PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2017 August 15.
Published in final edited form as:
PMCID: PMC4976035
NIHMSID: NIHMS793318

DISTINCT CD55 ISOFORM SYNTHESIS AND INHIBITION OF COMPLEMENT DEPENDENT CYTOLYSIS BY HEPATITIS C VIRUS#

Abstract

CD55/DAF, one of the regulators of complement activation (RCA), is known to limit excess complement activation on the host cell surface by accelerating the decay of C3 convertase. We have previously reported that hepatitis C virus (HCV) infection or virus core protein expression upregulates CD55 expression. CD55 associates with HCV particles, potentially protecting HCV from lysis in circulation. An increase in CD55 on HCV infected cell surface may inhibit complement mediated cell killing. In this study, we have shown that antibodies against cancer cell surface proteins induce complement dependent cytolysis (CDC) or antibody-dependent cell-mediated cytotoxicity (ADCC) of immortalized human hepatocytes (IHH) in the presence of CD55 blocking antibody. CD55 has a secreted isoform (sCD55) generated by alternative splicing. We have observed that sCD55 is induced in HCV infected or HCV replicon harboring cells, and in liver biopsy samples from chronically HCV infected patients. Conditioned medium from HCV infected hepatoma cells (Huh7.5) or IHH inhibited C3 convertase activity and CDC of sheep blood erythrocytes. Chronically HCV infected patient sera displayed inhibition of C3 convertase activity, further implicating HCV specific impairment of complement function in infected humans. CD55 blocking antibody inhibited erythrocyte lysis by conditioned medium, suggesting CD55/sCD55 has a function for impairing convertase activity. Together, we have shown that HCV infection induces sCD55 expression in HCV infected cell culture conditioned medium, and inhibits C3 convertase activity. This may have implication in modulating complement mediated immune function in the microenvironment and on HCV harboring cells.

Keywords: HCV, CD55, sCD55, complement, cytolysis

INTRODUCTION

The complement system, by virtue of its dual effector and priming functions, is a major host defense mechanism against pathogens. It serves as an arm of the innate immune system by targeting and eliminating infected cells and invading microorganisms- including free viral particles-and also serves to link innate and adaptive immunity including enhancing humoral immunity, regulating antibody effector mechanisms, and modulating T cell function (14). Deficiencies in complement predispose patients to infection due to ineffective opsonization and defects in lytic activity (57). The liver, primarily hepatocytes, is responsible for the biosynthesis of approximately 90% of plasma complement components and their soluble regulators (8). Regulators of complement limit excess complement activation (CD46, CD55, and CD59), are expressed on the surface of host cells (911).

HCV is an important cause of morbidity and mortality worldwide, causing a spectrum of liver disease ranging from an asymptomatic carrier state to hepatocellular carcinoma. Approximately 3% (170 million) of the world’s population is estimated to be infected with HCV (12). HCV establishes chronic infection in more than 70% of infected individuals. Persistent HCV infection is associated with hepatic fibrosis, cirrhosis, and hepatocellular carcinoma. HCV has evolved mechanisms to evade immune activation, including complement response. We have shown a regulatory role for HCV on complement related functions (1316). HCV suppresses C3, C4 and C9 synthesis in hepatocytes, and induces CD55 as a negative regulator of complement activation. CD55 accelerates the decay of preformed C3 convertases. HCV core protein upregulates CD55 expression on the cell surface and inhibits complement dependent cytolysis (15). Some tumors do not solely express a single variant of CD55, but also express different isoforms of the protein (17). Isoforms of CD55 may occur due to alternative splicing, or may also originate from different glycosylation patterns of CD55 in some cell types, like in colorectal carcinoma cells (18).

Two isoforms of DAF are known in humans, a glycosyl phosphatidylinositol (GPI)-anchored form (gDAF or CD55) and a soluble form (sDAF or sCD55) (19, 20). CD55 or gDAF is the major form, which is composed of four N-terminal complement control protein (CCP) domains, a heavily glycosylated serine, threonine, and proline (STP)-rich domain, and a C-terminal GPI-anchored portion (21). CD55 is expressed on the plasma membrane of all blood cells and almost all other cell types in immediate contact with plasma component proteins. Unlike CD55, sCD55 is present in body fluids, including urine and plasma (22), and extracellular matrix; and its levels are much lower than CD55. sCD55 is generated from the CD55 gene by alternative usage of an optional exon and lacks the GPI-anchored portion in the C-terminal (23).

In addition to sCD55, human fluids contain additional soluble regulators for decay acceleration and cofactor activity. Among those, Factor H regulates complement activation for having both cofactor activity for the Factor I mediated C3b cleavage, and decay accelerating activity against the alternative pathway C3-convertase, C3bBb (24). On the other hand, C4b-binding protein (C4BP) is a potent circulating soluble inhibitor of the classical and lectin pathways of complement (25). Upon inflammation, expression of a form of C4BP composed of exclusively α-chains is increased. We have shown previously that HCV induces Factor H (28).

In this study, we have shown that antibodies against cancer cell surface proteins enhance complement dependent cytolysis (CDC) or antibody-dependent cell-mediated cytotoxicity (ADCC) of immortalized human hepatocytes (IHH) in the presence of CD55 blocking antibody. Further, HCV infection induces sCD55 expression, in addition to the previously noted positive regulation of CD55. Secretion of sCD55 was characterized from HCV infected cell culture conditioned medium, and inhibited C3 convertase activity. Our results suggested that the induction of cell associated and secretory CD55 expression by HCV infection limits complement-mediated damage of infected cells and in their microenvironment.

MATERIALS AND METHODS

Patient liver RNA

Archived liver biopsy specimens from eight patients with chronic HCV infection were used (13). Specimens were collected from subjects with their written consent, and the human studies protocol was approved by the Saint Louis University Instituional Review Board. RNA was prepared from liver specimens by using TRIzol (Invitrogen) as previously described (26). Commercially available control liver RNA (CloneTech, CA and Lonza, NJ) was used for comparison.

Cell culture and HCV infection

BHK21, IHH, Huh7.5, and replicon of HCV genotype 2a full-length genome harboring Huh7.5 cells (Rep2a) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum, 100 U/mL penicillin G, and 100 μg/mL streptomycin at 37°C in a 5% carbon dioxide atmosphere. The NK3.3 cell line (27), kindly provided by Jackie Kornbluth (Saint Louis University, MO), was maintained in RPMI 1640 supplemented with 15% fetal bovine serum, 1% glutamine, 100 U/mL penicillin G, 100 μg/mL streptomycin, and 200 IU/ml recombinant IL-2 (R & D Systems, Inc., MN) as described previously (28).

Huh7.5 cells were used to grow HCV genotype 2a (clone JFH1), as previously described (29). Cell culture supernatant was filtered through a 0.45-μm cellulose acetate membrane (Nalgene, NY), aliquoted as virus stock, and stored at −70°C for single use. HCV RNA in virus stock was quantified (IU/ml) by real-time PCR (Prism 7500 real-time thermocycler, ABI, CA) with the use of analyte-specific reagents (ASR, Abbott, IL) in the Pathology Clinical Laboratory of Saint Louis University.

ELISA

Rabbit anti-CD55 (Santa Cruz, CA) or an unrelated control rabbit antibody to a cellular protein C/EBPα (Santa Cruz, CA) was coated for overnight on a Corning Costar flat-bottom high-binding EIA/RIA 3690 plate in PBS (pH 7.4; 0.4 μg/well) at 4°C. The plate was blocked with 2% BSA in PBS. Nitrocellulose (0.22 μM) membrane filtered conditioned medium from Huh7.5 or HCV genotype 2a replicon harboring cells (Rep2a) was added in triplicate to experimental or control wells. After incubation at 4°C overnight, wells were washed and bound sCD55 was detected by anti-CD55 monoclonal antibody (Millipore), followed by secondary anti-mouse HRP conjugated antibody treatment, and addition of peroxidase substrate (Pierce Chemicals, IL). The absorbance at 450 nm was read and presented as fold induction.

Reverse transcription-PCR and Real-Time PCR

RNA from experimental cells was isolated by treatment with TRIzol and cDNA was transcribed using Superscript III First-Strand Synthesis System (Invitrogen). Total 1 μg of RNA was used for CD55 (accession number : NM_00574.3) cDNA synthesis using specific forward (5′-GATTCACCATGATTGGAGAGCACTC–3′) and reverse (5′-AAGTCAGCAAGCCCATGGTTAC TAGC-3′) primers. Synthesis of sCD55 (accession number : NM_000114752.1) cDNA was made by using the above forward and a different reverse (5′-AGGAGTTCGAGACTGCAGTGAGCTACGATCACAC-3′) primer as reported earlier (20).

For real-time PCR, a specific primer set was designed containing exon 10 of sCD55 transcript ; forward: 5′-TCAAGCGATCCTTCCACTTC-3′ and reverse: 5′-CAGCAAGCCCATGGTTACTA -3′ primers, and normalized with GAPDH specific forward: 5′-CATCATCCCTGCCTCTACTG - 3′ and reverse: 5′-GCCTGCTTCACCTTCTT-3′primers. CD55 mRNA was analyzed using a predesigned CD55 specific primer (Sigma); Forward: 5′-CAGAGGAAAATCTCTAACTTCC – 3′ and reverse: 5′ – AGTTGGTGAGACTTCTGTAG – 3′. Power SYBR Green Assay kit (Applied Biosystems) was used for sCD55 mRNA quantification following manufacturer’s protocol. All reactions were performed in triplicate and analyzed using an ABI Prism 7500 analyzer.

C3 cleavage assay

C3 cleavage assay was performed as previously reported (30). Briefly, 50 μg/ml of C3 purified protein was incubated with an indicated percentage of human sera at 37°C for 30 min. Samples were separated by SDS-PAGE. Proteins were transferred onto nitrocellulose membrane (Bio-Rad) and treated with anti-human C3 antibody at 4°C overnight, followed by a mouse secondary antibody. The experiment was carried out three times for densitometric analysis using Image J software.

Convertase functional assay

Classical pathway was analyzed using amboceptor sensitized sheep erythrocytes (EA) (Complement Technologies, Tyler, TX). Erythrocytes (5×108) were washed with dextrose gelatin veronal buffer (GVB++ containing 0.1 % gelatin, 5 mM Veronal, 145 mM NaCl, 0.025% NaN3, 1 mM MgCl2, 0.15 mM CaCl2, pH 7.3), EA suspensions were adjusted and lysed with 90 μl of water to have an absorbance value of ~1.2 at 405 nm.

In order to determine the function of sCD55, a modified previously described method (30, 31) was used. Briefly, 10 μl of EA were placed in a 96-well V-shape microplate (Nunc) and 40 μl of GVB++ buffer containing a 2% C3-depleted normal human serum (Quidel) was added to assemble C3 convertase. The plate was kept in an incubator shaker (300 rpm) at 30°C for 5 minutes for convertase formation. After removing the supernatant, complete medium (DMEM+ 10% FBS) containing purified sCD55 or conditioned medium from each cell line was added. To initiate complement mediated lysis from existing convertase complexes, 50 μl of 40 mM EDTA-GVB buffer (40 mM EDTA, 5 mM veronal buffer, 0.1% gelatin, 145 mM NaCl, 0.025 NaN3, pH 7.3) containing 1:40 guinea pig serum as a source of complement was added. The plate was incubated for an additional 30 minutes at 37°C on a 300 rpm shaker. Cells were pelleted and 80 μl of the supernatant containing hemoglobin released from lysed EA were measured at 405 nm.

For alternative pathway, ~4×108 cells/ml of rabbit erythrocytes (rE) were washed with Mg++EGTA buffer (GVB++ including 10 mM EGTA) until there was no visible hemoglobin in the supernatant. To ensure an equal number of rE in each experiment, cell suspensions were standardized so that 10 μl of such suspension lysed with 90 μl of water had an absorbance of ~1.0 at 405 nm. 10 μl of rE were placed in wells of a 96-well V-shape microplate (Nunc) and 40 μl of Mg++EGTA buffer containing a given concentration of C5-depleted serum (Complement Technologies, Tyler, TX) was added in order to assemble convertase. Complement-mediated lysis resulting from assembled convertase complexes was initiated and measured as described for the classical pathway assay.

Complement dependent cytolysis (CDC) and antibody dependent cell-mediated cytotoxicity (ADCC)

Calcein AM release (Molecular Probe) was used for measuring cytolysis (32). For CDC, cells (2 × 104 cells/ml) were seeded in a 96-well plate and grown to confluency. Cells were incubated with calcein AM (5 μg/ml) for 30 min at 37°C, washed twice prior to treatment with anti-c-Kit mouse IgG2a monoclonal antibody (Thermo scientific) or anti-GPC3 mouse IgG2a antibody (Santa Cruz, CA) together with anti-CD55 mouse IgG1 (BRIC216, EMD Millipore, MA), anti-CD46 (GB24, kindly provided by Dr. John Atkinson, Washington University, St. Louis) or anti-CD59 (YTH53.1, Santa Cruz, CA) for 20 min at 37°C. Cells were incubated in the presence of normal human serum (NHS) as a source of complement at 37°C for 4h. Alternatively, BHK21 cells were infected with vesicular stomatitis virus (VSV, Indiana) at a multiplicity of infection of 0.3. Cells were incubated for 16h before addition of calcein AM. VSV G antibody (SantaCruz, CA) and a 5% dilution of normal human serum in the presence or absence of purified CD55 protein (ACRO Biosystem, Newark, DE), or each conditioned medium. The supernatant was transferred to a new 96 well plate to represent the complement-mediated release of calcein AM fraction. The calcein AM remaining in the cells were released by incubation with 0.1% Triton X-100 for 30 min as maximum release. Samples were measured using a Multimode Plate Reader using an excitation filter 485 nm and emission filter 530 nm (PerkinElmer). Percent lysis was calculated according to the formula [(test release − spontaneous release)/(maximum release − spontaneous release)] × 100. For ADCC, cells stained by calcein AM were treated with each antibody at 37°C for 20 min. Cells were incubated with NK 3.3 effector cells at 37°C for 4h. The supernatant was transferred and the fluorescence was measured similar to CDC assay. Percent lysis was calculated using the same formula with CDC.

Flow cytometry

HCV genotype 2a (clone JFH1)-infected IHH were grown for 3 days, washed with phosphate-buffer saline (PBS) and incubated with 1:250 dilution of antibody to CD46, CD55 or CD59 in PBS containing 3% FBS for 30 min. Cells were washed, an Alexa488 conjugated anti-mouse IgG antibody (Molecular Probes, CA) for CD46 and CD55 or anti-Rat IgG antibody for CD59 (Molecular Probes, CA) were added at a 1:500 dilution, and incubated for 30 min. Washed cells were resuspended in 1% formaldehyde in PBS and subjected to flow cytometric analysis (Becton, Dickinson) using software for processing data (Cell Quest software; BD Immunocytometry Systems).

Statistical Analysis

Statistical analyses were performed using a two-tailed unpaired Student t- test for two groups or one-way analysis of variance (ANOVA) for comparison among three or more groups. A p value of <0.05 was considered significant.

RESULTS

HCV infection or replicon harboring hepatocytes transcriptionally activates expression of CD55 isoforms

In order to analyze both CD55 and sCD55 expression in HCV infected cells, we designed specific primers as reported earlier (20). CD55 as well as sCD55 mRNA levels were determined in Huh7.5 cells infected with cell culture-grown HCV genotype 2a or replicon harboring cells and compared with uninfected parental Huh7.5 cells by real-time PCR. A ~2.5 fold induction in CD55 mRNA was observed, and increased induction (~3 fold) in sCD55 mRNA was detected in HCV genotype 2a infected Huh7.5 cells (Fig. 1, panels A, C and E). We also observed ~5 fold induction of CD55 mRNA, and increased induction of sCD55 mRNA (~3.5 fold) in HCV genotype 2a replicon harboring cells as compared to parental Huh7.5 (Fig. 1, panels B, D and E).

FIG 1
Expression of CD55 isoforms in HCV infected and HCV replicon harboring cells

Next, we examined the secretion of sCD55 in a HCV genotype 2a replicon harboring cell line. The sCD55 protein was detected in conditioned medium from mock Huh7.5 and HCV genotype 2a replicon harboring cells by sandwich ELISA on a CD55 antibody coated plate. HCV genotype 2a replicon cells secreted ~5 fold more sCD55/CD55 in culture fluid as compared to mock-treated Huh7.5 (Fig. 1, panel F).

Blockade of CD55 augments complement dependent attack by antibodies to HCV induced cell surface protein or tumor specific antigen

We have shown that HCV core protein expression induces CD55 (15). Immortalized human hepatocytes (IHH) generated by stable transfection of HCV (genotype 1a) core genomic region into primary human hepatocytes (33) enhanced CD55 expression on cell surface. CD55 expression on cell curface decreases susceptiblity of killing by ADCC (34). These IHH inhibit CDC or NK-cell mediated ADCC. Another group of investigators reported that CD59, an additional RCA which inhibits an excessive complement response, is upregulated by HCV and associates with HCV viral particles (35). Here, we analyzed the expression status of CD55, CD46 and CD59 on IHH surface by flow cytometry. The expression of CD55 and CD59 were significantly high, but CD46 was expressed at a much lower level on IHH surface (Fig. 2, panel A). We also examined the expression of RCAs in HCV genotype 2a infected IHH, but these were not further enhanced (data not shown). IHH generated from stable transfection of HCV core gene into primary human hepatocytes already displayed a high level of CD55 expression on cell surface, which may account for a lack of enhancement from its threshold level of expression.

FIG 2
Complement dependent cytolysis of IHH by antibody to c-Kit or GPC3

Our previous report has shown that c-Kit is induced in HCV infected hepatocytes and HCV core upregulates c-Kit at the transcriptional level (26). On the other hand, GPC3, a tumor specific antigen is a target of ADCC in hepatocellular carcinoma (36). In this study, we examined whether c-Kit or GPC3 antibody can induce CDC in IHH. CDC was induced after treatment with c-Kit antibody in a dose dependent manner with normal human serum complement when CD55 was blocked by a specific inhibitory antibody (BRIC216) (Fig. 2, panel B), but CD55 blocking antibody alone did not induce cytolysis (data not shown). GPC3 antibody also induced CDC of IHH in the presence of CD55 blocking antibody (Fig. 2, panel C). Further, we examined whether CDC may be enhanced or induced after blocking CD55, CD46 and/or CD59. When c-Kit antibody was added together with CD59 blocking antibody and complement, a higher level of CDC was induced as compared to c-Kit antibody alone. However, CD46 blocking antibody did not have a significant role in enhancing CDC by c-Kit antibody. The use of both CD55 and CD59 antibodies further enhanced cytotoxicity in response to complement and c-Kit antibody by approximately two fold (Fig. 2 panel D). This result defines a role for both CD55 and CD59 in escape from cytolysis in hepatocytes expressing HCV core protein.

We further treated IHH with c-Kit or GPC3 antibody in the presence of NK3.3 cells (E:T ratio = 2.5 :1, 5 : 1 or 10 : 1) in order to induce ADCC. These two antibodies induced ADCC after blocking with CD55 antibody (Fig. 3, panels A and B). Macrophages are known to induce ADCC (37). We also examined whether a combination of NK cells and THP1 (a human monocyte/macrophage cell line) could induce a higher % of cytolysis in IHH. When IHH were incubated with NK3.3 (E:T ratio = 5 : 1), we observed that NK cells cluster around IHH, unlike THP1, by light microscopy (Fig. 3, panel C). NK cells also induced ADCC in the presence of c-Kit and CD55 blocking antibodies (Fig. 3, panel A). However, THP1 did not induce cytolysis or enhance NK cell mediated ADCC (Fig. 3, panel D). Together these data suggested that HCV induced antigen and RCA proteins on cell surface and protect infected cells by inhibiting CDC or NK cell mediated ADCC. The use of inhibitory antibodies to CD55 and CD59 enhance cytolysis.

FIG 3
Antibody-dependent cell-mediated cytotoxicity of IHH by NK3.3 cells in the presence of c-Kit or GPC3 antibody

Conditioned medium from HCV infected cells inhibits complement dependent cytolysis

In our previous study, we have shown that VSV G antibody induces complement dependent cytolysis (CDC) in VSV infected cells (15). Here, we used VSV infected BHK21 cells as a model to demonstrate the effect of sCD55 on CDC, as CD55 is not expressed on the cell surface of BHK21 cells (38). This model allowed us to determine primarily the function of sCD55. Purified sCD55 inhibited VSV G antibody mediated CDC in VSV infected BHK21 cells in a dose dependent manner (Fig. 4, panel A). We performed a similar assay with the conditioned medium from parental Huh7.5, HCV genotype 2a full-length replicon harboring Huh7.5, HCV genotype 2a infected Huh7.5 or IHH. CDC was not inhibited by conditioned medium from Huh7.5 cells, but was significantly inhibited by conditioned medium from HCV replicon (21%), HCV infected Huh7.5 (22%) and IHH (20%) as compared to control (45%) or conditioned medium from Huh7.5 cells (39%) (Fig. 4, panel A). We have shown previously that DAF was upregulated in IHH as compared to primary human hepatocytes (39). IHH was generated by transfection of HCV core gene into primary human hepatocytes (33, 40) and HCV core protein is known to induce CD55 promoter activity via SP1 promoter activation (15).

FIG 4
Inhibition of complement dependent cytolysis and convertase activity by secreted CD55 and conditioned medium from HCV infected cells

Conditioned medium from HCV infected cells inhibits convertase activity

In order to determine whether sCD55 secreted by HCV inhibits convertase activity, we performed a series of hemolytic assays with antibody sensitive sheep erythrocytes as previously described (30). This highly sensitive sheep erythrocyte model was used to understand the function of sCD55. We used conditioned medium from Huh7.5, HCV genotype 2a infected Huh7.5, early or late passage IHH (E or L-passage). Purified sCD55 was used as a positive control. The conditioned medium from early or late passage IHH and HCV genotype 2a infected Huh7.5 displayed reduced hemolysis (~42–55%) as compared to complete medium (~81% lysis) (Fig. 4, panel B). However, conditioned medium (CM) from Huh7.5 did not inhibit cell lysis (~81%). We examined whether conditioned medium treatment associated inhibition was specific for sCD55 (Fig. 4, panel D), and inhibition of sCD55 reduced CM specific inhibition by greater than 50% in all cases. After anti-CD55 blocking antibody treatment, the inhibition of hemolysis was impaired in sCD55 supplemented medium (from 9% to 39%), early/late passaged IHH conditioned medium (from 42% to 56%) and HCV genotype 2a infected Huh7.5 conditioned medium (from 55% to 70%) (Fig. 4. panels D and E). These results suggested that sCD55 induced by HCV infection or core protein expression inhibits convertase activity.

We performed a separate hemolytic assay with rabbit erythrocytes to analyze alternative complement pathway function. Hemolysis by alternative pathway (~35% lysis) was less apparent than that seen associated with the classical pathway (~80% lysis). Purified sCD55 inhibited alternate pathway hemolysis (from ~35% to 17%) but was not as efficient as the classical pathway (from ~80% to ~10%). We also analyzed each conditioned medium for inhibiting alternative pathway. Conditioned medium from IHH and HCV genotype 2a infected Huh7 cells inhibited hemolysis by alternative pathway, but not to the extent as observed in a classical pathway (Fig. 4, panel C).

Liver biopsy specimens from chronically HCV infected patients exhibit a high level of sCD55 mRNA

We designed a sCD55 specific primer pair to determine the expression status of sCD55 mRNA by quantitative real-time PCR analysis in liver biopsies from a randomly chosen cohort of chronically HCV infected patients (26). sCD55 mRNA expression was significantly enhanced in all patients, and was higher (>30 fold) in 5 of 8 chronically HCV infected liver biopsy specimens (Fig. 5, panels A and B) as compared with that of two healthy liver RNA samples. Similarly, CD55 expression was higher (>3 fold) in chronically HCV infected patients (Fig. 5, panels C and D). These results suggested that both sCD55 and membrane anchored CD55 are up-regulated in HCV-infected human liver specimens, and may protect infected hepatocytes and the surrounding microenvironment from complement dependent lysis.

FIG 5
CD55 isoform expression increases in HCV infected liver biopsy samples

Chronic HCV infected patients exhibit limited C3 convertase activity

CD55 inhibits C3 and C5 convertase activity by inhibiting formation and accelerating decay of convertase (41). To verify the impairment of C3 convertase activity in HCV infected patients, we analyzed C3 cleavage by C3 convertase. C3 convertase cleaves C3 into C3a and C3b (6). C3 is composed of 115 kDa α and 75 kDa β chain. The α chain cleaves into ~104 kDa α′ chain of C3b by C3 convertase. On the other hand, ~43 kDa of iC3b-α2′-chain is generated by Factor I after formation of C3b. The generation of C3b-α′-chain and iC3b-α2′-chain, as a result of cleavage of C3-α′-chain, was increased in a dose dependent manner of serum concentration, and significantly increased in 10% NHS included in the reaction. On the other hand, HCV infected patient sera moderately cleaved C3 protein at a similar concentration. Results from representative NHS and patient serum are shown (Fig. 6, panels A and B). C3 cleavage formed in non-HCV patient sera was increased as compared to HCV infected patient sera when the reaction included purified C3 protein. Densitometric analysis showed C3b-α′-chain status in NHS is more than 3 times higher than HCV infected patient sera (Fig. 6, panel B). HCV decreases several complement components which form the C3 convertase as previously observed (13, 14), and induces sCD55 that have a function to decay C3 convertase. Interestingly, we have observed an incresed C4BPA mRNA expression in HCV infected liver bipsy specimens as compared to normal donor livers (Supplementary Fig. 1). Taken together, the results suggest that HCV infected patients has limited C3 convertase activity as compared to normal humans.

FIG 6
Inhibition of C3 convertase activity by HCV infected patient sera

DISCUSSION

The complement response eliminates infected cells, inactivates virions, neutralizes virus by natural antibody or complement, and enhances B lymphocyte response (4). Virus can evade the host complement response by various mechanisms. We have previously shown that HCV infection induces CD55 expression on infected cell surface, and is incorporated onto the viral lipid bilayer to inhibit complement dependent cytolysis (15). Another study reported that HCV incorporates CD59 into the viral lipid bilayer and protects against complement dependent viral lysis (35). We examined the expression of CD55, CD46 and CD59 on IHH, a cell line generated by HCV core transfection into primary human hepatocytes (33, 40). IHH displayed abundant expression of CD55 and CD59 on cell surface by immunofluorescence, but not CD46. We also examined HCV genotype 2a infected IHH, but these RCAs were not induced in IHH because IHH has integrated HCV core gene and also express high level of CD55 and CD59.

Dumestre-Perard et al. (2002) observed significantly lower C4 activity in a large cohort of chronic HCV patients (42). A decrease in specific C4 activity was reported among relapsers compared with sustained responders to interferon-based therapy, suggesting a role for complement in viral clearance. HIV positive patients with chronic HCV infection are at increased risk of developing chronic kidney disease (CKD) as compared with HIV mono-infected patients, suggesting a contribution from active HCV infection towards pathogenesis of CKD (43). An association with persistent infection, including cytomegalovirus, cryptococcus, and tuberculosis is more common in HCV-infected patients compared to non-HCV-infected controls (44). Further, HAV or HBV vaccination response is reduced in chronic HCV patients (4549). These observations suggest that chronic HCV infection may generate an overall attenuation or suppression of immune responses.

c-Kit is a cancer stem cell marker. HCV infection (or core protein expression) induces c-Kit in human hepatocytes (26). Human glypican-3 (GPC3) immunoreactivity is detected in HCC patients associated with HCV infection (50). GPC3 is a heparan sulfate proteoglycan, which is overexpressed in various cancers, including HCC, and plays an important role in cell growth promotion and differentiation. Interestingly, HCV binds with heparan sulfate proteoglycans (51). On the other hand, there may be a potential complement inhibitory role of GPC3 by interaction with C1q (52). However, this does not disagree with the cytoprotective role of CD55. Thus, it is difficult to predict the role of GPC3 for additional complement inhibitory role until further examination. GPC3 antibody induces ADCC in Huh7 and HepG2 cells (36). In this study, we have shown that antibodies to c-Kit and GPC3 induce CDC and NK cell mediated ADCC in IHH in the presence of CD55 blocking antibody. Further, the level of CDC is enhanced in the presence of blocking antibody to CD59. The use of THP1 as a monocyte/macrophage derived cell line, in place of NK cells, did not increase the level of cytolysis.

Interestingly, we have observed that HCV infection enhances sCD55 expression for secretion into culture medium. We used VSV infected BHK cells or sheep RBC as working models to target and evaluate the function of sCD55 generated and secreted by HCV. Our results suggested that HCV infection induces sCD55 expression in the liver, and modulates complement mediated immune function. We have shown that HCV infection induces sCD55 and gDAF in chronically infected liver biopsy specimens. sCD55 is secreted at much higher level in HCV infected cells and in the conditioned medium, and inhibited C3 convertase activity. However, we do not rule out the possibility of contaminating full-length CD55 in culture medium due to cell membrane damage. To our knowledge, this is the first report on sCD55 and gCD55 inhibiting complement mediated immune function in HCV infected patients. CD55 exists as isotypes by alternative splicing (20), and we observed upregulation of both gCD55 and sCD55 mRNA in HCV infected or HCV genome replicon harboring cells. sCD55 was observed to be about five fold higher in culture medium of HCV genome harboring Huh7.5 cells as compared to culture medium from mock-treated cells. c-Kit, an HCV mediated tumor specific antigen, is a potential target for complement dependent cytolysis in IHH when CD55 is blocked by specific antibody. The conditioned medium from HCV infected Huh7.5 or IHH inhibits C3 convertase activity and anti-CD55 blocking antibody attenuates this inhibition. These results indicated that HCV mediated sCD55 inhibits complement dependent cytolysis, especially the convertase activity.

sCD55 mRNA expression was significantly induced in liver of chronically HCV infected patients as compared to full-length CD55. The alternative splicing factor of CD55 is unknown. However, we speculate that the splicing factors for sCD55 expression may be affected by HCV infection. The serum from HCV infected patients inhibits C3 cleavage by inhibition of C3 convertase or decrease C3 convertase activity. Our previous studies have shown that HCV downregulates C2, C3 and C4 expression (13, 14, 30), which contribute C3 convertase formation. On the other hand, HCV induces factor H and inhibits C3 convertase activity (28). Thus, HCV may inhibit C3 convertase activity at multiple steps in infected host.

Virus infection can activate the complement response, and some virus infection does not need specific antibody to induce the classical complement pathway. The glycoproteins of some viruses can be bound directly with C1q, which is a component of the classical pathway, in the absence of specific antibodies. These viruses include human cytomegalovirus and certain retroviruses (5356). Hepatitis B virus and influenza virus (5759) can activate the lectin pathway by interaction of mannan-binding lectin (MBL) with viral surface carbohydrates. However, HCV does not express viral protein on the infected host cell surface, thus the antibody against HCV antigen does not itself activate complement dependent cytolysis of infected cells. Here, wwe have shown that HCV subverts the ability of NK cells to positively mediate complement protein expression. The ability of viruses to attenuate complement function can play an important role in viral pathogenesis. CD55 isoforms appears to be important target for therapeutic potential in HCV associated HCC, as it might play an important role in cancer immune evasion in liver. Thus, it is increasingly clear that a greater understanding of complement interactions with HCV is necessary for the design of immunotherapeutic modalities.

Supplementary Material

Acknowledgments

We thank Ratna B. Ray and Sandip K. Bose for helpful suggestions. We appreciate technical help from Ms. Patricia Osmack for collection and storage of clinical liver biopsy specimens.

Footnotes

#This work was supported by research grant DK080812, and from the Lver Center Research Funds of Saint Louis University.

References

1. Mollnes TE, Song WC, Lambris JD. Complement in inflammatory tissue damage and disease. Trends Immunol. 2002;23:61–64. [PubMed]
2. Gasque P. Complement: a unique innate immune sensor for danger signals. Mol Immunol. 2004;41:1089–1098. [PubMed]
3. Kim DD, Song WC. Membrane complement regulatory proteins. Clin Immunol. 2006;118:127–136. [PubMed]
4. Stoermer KA, Morrison TE. Complement and viral pathogenesis. Virology. 2011;411:362–373. [PMC free article] [PubMed]
5. Zipfel PF, Skerka C. Complement regulators and inhibitory proteins. Nat Rev Immunol. 2009;9:729–740. [PubMed]
6. Wagner E, Frank MM. Therapeutic potential of complement modulation. Nat Rev Drug Discov. 2010;9:43–56. [PubMed]
7. Joller N, Weber SS, Oxenius A. Antibody-Fc receptor interactions in protection against intracellular pathogens. Eur J Immunol. 2011;41:889–897. [PubMed]
8. Qin X, Gao B. The complement system in liver diseases. Cell Mol Immunol. 2006;3:333–340. [PubMed]
9. Seya T, Atkinson JP. Functional properties of membrane cofactor protein of complement. Biochem J. 1989;264:581–588. [PubMed]
10. Hourcade D, Liszewski MK, Krych-Goldberg M, Atkinson JP. Functional domains, structural variations and pathogen interactions of MCP, DAF and CR1. Immunopharmacology. 2000;49:103–116. [PubMed]
11. Williams P, Chaudhry Y, Goodfellow IG, Billington J, Powell R, Spiller OB, Evans DJ, Lea S. Mapping CD55 function. The structure of two pathogen-binding domains at 1.7 A. J Biol Chem. 2003;278:10691–10696. [PubMed]
12. Negro F, Alberti A. The global health burden of hepatitis C virus infection. Liver Int. 2011;31(Suppl 2):1–3. [PubMed]
13. Banerjee A, Mazumdar B, Meyer K, Di Bisceglie AM, Ray RB, Ray R. Transcriptional repression of C4 complement by hepatitis C virus proteins. J Virol. 2011;85:4157–4166. [PMC free article] [PubMed]
14. Mazumdar B, Kim H, Meyer K, Bose SK, Di Bisceglie AM, Ray RB, Ray R. Hepatitis C virus proteins inhibit C3 complement production. J Virol. 2012;86:2221–2228. [PMC free article] [PubMed]
15. Mazumdar B, Kim H, Meyer K, Bose SK, Di Bisceglie AM, Ray RB, Diamond MS, Atkinson JP, Ray R. Hepatitis C virus infection upregulates CD55 expression on the hepatocyte surface and promotes association with virus particles. J Virol. 2013;87:7902–7910. [PMC free article] [PubMed]
16. Kim H, Meyer K, Di Bisceglie AM, Ray R. Hepatitis C virus suppresses C9 complement synthesis and impairs membrane attack complex function. J Virol. 2013;87:5858–5867. [PMC free article] [PubMed]
17. Mikesch JH, Buerger H, Simon R, Brandt B. Decay-accelerating factor (CD55): a versatile acting molecule in human malignancies. Biochim Biophys Acta. 2006;1766:42–52. [PubMed]
18. Nakagawa M, Mizuno M, Kawada M, Uesu T, Nasu J, Takeuchi K, Okada H, Endo Y, Fujita T, Tsuji T. Polymorphic expression of decay-accelerating factor in human colorectal cancer. J Gastroenterol Hepatol. 2001;16:184–189. [PubMed]
19. Medof ME, Walter EI, Rutgers JL, Knowles DM, Nussenzweig V. Identification of the complement decay-accelerating factor (DAF) on epithelium and glandular cells and in body fluids. J Exp Med. 1987;165:848–864. [PMC free article] [PubMed]
20. Osuka F, Endo Y, Higuchi M, Suzuki H, Shio Y, Fujiu K, Kanno R, Oishi A, Terashima M, Fujita T, Gotoh M. Molecular cloning and characterization of novel splicing variants of human decay-accelerating factor. Genomics. 2006;88:316–322. [PubMed]
21. Coyne KE, Hall SE, Thompson S, Arce MA, Kinoshita T, Fujita T, Anstee DJ, Rosse W, Lublin DM. Mapping of epitopes, glycosylation sites, and complement regulatory domains in human decay accelerating factor. J Immunol. 1992;149:2906–2913. [PubMed]
22. Miot S, Crespo S, Schifferli JA. Distinct forms of DAF in urine and blood. J Immunol Methods. 2002;260:43–53. [PubMed]
23. Caras IW, Weddell GN. Signal peptide for protein secretion directing glycophospholipid membrane anchor attachment. Science. 1989;243:1196–1198. [PubMed]
24. Kwan WH, van der Touw W, Heeger PS. Complement regulation of T cell immunity. Immunol Res. 2012;54:247–253. [PMC free article] [PubMed]
25. Ermert D, Blom AM. C4b-binding protein: The good, the bad and the deadly. Novel functions of an old friend. Immunol Lett. 2016;169:82–92. [PubMed]
26. Kwon YC, Bose SK, Steele R, Meyer K, Di Bisceglie AM, Ray RB, Ray R. Promotion of Cancer Stem-Like Cell Properties in Hepatitis C Virus-Infected Hepatocytes. J Virol. 2015;89:11549–11556. [PMC free article] [PubMed]
27. Kornbluth J, Flomenberg N, Dupont B. Cell surface phenotype of a cloned line of human natural killer cells. J Immunol. 1982;129:2831–2837. [PubMed]
28. Kim H, Bose SK, Meyer K, Ray R. Hepatitis C virus impairs natural killer cell-mediated augmentation of complement synthesis. J Virol. 2014;88:2564–2571. [PMC free article] [PubMed]
29. Kanda T, Basu A, Steele R, Wakita T, Ryerse JS, Ray R, Ray RB. Generation of infectious hepatitis C virus in immortalized human hepatocytes. J Virol. 2006;80:4633–4639. [PMC free article] [PubMed]
30. Kim H, Meyer K, Di Bisceglie AM, Ray R. Inhibition of c3 convertase activity by hepatitis C virus as an additional lesion in the regulation of complement components. PLoS One. 2014;9:e101422. [PMC free article] [PubMed]
31. Okroj M, Holmquist E, King BC, Blom AM. Functional analyses of complement convertases using C3 and C5-depleted sera. PLoS One. 2012;7:e47245. [PMC free article] [PubMed]
32. Loberg RD, Day LL, Dunn R, Kalikin LM, Pienta KJ. Inhibition of decay-accelerating factor (CD55) attenuates prostate cancer growth and survival in vivo. Neoplasia. 2006;8:69–78. [PMC free article] [PubMed]
33. Basu A, Meyer K, Ray RB, Ray R. Hepatitis C virus core protein is necessary for the maintenance of immortalized human hepatocytes. Virology. 2002;298:53–62. [PubMed]
34. Bellone S, Roque D, Cocco E, Gasparrini S, Bortolomai I, Buza N, Abu-Khalaf M, Silasi DA, Ratner E, Azodi M, Schwartz PE, Rutherford TJ, Pecorelli S, Santin AD. Downregulation of membrane complement inhibitors CD55 and CD59 by siRNA sensitises uterine serous carcinoma overexpressing Her2/neu to complement and antibody-dependent cell cytotoxicity in vitro: implications for trastuzumab-based immunotherapy. Br J Cancer. 2012;106:1543–1550. [PMC free article] [PubMed]
35. Amet T, Ghabril M, Chalasani N, Byrd D, Hu N, Grantham A, Liu Z, Qin X, He JJ, Yu Q. CD59 incorporation protects hepatitis C virus against complement-mediated destruction. Hepatology. 2012;55:354–363. [PMC free article] [PubMed]
36. Ishiguro T, Sugimoto M, Kinoshita Y, Miyazaki Y, Nakano K, Tsunoda H, Sugo I, Ohizumi I, Aburatani H, Hamakubo T, Kodama T, Tsuchiya M, Yamada-Okabe H. Anti-glypican 3 antibody as a potential antitumor agent for human liver cancer. Cancer Res. 2008;68:9832–9838. [PubMed]
37. Gul N, Babes L, Siegmund K, Korthouwer R, Bogels M, Braster R, Vidarsson G, ten Hagen TL, Kubes P, van Egmond M. Macrophages eliminate circulating tumor cells after monoclonal antibody therapy. J Clin Invest. 2014;124:812–823. [PMC free article] [PubMed]
38. Rosner T, Lohse S, Peipp M, Valerius T, Derer S. Epidermal growth factor receptor targeting IgG3 triggers complement-mediated lysis of decay-accelerating factor expressing tumor cells through the alternative pathway amplification loop. J Immunol. 2014;193:1485–1495. [PubMed]
39. Basu A, Meyer K, Lai KK, Saito K, Di Bisceglie AM, Grosso LE, Ray RB, Ray R. Microarray analyses and molecular profiling of Stat3 signaling pathway induced by hepatitis C virus core protein in human hepatocytes. Virology. 2006;349:347–358. [PubMed]
40. Ray RB, Meyer K, Ray R. Hepatitis C virus core protein promotes immortalization of primary human hepatocytes. Virology. 2000;271:197–204. [PubMed]
41. Kemper C, Atkinson JP. T-cell regulation: with complements from innate immunity. Nat Rev Immunol. 2007;7:9–18. [PubMed]
42. Dumestre-Perard C, Ponard D, Drouet C, Leroy V, Zarski JP, Dutertre N, Colomb MG. Complement C4 monitoring in the follow-up of chronic hepatitis C treatment. Clin Exp Immunol. 2002;127:131–136. [PubMed]
43. Peters L, Grint D, Lundgren JD, Rockstroh JK, Soriano V, Reiss P, Grzeszczuk A, Sambatakou H, Mocroft A, Kirk O, Euro SIE. Hepatitis C virus viremia increases the incidence of chronic kidney disease in HIV-infected patients. AIDS. 2012;26:1917–1926. [PubMed]
44. El-Serag HB, Anand B, Richardson P, Rabeneck L. Association between hepatitis C infection and other infectious diseases: a case for targeted screening? Am J Gastroenterol. 2003;98:167–174. [PubMed]
45. Keeffe EB, Iwarson S, McMahon BJ, Lindsay KL, Koff RS, Manns M, Baumgarten R, Wiese M, Fourneau M, Safary A, Clemens R, Krause DS. Safety and immunogenicity of hepatitis A vaccine in patients with chronic liver disease. Hepatology. 1998;27:881–886. [PubMed]
46. Chlabicz S, Grzeszczuk A, Lapinski TW. Hepatitis B vaccine immunogenicity in patients with chronic HCV infection at one year follow-up: the effect of interferon-alpha therapy. Med Sci Monit. 2002;8:CR379–383. [PubMed]
47. Buxton JA, Kim JH. Hepatitis A and hepatitis B vaccination responses in persons with chronic hepatitis C infections: A review of the evidence and current recommendations. Can J Infect Dis Med Microbiol. 2008;19:197–202. [PMC free article] [PubMed]
48. Moorman JP, Zhang CL, Ni L, Ma CJ, Zhang Y, Wu XY, Thayer P, Islam TM, Borthwick T, Yao ZQ. Impaired hepatitis B vaccine responses during chronic hepatitis C infection: involvement of the PD-1 pathway in regulating CD4(+) T cell responses. Vaccine. 2011;29:3169–3176. [PMC free article] [PubMed]
49. Shi L, Wang JM, Ren JP, Cheng YQ, Ying RS, Wu XY, Lin SM, Griffin JW, Li GY, Moorman JP, Yao ZQ. KLRG1 impairs CD4+ T cell responses via p16ink4a and p27kip1 pathways: role in hepatitis B vaccine failure in individuals with hepatitis C virus infection. J Immunol. 2014;192:649–657. [PMC free article] [PubMed]
50. Yorita K, Takahashi N, Takai H, Kato A, Suzuki M, Ishiguro T, Ohtomo T, Nagaike K, Kondo K, Chijiiwa K, Kataoka H. Prognostic significance of circumferential cell surface immunoreactivity of glypican-3 in hepatocellular carcinoma. Liver Int. 2011;31:120–131. [PubMed]
51. Basu A, Kanda T, Beyene A, Saito K, Meyer K, Ray R. Sulfated homologues of heparin inhibit hepatitis C virus entry into mammalian cells. J Virol. 2007;81:3933–3941. [PMC free article] [PubMed]
52. Cummings KL, Waggoner SN, Tacke R, Hahn YS. Role of complement in immune regulation and its exploitation by virus. Viral Immunol. 2007;20:505–524. [PubMed]
53. Spiller OB, Morgan BP. Antibody-independent activation of the classical complement pathway by cytomegalovirus-infected fibroblasts. J Infect Dis. 1998;178:1597–1603. [PubMed]
54. Cooper NR, Jensen FC, Welsh RM, Jr, Oldstone MB. Lysis of RNA tumor viruses by human serum: direct antibody-independent triggering of the classical complement pathway. J Exp Med. 1976;144:970–984. [PMC free article] [PubMed]
55. Solder BM, Schulz TF, Hengster P, Lower J, Larcher C, Bitterlich G, Kurth R, Wachter H, Dierich MP. HIV and HIV-infected cells differentially activate the human complement system independent of antibody. Immunol Lett. 1989;22:135–145. [PubMed]
56. Ikeda F, Haraguchi Y, Jinno A, Iino Y, Morishita Y, Shiraki H, Hoshino H. Human complement component C1q inhibits the infectivity of cell-free HTLV-I. J Immunol. 1998;161:5712–5719. [PubMed]
57. Wang FS. Current status and prospects of studies on human genetic alleles associated with hepatitis B virus infection. World J Gastroenterol. 2003;9:641–644. [PMC free article] [PubMed]
58. Hartshorn KL, Sastry K, White MR, Anders EM, Super M, Ezekowitz RA, Tauber AI. Human mannose-binding protein functions as an opsonin for influenza A viruses. J Clin Invest. 1993;91:1414–1420. [PMC free article] [PubMed]
59. Thielens NM, Tacnet-Delorme P, Arlaud GJ. Interaction of C1q and mannan-binding lectin with viruses. Immunobiology. 2002;205:563–574. [PubMed]