, and G1409A affect RdRp activity, we constructed a LASV S MG in the antisense orientation with GPC deleted, denoted pRF42-SagLASVFireflyΔGPC, in which the GPC gene was replaced by a negative-sense copy of the firefly luciferase reporter gene (Fig. 7C). Our unpublished data indicate that LpMOPV and NPLASV are sufficient for the replication and transcription of the LASV S genome. To confirm the RdRp activity of LpMOPV, BHK-21 cells were cotransfected with plasmids expressing the LASV S MG (pRF42-SagLASVFireflyΔGPC), NPLASV, and LpMOPV or LpMOPV mutants, and at 24 h posttransfection, the cells were lysed to measure intracellular firefly luciferase activity. As shown in Fig. 7D, firefly luciferase activity was detected in cells expressing wild-type LpMOPV, whereas firefly luciferase activity was much lower in the cells transfected with the LpMOPV E1400A or LpMOPV G1409A mutant, and no activity was detected in LpMOPV D1349A-expressing cells. These results suggest that both the E1400A and G1409A mutations reduce the RdRp activity of LpMOPV, while the D1349A mutation abolishes RdRp activity.

We then analyzed the effects of LpMOPV D1349A, E1400A, and G1409A on the activation of IFN-I. Cells were transfected with the Lp mutants, and activation of IFN-I was assessed by measuring the relative intracellular mRNA levels of IFNB1 and the extent of IFN-β promoter activity. As shown in Fig. 7E and andF,F, compared to wild-type LpMOPV, the activation of IFN-I was blocked by the LpMOPV mutation D1349A and was reduced by mutations E1400A and G1409A. We also assessed the effects of the Lp mutants on the activity of the ISRE promoter and on several ISGs and observed that D1349A blocked both ISRE promoter activity and intracellular mRNA levels of ISG15, ISG56, and OASL, while E1400A and G1409A significantly decreased these parameters (Fig. 7G and andH).H). These results suggest that the activation of IFN-I and downstream effectors by LpMOPV is associated with its RdRp activity.

DISCUSSION

Interactions between arenaviruses and the innate immune system are complex. Distinct innate immune responses are observed when hosts are infected with different arenaviruses (25, 35, 48, 49). In patients with severe symptoms, LASV infections are generally immunosuppressive without activated IFN-I responses (25, 50, 51), whereas elevated IFN-I production is observed in JUNV-infected patients. JUNV infection reportedly induces the IFN-I response in a RIG-I-dependent manner in vitro (31). The mechanisms by which arenavirus infection induces distinct IFN-I responses remain unclear. It has been widely accepted that NP and certain Z proteins of arenaviruses inhibit the RLR/MAVS signaling pathway and decrease IFN-I production during infection. However, this seems to contradict previous observations of elevated IFN-I levels in cells or mice infected with certain arenaviruses, such as JUNV (31), MACV (25), LCMV (32), and MOPV (35). To explain the IFN-I activation that has been observed in LCMV-infected mice, Zhou et al. performed experiments to prove that LCMV genomic RNA can promote IFN-I production via the RLR/MAVS signaling pathway and that this genomic-RNA-mediated activation of IFN-I production can be inhibited by LCMV NP (32). In the above-mentioned study, it was proposed that dynamic interactions existed among LCMV genomic RNA, NP, and host IFN-I modulators, including MDA5 and RIG-I, and that these interactions could determine the final pattern of IFN-I response.

Viral RdRp proteins, which are the largest proteins encoded by viral genomes in most RNA viruses, mainly participate in viral genome replication and mRNA transcription. In recent years, viral RdRp proteins have also been reported to participate in multiple processes other than RNA synthesis. For example, in nearly all flaviviruses, NS5, the flaviviral RdRp protein, can inhibit pathways associated with IFN-I induction or signaling (52, 53), while the Japanese encephalitis virus (JEV) NS5 protein can interact with the mitochondrial trifunctional protein and impairs fatty acid β-oxidation (54). Studies since the 1990s have indicated that expression of viral RdRp can activate the immune system and confer resistance to viral infection on plant cells (55,57). Several research groups have recently reported that expression of viral RdRps can also activate the innate immune system in mammalian cells (28, 58, 59). The RdRps of hepatitis C virus (HCV), Semliki Forest virus (SFV), and Theiler's murine encephalitis virus (TMEV) produce dsRNAs in transfected cells even in the absence of viral genomic RNA, and these dsRNAs, as pathogen-associated molecular patterns (PAMPs), are recognized by PRRs, which then trigger RLR/MAVS signaling pathway activation and induce IFN-I production.

In this study, we performed experiments to demonstrate that the Lp of MOPV, an OW arenavirus, can activate the RLR/MAVS signaling pathway and induce IFN-I production. We also determined that both MDA5 and RIG-I play important roles in this activation and found that the activation was associated with Lp RdRp activity (Fig. 5 and and7).7). We hypothesize that, in the absence of viral genomic RNA and NP, Lp is recruited by host transcription factors or certain host mRNA structures to perform RNA-dependent RNA synthesis, resulting in the production of “abnormal RNAs,” which are subsequently recognized by PRRs. Our further experiments indicated that small RNAs extracted from Lp-expressing cells can activate IFN-I production (Fig. 6). Similar results were observed in a previous study, which reported that HCV RdRp used host RNAs as templates to produce IFN-I-inducing RNAs and subsequently induced an inflammatory response and liver damage (60). This study analyzed the IFN-I-inducing RNAs by deep sequencing and found that the sequences of these RNAs are distinct among replicates, suggesting the templates of the RNAs were not specific.

During arenavirus infection, a viral replication-transcription complex (RTC) is formed, which is composed of viral RNA, NP, and host cell factors. Lp is then recruited to the RTC to perform RNA synthesis. The abnormal RNAs described here can be synthesized by Lp in the absence of NP and viral RNA, the essential components of the arenavirus RTC. These abnormal RNAs may then be recognized by host cells as a “danger signal,” which was proposed by Huang et al., that can activate IFN-I production and was associated with MACV replication rather than with an immediate-early signal (25). However, whether these RNAs are produced during MOPV infection remains to be determined, and further studies are needed to explain how these RNAs are produced.

It has been reported that human macrophages produced IFN-I in response to MOPV infection. Our preliminary data showed that intracellular expression of MOPV Z and GPC did not affect IFN-I production, suggesting that the activation of IFN-I may be due to the presence of Lp and genomic RNA. As the most abundant viral protein, NP employs multiple strategies to disrupt the RLR/MAVS signaling pathway and inhibit IFN-I production (61,63). Although Lp expression is low in infected cells, the levels of RNAs that can be produced by Lp, including genomic RNA or abnormal RNAs proposed here, have not been determined to date. These RNAs can be recognized by host cells and can subsequently activate the RLR/MAVS signaling pathway and induce IFN-I production. The dynamic interactions that exist among Lp-produced RNA molecules, NP, and the RLR/MAVS signaling pathway may determine the final IFN-I response pattern: elevated or reduced.

In conclusion, this study is the first to demonstrate that Lp of the MOPV arenavirus can activate the RLR/MAVS signaling pathways and promote IFN-I production. Our results will promote further investigations of the interactions between arenaviruses and the innate immune system and should help facilitate the elucidation of arenavirus pathogenesis.

ACKNOWLEDGMENTS

We thank Yan-Yi Wang and Peng Gong (Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China) for assistance with data analysis.

We acknowledge financial support from the Ministry of Science and Technology of China (2016YFC1200400), the Chinese Academy of Sciences (ZDRW-ZS-2016-4), and the National Natural Science Foundation of China (31500144 to L.-K.Z.).

REFERENCES

1. Wright KE, Spiro RC, Burns JW, Buchmeier MJ 1990. Post-translational processing of the glycoproteins of lymphocytic choriomeningitis virus. Virology 177:175–183. doi:.10.1016/0042-6822(90)90471-3 [PubMed] [Cross Ref]
2. Urata S, Yasuda J 2012. Molecular mechanism of arenavirus assembly and budding. Viruses 4:2049–2079. doi:.10.3390/v4102049 [PMC free article] [PubMed] [Cross Ref]
3. Perez M, Craven RC, de la Torre JC 2003. The small RING finger protein Z drives arenavirus budding: implications for antiviral strategies. Proc Natl Acad Sci U S A 100:12978–12983. doi:.10.1073/pnas.2133782100 [PubMed] [Cross Ref]
4. Cornu TI, de la Torre JC 2001. RING finger Z protein of lymphocytic choriomeningitis virus (LCMV) inhibits transcription and RNA replication of an LCMV S-segment minigenome. J Virol 75:9415–9426. doi:.10.1128/JVI.75.19.9415-9426.2001 [PMC free article] [PubMed] [Cross Ref]
5. Jacamo R, Lopez N, Wilda M, Franze-Fernandez MT 2003. Tacaribe virus Z protein interacts with the L polymerase protein to inhibit viral RNA synthesis. J Virol 77:10383–10393. doi:.10.1128/JVI.77.19.10383-10393.2003 [PMC free article] [PubMed] [Cross Ref]
6. Salvato M, Shimomaye E, Oldstone MB 1989. The primary structure of the lymphocytic choriomeningitis virus L gene encodes a putative RNA polymerase. Virology 169:377–384. doi:.10.1016/0042-6822(89)90163-3 [PubMed] [Cross Ref]
7. Lee KJ, Novella IS, Teng MN, Oldstone MB, de La Torre JC 2000. NP and L proteins of lymphocytic choriomeningitis virus (LCMV) are sufficient for efficient transcription and replication of LCMV genomic RNA analogs. J Virol 74:3470–3477. doi:.10.1128/JVI.74.8.3470-3477.2000 [PMC free article] [PubMed] [Cross Ref]
8. Radoshitzky SR, Bao Y, Buchmeier MJ, Charrel RN, Clawson AN, Clegg CS, DeRisi JL, Emonet S, Gonzalez JP, Kuhn JH, Lukashevich IS, Peters CJ, Romanowski V, Salvato MS, Stenglein MD, de la Torre JC 2015. Past, present, and future of arenavirus taxonomy. Arch Virol 160:1851–1874. doi:.10.1007/s00705-015-2418-y [PubMed] [Cross Ref]
9. Ogbu O, Ajuluchukwu E, Uneke CJ 2007. Lassa fever in West African sub-region: an overview. J Vector Borne Dis 44:1–11. [PubMed]
10. Grant A, Seregin A, Huang C, Kolokoltsova O, Brasier A, Peters C, Paessler S 2012. Junin virus pathogenesis and virus replication. Viruses 4:2317–2339. doi:.10.3390/v4102317 [PMC free article] [PubMed] [Cross Ref]
11. Bray M. 2005. Pathogenesis of viral hemorrhagic fever. Curr Opin Immunol 17:399–403. doi:.10.1016/j.coi.2005.05.001 [PubMed] [Cross Ref]
12. Goni SE, Iserte JA, Ambrosio AM, Romanowski V, Ghiringhelli PD, Lozano ME 2006. Genomic features of attenuated Junin virus vaccine strain candidate. Virus Genes 32:37–41. doi:.10.1007/s11262-005-5843-2 [PubMed] [Cross Ref]
13. Lukashevich IS, Vasiuchkov AD, Stel'makh TA, Scheslenok EP, Shabanov AG 1991. The isolation and characteristics of reassortants between the Lassa and Mopeia arenaviruses. Vopr Virusol 36:146–150. (In Russian.) [PubMed]
14. Lukashevich IS, Carrion R Jr, Salvato MS, Mansfield K, Brasky K, Zapata J, Cairo C, Goicochea M, Hoosien GE, Ticer A, Bryant J, Davis H, Hammamieh R, Mayda M, Jett M, Patterson J 2008. Safety, immunogenicity, and efficacy of the ML29 reassortant vaccine for Lassa fever in small non-human primates. Vaccine 26:5246–5254. doi:.10.1016/j.vaccine.2008.07.057 [PMC free article] [PubMed] [Cross Ref]
15. Cheng BY, Ortiz-Riano E, de la Torre JC, Martinez-Sobrido L 2015. Arenavirus genome rearrangement for the development of live attenuated vaccines. J Virol 89:7373–7384. doi:.10.1128/JVI.00307-15 [PMC free article] [PubMed] [Cross Ref]
16. Wu J, Chen ZJ 2014. Innate immune sensing and signaling of cytosolic nucleic acids. Annu Rev Immunol 32:461–488. doi:.10.1146/annurev-immunol-032713-120156 [PubMed] [Cross Ref]
17. Takeuchi O, Akira S 2009. Innate immunity to virus infection. Immunol Rev 227:75–86. doi:.10.1111/j.1600-065X.2008.00737.x [PubMed] [Cross Ref]
18. Loo YM, Gale M Jr 2011. Immune signaling by RIG-I-like receptors. Immunity 34:680–692. doi:.10.1016/j.immuni.2011.05.003 [PMC free article] [PubMed] [Cross Ref]
19. Seth RB, Sun L, Ea CK, Chen ZJ 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122:669–682. doi:.10.1016/j.cell.2005.08.012 [PubMed] [Cross Ref]
20. Xu LG, Wang YY, Han KJ, Li LY, Zhai Z, Shu HB 2005. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol Cell 19:727–740. doi:.10.1016/j.molcel.2005.08.014 [PubMed] [Cross Ref]
21. Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, Bartenschlager R, Tschopp J 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437:1167–1172. doi:.10.1038/nature04193 [PubMed] [Cross Ref]
22. Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ, Takeuchi O, Akira S 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat Immunol 6:981–988. doi:.10.1038/ni1243 [PubMed] [Cross Ref]
23. Nan Y, Nan G, Zhang YJ 2014. Interferon induction by RNA viruses and antagonism by viral pathogens. Viruses 6:4999–5027. doi:.10.3390/v6124999 [PMC free article] [PubMed] [Cross Ref]
24. Koma T, Huang C, Kolokoltsova OA, Brasier AR, Paessler S 2013. Innate immune response to arenaviral infection: a focus on the highly pathogenic New World hemorrhagic arenaviruses. J Mol Biol 425:4893–4903. doi:.10.1016/j.jmb.2013.09.028 [PMC free article] [PubMed] [Cross Ref]
25. Huang C, Kolokoltsova OA, Yun NE, Seregin AV, Ronca S, Koma T, Paessler S 2015. Highly pathogenic New World and Old World human arenaviruses induce distinct interferon responses in human cells. J Virol 89:7079–7088. doi:.10.1128/JVI.00526-15 [PMC free article] [PubMed] [Cross Ref]
26. Meyer B, Ly H 2016. Inhibition of innate immune responses is key to pathogenesis by arenaviruses. J Virol 90:3810–3818. doi:.10.1128/JVI.03049-15 [PMC free article] [PubMed] [Cross Ref]
27. Borrow P, Martinez-Sobrido L, de la Torre JC 2010. Inhibition of the type I interferon antiviral response during arenavirus infection. Viruses 2:2443–2480. doi:.10.3390/v2112443 [PMC free article] [PubMed] [Cross Ref]
28. Nikonov A, Molder T, Sikut R, Kiiver K, Mannik A, Toots U, Lulla A, Lulla V, Utt A, Merits A, Ustav M 2013. RIG-I and MDA-5 detection of viral RNA-dependent RNA polymerase activity restricts positive-strand RNA virus replication. PLoS Pathog 9:e1003610. doi:.10.1371/journal.ppat.1003610 [PMC free article] [PubMed] [Cross Ref]
29. Fan L, Briese T, Lipkin WI 2010. Z proteins of New World arenaviruses bind RIG-I and interfere with type I interferon induction. J Virol 84:1785–1791. doi:.10.1128/JVI.01362-09 [PMC free article] [PubMed] [Cross Ref]
30. Xing J, Ly H, Liang Y 2015. The Z proteins of pathogenic but not nonpathogenic arenaviruses inhibit RIG-I-like receptor-dependent interferon production. J Virol 89:2944–2955. doi:.10.1128/JVI.03349-14 [PMC free article] [PubMed] [Cross Ref]
31. Huang C, Kolokoltsova OA, Yun NE, Seregin AV, Poussard AL, Walker AG, Brasier AR, Zhao Y, Tian B, de la Torre JC, Paessler S 2012. Junin virus infection activates the type I interferon pathway in a RIG-I-dependent manner. PLoS Negl Trop Dis 6:e1659. doi:.10.1371/journal.pntd.0001659 [PMC free article] [PubMed] [Cross Ref]
32. Zhou S, Cerny AM, Zacharia A, Fitzgerald KA, Kurt-Jones EA, Finberg RW 2010. Induction and inhibition of type I interferon responses by distinct components of lymphocytic choriomeningitis virus. J Virol 84:9452–9462. doi:.10.1128/JVI.00155-10 [PMC free article] [PubMed] [Cross Ref]
33. Bowen MD, Peters CJ, Nichol ST 1997. Phylogenetic analysis of the Arenaviridae: patterns of virus evolution and evidence for cospeciation between arenaviruses and their rodent hosts. Mol Phylogenet Evol 8:301–316. doi:.10.1006/mpev.1997.0436 [PubMed] [Cross Ref]
34. Kiley MP, Lange JV, Johnson KM 1979. Protection of rhesus monkeys from Lassa virus by immunisation with closely related Arenavirus. Lancet ii:738. [PubMed]
35. Pannetier D, Faure C, Georges-Courbot MC, Deubel V, Baize S 2004. Highly pathogenic New World and Old World human arenaviruses induce distinct interferon responses in human cells. J Virol 78:10516–10524. doi:.10.1128/JVI.78.19.10516-10524.2004 [PMC free article] [PubMed] [Cross Ref]
36. Chai F, Li HY, Wang W, Zhu XJ, Li Y, Wang S, Guo L, Zhang LK, Xiao G 2015. Subcellular quantitative proteomic analysis reveals host proteins involved in human cytomegalovirus infection. Biochim Biophys Acta 1854:967–978. doi:.10.1016/j.bbapap.2015.04.016 [PubMed] [Cross Ref]
37. Schneider WM, Chevillotte MD, Rice CM 2014. Interferon-stimulated genes: a complex web of host defenses. Annu Rev Immunol 32:513–545. doi:.10.1146/annurev-immunol-032713-120231 [PMC free article] [PubMed] [Cross Ref]
38. Martinez-Sobrido L, Giannakas P, Cubitt B, Garcia-Sastre A, de la Torre JC 2007. Differential inhibition of type I interferon induction by arenavirus nucleoproteins. J Virol 81:12696–12703. doi:.10.1128/JVI.00882-07 [PMC free article] [PubMed] [Cross Ref]
39. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441:101–105. doi:.10.1038/nature04734 [PubMed] [Cross Ref]
40. Schlee M, Roth A, Hornung V, Hagmann CA, Wimmenauer V, Barchet W, Coch C, Janke M, Mihailovic A, Wardle G, Juranek S, Kato H, Kawai T, Poeck H, Fitzgerald KA, Takeuchi O, Akira S, Tuschl T, Latz E, Ludwig J, Hartmann G 2009. Recognition of 5′ triphosphate by RIG-I helicase requires short blunt double-stranded RNA as contained in panhandle of negative-strand virus. Immunity 31:25–34. doi:.10.1016/j.immuni.2009.05.008 [PMC free article] [PubMed] [Cross Ref]
41. Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa C 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science 314:997–1001. doi:.10.1126/science.1132998 [PubMed] [Cross Ref]
42. Ablasser A, Bauernfeind F, Hartmann G, Latz E, Fitzgerald KA, Hornung V 2009. RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate. Nat Immunol 10:1065–1072. doi:.10.1038/ni.1779 [PMC free article] [PubMed] [Cross Ref]
43. Schonborn J, Oberstrass J, Breyel E, Tittgen J, Schumacher J, Lukacs N 1991. Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts. Nucleic Acids Res 19:2993–3000. doi:.10.1093/nar/19.11.2993 [PMC free article] [PubMed] [Cross Ref]
44. Weber F, Wagner V, Rasmussen SB, Hartmann R, Paludan SR 2006. Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J Virol 80:5059–5064. doi:.10.1128/JVI.80.10.5059-5064.2006 [PMC free article] [PubMed] [Cross Ref]
45. Son KN, Liang Z, Lipton HL 2015. Double-stranded RNA is detected by immunofluorescence analysis in RNA and DNA virus infections, including those by negative-stranded RNA viruses. J Virol 89:9383–9392. doi:.10.1128/JVI.01299-15 [PMC free article] [PubMed] [Cross Ref]
46. Poch O, Sauvaget I, Delarue M, Tordo N 1989. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J 8:3867–3874. [PubMed]
47. Hass M, Lelke M, Busch C, Becker-Ziaja B, Gunther S 2008. Mutational evidence for a structural model of the Lassa virus RNA polymerase domain and identification of two residues, Gly1394 and Asp1395, that are critical for transcription but not replication of the genome. J Virol 82:10207–10217. doi:.10.1128/JVI.00220-08 [PMC free article] [PubMed] [Cross Ref]
48. Lee LN, Burke S, Montoya M, Borrow P 2009. Multiple mechanisms contribute to impairment of type 1 interferon production during chronic lymphocytic choriomeningitis virus infection of mice. J Immunol 182:7178–7189. doi:.10.4049/jimmunol.0802526 [PubMed] [Cross Ref]
49. Zapata JC, Carrion R Jr, Patterson JL, Crasta O, Zhang Y, Mani S, Jett M, Poonia B, Djavani M, White DM, Lukashevich IS, Salvato MS 2013. Transcriptome analysis of human peripheral blood mononuclear cells exposed to Lassa virus and to the attenuated Mopeia/Lassa reassortant 29 (ML29), a vaccine candidate. PLoS Negl Trop Dis 7:e2406. doi:.10.1371/journal.pntd.0002406 [PMC free article] [PubMed] [Cross Ref]
50. Walker DH, McCormick JB, Johnson KM, Webb PA, Komba-Kono G, Elliott LH, Gardner JJ 1982. Pathologic and virologic study of fatal Lassa fever in man. Am J Pathol 107:349–356. [PubMed]
51. Russier M, Pannetier D, Baize S 2012. Immune responses and Lassa virus infection. Viruses 4:2766–2785. doi:.10.3390/v4112766 [PMC free article] [PubMed] [Cross Ref]
52. Shi PY. 2014. Flavivirus NS5 prevents the inSTATement of IFN. Cell Host Microbe 16:269–271. doi:.10.1016/j.chom.2014.08.011 [PubMed] [Cross Ref]
53. Grant A, Ponia SS, Tripathi S, Balasubramaniam V, Miorin L, Sourisseau M, Schwarz MC, Sanchez-Seco MP, Evans MJ, Best SM, Garcia-Sastre A 2016. Zika virus targets human STAT2 to inhibit type I interferon signaling. Cell Host Microbe 19:882–890. doi:.10.1016/j.chom.2016.05.009 [PMC free article] [PubMed] [Cross Ref]
54. Kao YT, Chang BL, Liang JJ, Tsai HJ, Lee YL, Lin RJ, Lin YL 2015. Japanese encephalitis virus nonstructural protein NS5 interacts with mitochondrial trifunctional protein and impairs fatty acid beta-oxidation. PLoS Pathog 11:e1004750. doi:.10.1371/journal.ppat.1004750 [PMC free article] [PubMed] [Cross Ref]
55. Golemboski DB, Lomonossoff GP, Zaitlin M 1990. Plants transformed with a tobacco mosaic virus nonstructural gene sequence are resistant to the virus. Proc Natl Acad Sci U S A 87:6311–6315. doi:.10.1073/pnas.87.16.6311 [PubMed] [Cross Ref]
56. Donson J, Kearney CM, Turpen TH, Khan IA, Kurath G, Turpen AM, Jones GE, Dawson WO, Lewandowski DJ 1993. Broad resistance to tobamoviruses is mediated by a modified tobacco mosaic virus replicase transgene. Mol Plant Microbe Interact 6:635–642. doi:.10.1094/MPMI-6-635 [PubMed] [Cross Ref]
57. Goregaoker SP, Eckhardt LG, Culver JN 2000. Tobacco mosaic virus replicase-mediated cross-protection: contributions of RNA and protein-derived mechanisms. Virology 273:267–275. doi:.10.1006/viro.2000.0430 [PubMed] [Cross Ref]
58. Kerkvliet J, Papke L, Rodriguez M 2011. Antiviral effects of a transgenic RNA-dependent RNA polymerase. J Virol 85:621–625. doi:.10.1128/JVI.01626-10 [PMC free article] [PubMed] [Cross Ref]
59. Painter MM, Morrison JH, Zoecklein LJ, Rinkoski TA, Watzlawik JO, Papke LM, Warrington AE, Bieber AJ, Matchett WE, Turkowski KL, Poeschla EM, Rodriguez M 2015. Antiviral protection via RdRP-mediated stable activation of innate immunity. PLoS Pathog 11:e1005311. doi:.10.1371/journal.ppat.1005311 [PMC free article] [PubMed] [Cross Ref]
60. Yu GY, He G, Li CY, Tang M, Grivennikov S, Tsai WT, Wu MS, Hsu CW, Tsai Y, Wang LH, Karin M 2012. Hepatic expression of HCV RNA-dependent RNA polymerase triggers innate immune signaling and cytokine production. Mol Cell 48:313–321. doi:.10.1016/j.molcel.2012.07.032 [PMC free article] [PubMed] [Cross Ref]
61. Pythoud C, Rodrigo WW, Pasqual G, Rothenberger S, Martinez-Sobrido L, de la Torre JC, Kunz S 2012. Arenavirus nucleoprotein targets interferon regulatory factor-activating kinase IKKepsilon. J Virol 86:7728–7738. doi:.10.1128/JVI.00187-12 [PMC free article] [PubMed] [Cross Ref]
62. Rodrigo WW, Ortiz-Riano E, Pythoud C, Kunz S, de la Torre JC, Martinez-Sobrido L 2012. Arenavirus nucleoproteins prevent activation of nuclear factor kappa B. J Virol 86:8185–8197. doi:.10.1128/JVI.07240-11 [PMC free article] [PubMed] [Cross Ref]
63. Jiang X, Huang Q, Wang W, Dong H, Ly H, Liang Y, Dong C 2013. Structures of arenaviral nucleoproteins with triphosphate dsRNA reveal a unique mechanism of immune suppression. J Biol Chem 288:16949–16959. doi:.10.1074/jbc.M112.420521 [PMC free article] [PubMed] [Cross Ref]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)