PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurol Sci. Author manuscript; available in PMC 2017 March 15.
Published in final edited form as:
PMCID: PMC4779500
NIHMSID: NIHMS759394

Blepharospasm in a multiplex African-American pedigree

Abstract

Background

Isolated blepharospasm (BSP) is a late-onset focal dystonia characterized by involuntary contractions of the orbicularis oculi muscles. Genetic studies of BSP have been limited by the paucity of large multiplex pedigrees. Although sequence variants (SVs) in THAP1 have been reported in rare cases of BSP, the genetic causes of this focal dystonia remain largely unknown. Moreover, in the absence of family history and strong in silico or in vitro evidence of deleteriousness, the pathogenicity of novel SVs in THAP1 and other dystonia-associated genes can be indeterminate.

Methods

A large African-American pedigree with BSP was phenotypically characterized and screened for mutations in THAP1, TOR1A and GNAL with Sanger sequencing. Whole-exome sequencing of the proband was used to examine other dystonia-associated genes for potentially pathogenic SVs. In silico and co-segregation analyses were performed for a novel THAP1 SV identified in the proband.

Results

Seven family members exhibited increased blinking and/or stereotyped bilateral and synchronous orbicularis oculi spasms with age of onset ranging from early childhood to late adult life (7 to 54 years). The proband was found to harbor a novel THAP1 SV (c.314T>C, p.L105S). However, the p.L105S SV did not co-segregate with blepharospasm in the pedigree. Moreover, in silico analyses suggest that p.L105S is benign. No pathogenic or likely pathogenic SVs in other dystonia-associated genes were identified with whole-exome sequencing.

Conclusions

Blepharospasm can be familial and may be hereditary in African-Americans. A comprehensive array of in silico tools, and, if possible, co-segregation analysis should be used to classify SVs in dystonia-associated genes.

Keywords: Dystonia, Blepharospasm, THAP1, Sequence variant, African-American

1. Introduction

Isolated blepharospasm (BSP) is a late-onset focal dystonia characterized by involuntary contractions of the orbicularis oculi muscles [1]. BSP is a relatively common form of focal dystonia, with prevalence estimates ranging from 1.6 to 13.3/100,000 worldwide [2]. Mean age of onset is from 50 to 60 years and women are more commonly affected than men [1, 3]. Genetic factors are believed to play an important role in the etiopathogenesis of BSP given that 10 to 27% of affected individuals report a positive family history of dystonia [4, 5]. BSP is within the phenotypic spectrum of several genetic forms of dystonia inherited in autosomal dominant fashion (DYT1, DYT6, and DYT25) [4, 6]. Although rare cases of BSP as a singular dystonia manifestation have been linked to THAP1 mutations, the genetic underpinnings of this important focal dystonia remain largely unknown and large pedigrees adequately powered for linkage analysis are quite uncommon [4, 7]. Although one large Italian BSP family has been described in the literature [8], there have been no reports of large BSP pedigrees in other ethnic and racial groups.

2. Patients and Methods

2.1 Human Subjects

All human studies were conducted in accordance with the Declaration of Helsinki with formal approval from the University of Tennessee Health Science Center Institutional Review Board (01-07346-FB, 05-08331-XP, and 14-03320-XP). All subjects gave written informed consent for genetic analyses and disclosure of medical and demographic information. Subjects in this pedigree (Fig. 1) were examined by a neurologist (MSL) with subspecialty expertise in movement disorders. Subjects were asked to perform specific tasks including holding their eyes open, opening and closing their eyes gently, opening and closing their eyes forcefully, along with additional verbal and postural maneuvers design to capture masticatory, laryngeal or cervical involvement. Using motor severity classification from the Unified Dystonia Rating Scale, BSP was categorized as mild, moderate, severe or extreme. Medical histories were documented for each subject. A clinical diagnosis of definite BSP was given to subjects exhibiting increased blinking and stereotyped, bilateral and synchronous orbicularis oculi spasms inducing narrowing/closure of the eyelids [9]. Subjects with isolated episodes of increased eyelid blinking were given a diagnosis of possible BSP. Each affected or possibly affected family member was queried for the presence of sensory tricks.

Fig 1
Family pedigree. Arrow = proband. Filled symbols = affected. Half-filled symbols = possibly affected. +/+, homozygous wild-type allele. +/-, heterozygous for THAP1 c.314T>C.

2.2. Genetic analyses

Blood or saliva was acquired from 12 subjects, and DNA was extracted for variant screenings. Using previously defined primers, Sanger sequencing was employed to screen the proband for sequence variants (SVs) in THAP1, GNAL and Exon 5 of TOR1A [4, 6, 10]. For whole-exome sequencing, the proband's genomic DNA (3 μg) was sheared to yield 100-450 bp fragments, followed by processing with an Illumina (San Diego, CA) paired-end library preparation kit. Target enrichment was performed with the Agilent SureSelect Human All Exon V5 kit (Santa Clara, CA). Enriched DNA fragments were sequenced on Illumina's HiSeq 2000 platform as paired-end 100-125 base reads (Otogenetics Co., Norcross, GA USA). Sequence reads (FASTQ) were mapped to the human reference genome (NCBI build 37.1) with NextGENe® (SoftGenetics, State College, PA, USA). An integrated query of all NCBI databases with the search term ‘blepharospasm’ produced the following list of genes that have been associated with BSP as an isolated dystonia or part of a more complex neurogenetic syndrome: THAP1, TOR1A, SGCE, ATCAY, CIZ1, GNAL, ANO3, PRRT2, ATM, PRKRA, GCH1, TAF1, PNKD, ATP1A3, SLC2A1, TH, SPR, TIMM8A, DRD5, CP, PANK2, FTL, FBX07, and DJ1. SVs in reads mapped to these genes were analyzed in silico with the following programs which predict pathogenicity or deleteriousness: PolyPhen-2, MutationTaster, Sorting Intolerant From Tolerant (SIFT), Likelihood Ratio Test (LRT), and Combined Annotation Dependent Depletion (CADD). The allele frequency of identified SVs was compared to reported frequencies in dbSNP (http://www.ncbi.nlm.nih.gov/SNP/), 1000 Genomes (1KG, www.1000genomes.org) and Exome Aggregation Consortium (ExAC, exac.broadinstitute.org).

A presumed SV in DRD5, detected with whole-exome sequencing, was examined with genomic DNA (gDNA) and complementary DNA (cDNA) from the proband using forward (DRD5_F, cagtccagcccgaaatgc, NM_000798.4: 383-400) and reverse primers (DRD5_R, cacgaaaaggtctgacacgg, NM_000798.4 666-647) to generate a 284 bp amplicon. PCR was performed using 40 ng of peripheral blood gDNA or 2 μl of cDNA transcribed from 10 ng of total RNA along with 200 nM of each primer in a 10-μl reaction volume with HotStarTaq® Plus DNA polymerase from Qiagen (Valencia, CA). The following cycling conditions were employed: 95°C for 15 min; 35 cycles at 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s.

3. Results

Herein, we report a large multiple African-American pedigree with BSP (Table 1, Fig. 1). Among the 12 subjects that were examined (Fig. 1), 7 were assigned a diagnosis of either definite or possible BSP (II-1, II-3, II-5, II-7, III-4, III-9, and III-12) with ages of onset ranging from 7 years to 54 years of age.

Table 1
Phenotypes and THAP1 genotypes

The proband (II-3) was most recently examined at 66 years of age and reported onset of BSP at 48 years of age. At age 62, he underwent an extensive dental extraction and noted the development of lower facial and jaw-opening masticatory dystonia several months later. Neurological examination showed evidence of severe BSP with increased blink frequency and prolonged spasms of the orbicularis oculi muscles. Lower facial involvement and involuntary jaw-opening were prominent. The proband has shown significant and consistent benefit from injections of incobotulinumtoxinA for treatment of BSP and lower facial dystonia. He has also received electromyographically-guided injections of incobotulinumtoxinA into the inferior head of the lateral pterygoid muscles with notable reductions in involuntary jaw opening.

Three other family members, II-5 (59 years old), III-9 (33 years old), and III-12 (27 years old) were given diagnoses of definite BSP. Subject II-5, a sister of the proband, reported episodes of increased blinking, possibly triggered by phacoemulsification of her cataracts. In agreement with our clinical examination, Subject II-5 noted that she was less severely affected than her son (Subject III-9). Subject III-12, a niece of the proband, first noticed increased eyelid blinking at the age of 7 years. Subject III-12 was diagnosed with Tourette syndrome as a child due to the presence of motor and phonic tics which largely resolved by 15 years of age. At her most recent evaluation, BSP was present with eyelid spasms and narrowing of the palpebral fissures but no motor or phonic tics were apparent. Unlike the proband, these three additional family members with definite BSP did not exhibit oromandibular or lower facial involvement. In addition, none of the individuals in this pedigree had manifest cervical or appendicular dystonia. None of these definitely affected subjects had identified any useful sensory trick. No members of the pedigree reported dry eyes. Subjects II-5, III-9 and III-12 had not sought treatment for their BSP.

The proband's son (III-4, 30 years old) and two sisters (II-1, 69 years old, and II-7, 50 years old) were assigned diagnoses of possible BSP due to increased blink frequency. The exact ages of onset are unknown for these subjects. Subject II-1, a diabetic, reported eye spasms which were less severe than those experienced by the proband and other affected individuals, but indicated that her spasms were worse at night and when fatigued. Neither Subject III-4 nor II-7 reported eye spasms, although episodes of increased eyelid blinking were provoked in all three of these subjects during examinations.

Sanger sequencing of THAP1, GNAL, and Exon 5 of TOR1A exposed a THAP1 missense SV (c.314T>C, p.L105S). This SV was not present in dbSNP or 1KG. In addition, c.314T>C was not detected in 200 African-American alleles or 1000 Caucasian control alleles in our own laboratory database. However, in the ExAC database, c.314T>C was found in one African-American subject (Minor Allele Frequency [MAF] = 0.000008). In our pedigree, this SV was detected in only 5 of 7 affected subjects (II-1, II-3, II-7, III-4, and III-12) and 1 normal subject (II-4). Therefore, c.314T>C did not co-segregation with BSP in this family. In silico analyses with PolyPhen-2, MutationTaster, SIFT and LRT indicated that this variant is not pathogenic with scores of 0, 1, 0.75, and 0.009, respectively. Moreover, CADD, a robust tool for scoring the deleteriousness of single nucleotide variants as well as insertion/deletion variants in the human genome, generated a PHRED score of 0.476 which suggests that THAP1 c.314T>C is benign.

Whole-exome data from the proband showed that over 98.6% of exons were covered at ≥ 10× and 97.5% were covered at ≥ 20× (Table 2). As shown in Table 3, all dystonia-associated genes were adequately covered to detect coding SVs. SVs in genes previously reported to be associated with dystonia were analyzed for pathogenicity/deleteriousness using CADD, SIFT, PolyPhen-2, and MutationTaster. However, we did not identify a single potential candidate SV based on in silico analyses of pathogenicity/deleteriousness and associated MAFs within 1KG and ExAC (Table 4). Although a few SVs had high CADD PHRED scores, they were not deemed to be viable candidate SVs due to high MAFs in 1KG and ExAC.

Table 2
Exome sequencing quality metrics and sequence variant filtering
Table 3
Gene-specific coverage metrics
Table 4
Sequence variants identified in dystonia-associated genes and in silico analyses

Bidirectional Sanger sequencing of gDNA and cDNA showed that the presumed SV in DRD5 (Table 3, c.116C>T) was, in fact, a three nucleotide change (c.115TCA>GTG) present within DRD5 pseudogenes (DRD5P1 and DRD5P2), and, hence, a next-generation mapping error. Although DRD5 pseudogene transcription has been reported in brain, we did not detect c.115TCA>GTG in leukocyte cDNA.

4. Discussion

Though BSP is a seemingly common form of focal dystonia seen by neurologists and ophthalmologists, the reported prevalence of BSP has been highly variable, with crude estimates ranging from 16 to 133 cases per million, mainly in studies of Caucasian populations [1, 2]. BSP has been described in African-Americans [6, 11] but to our knowledge no large multiplex BSP pedigrees have been published in the English literature. However, one subject from a large African-American pedigree with dystonia due to a GNAL SV did manifest BSP as part of her segmental craniocervical dystonia [6]. While cervical dystonia is reportedly less common in African-Americans than Caucasian-Americans, the relative prevalence of BSP in African-Americans and other racial groups has not been well characterized [12].

Age and female gender are risk factors for developing BSP [1, 13]. Among the 7 definitely or probably affected subjects in our pedigree, 4 were female and 3 were male. However, the 2 most severely affected individuals were male. Previous studies have also shown that there is an increased risk of developing BSP in subjects with a family history of dystonia or postural tremor, prior head and face trauma, and prior eye disease [1, 13]. None of the patients in our pedigree had a manifest action tremor or history of head trauma. One affected female subject reported the onset of BSP several weeks after bilateral phacoemulsification of cataracts. No associations have been found with age-related medical conditions such as hypertension and diabetes which were present in two of our patients. Patients with BSP often show spread of dystonia to contiguous craniocervical anatomical segments, most commonly within 5 years, as seen our proband [3].

At the time of this report, only one of the family members with BSP was receiving medical treatment for this disorder. The other affected individuals in the family related that were not motivated to pursue treatment due to a variety of factors including fear of botulinum toxin injections, lack of insurance coverage, concerns related to insurance co-payments, and modest functional disability associated with their BSP. This information suggests that racial and socioeconomic factors can exert important effects on epidemiological studies of BSP, other dystonias, and other movement disorders, and BSP may be more common in the African-American population than commonly thought.

THAP1 dystonia often begins in an arm during the late teen years or early-adult life [4]. Involvement of the neck, larynx and lower cranial musculature is common. BSP is uncommon in THAP1 dystonia (18.9% of patients with missense mutations) and typically occurs in combination with involvement of other craniocervical anatomical segments and the arms [4]. BSP as the site of dystonia onset is seen in less than 1% of subjects with missense mutations in THAP1 [4, 7]. Non-coding variants in the 5′-untranslated region (UTR, c.-42C>T) and Intron 1 (c.71+9C>A) of THAP1 were reported in two patients with sporadic BSP [4]. The same 5′UTR SV (c. -40T>C) was also reported by another group in a subject with BSP [7]. In the same report, a novel missense SV (c.208 A>G, p.K70E) was described in a 65-year old woman diagnosed with sporadic BSP at the age of 55 [7]. The THAP1 SV reported herein was predicted to be benign by multiple in silico analyses and did not co-segregate with BSP (c.314T>C, p.L105S).

Whole-exome sequencing in the proband did not identify another candidate SV in a dystonia-associated gene. The presumed DRD5 SV identified with whole-exome sequencing was actually localized to DRD5 pseudogenes [14, 15]. As shown in our proband, paralogs, read errors, and mapping errors can complicate interpretation of next-generation sequencing data [16, 17].

Although we showed that a rare THAP1 SV did not co-segregate with the BSP phenotype in our African-American pedigree, we did confirm that BSP can be familial and may be hereditary in African-Americans. The distribution of the BSP phenotype in our pedigree is most consistent with autosomal dominant inheritance as has been the case for most isolated dystonia genes (TOR1A, THAP1, GNAL, and CIZ1) [18]. Although in silico tools such as CADD provide useful information on the deleteriousness of missense variants, they do not reliably predict pathogenicity. Therefore, pedigrees should be expanded and subjected to co-segregation analysis if novel SVs are identified in probands. Moreover, next-generation sequencing data must be confirmed with bidirectional Sanger sequencing and bioinformatic analyses to exclude mislocalization to paralogous sequences in the genome.

Highlights

  • Blepharospasm can be familial in African-Americans
  • Blepharospasm may be hereditary in African-Americans
  • If possible, co-segregation analysis should be used to classify sequence variants
  • Paralogous genes can complicate interpretation of whole-exome sequencing data

Acknowledgments

We thank all of the family members who contributed to our study.

MSL serves on the speakers' bureau for Lundbeck; has served as a consultant for TEVA Neuroscience, US WorldMeds, and the Mayo Clinic; received research support from the NIH (R01NS069936, R01NS082296, U54NS065701), Omeros, Auspex, TEVA Neuroscience, US WorldMeds and CHDI; and received royalty payments from Elsevier/Academic Press.

Funding sources for study: This study was supported by the Neuroscience Institute at the University of Tennessee Health Science Center, Benign Essential Blepharospasm Research Foundation, Dystonia Medical Research Foundation, and NIH grants R01 NS082296 and R01 NS069936.

Footnotes

Roles of the authors: JX and SRV performed the genetic and bioinformatic analysis. MMT collected clinical data and biological specimens. JX, MMT and MSL wrote the first draft of the manuscript. MSL examined subjects. All authors reviewed clinical and genetic data and contributed to the final version of the manuscript.

Financial disclosures of all authors (related to research covered in this article and for the preceding 12 months): JX, MMT, and SRV have nothing to disclose.

Conflict of Interest concerning the research related to the manuscript: JX, MMT, SRV and MSL have no conflicts of interest related to the manuscript.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Hallett M, Evinger C, Jankovic J, Stacy M. Update on blepharospasm: report from the BEBRF International Workshop. Neurology. 2008;71:1275–1282. [PMC free article] [PubMed]
2. Defazio G, Abbruzzese G, Livrea P, Berardelli A. Epidemiology of primary dystonia. Lancet Neurol. 2004;3:673–678. [PubMed]
3. Martino D, Berardelli A, Abbruzzese G, Bentivoglio AR, Esposito M, Fabbrini G, et al. Age at onset and symptom spread in primary adult-onset blepharospasm and cervical dystonia. Mov Disord. 2012;27:1447–1450. [PubMed]
4. LeDoux MS, Xiao J, Rudzinska M, Bastian RW, Wszolek ZK, Van Gerpen JA, et al. Genotype-phenotype correlations in THAP1 dystonia: molecular foundations and description of new cases. Park Rel Disord. 2012;18:414–425. [PMC free article] [PubMed]
5. Defazio G, Martino D, Aniello MS, Masi G, Abbruzzese G, Lamberti S, et al. A family study on primary blepharospasm. J Neurol Neurosurg Psych. 2006;77:252–254. [PMC free article] [PubMed]
6. Vemula SR, Puschmann A, Xiao J, Zhao Y, Rudzinska M, Frei KP, et al. Role of Galpha(olf) in familial and sporadic adult-onset primary dystonia. Hum Mol Genet. 2013;22:2510–2519. [PMC free article] [PubMed]
7. Xiromerisiou G, Dardiotis E, Tsironi EE, Hadjigeorgiou G, Ralli S, Kara E, et al. THAP1 mutations in a Greek primary blepharospasm series. Park Rel Disord. 2013;19:404–405. [PubMed]
8. Defazio G, Brancati F, Valente EM, Caputo V, Pizzuti A, Martino D, et al. Familial blepharospasm is inherited as an autosomal dominant trait and relates to a novel unassigned gene. Mov Disord. 2003;18:207–212. [PubMed]
9. Defazio G, Hallett M, Jinnah HA, Berardelli A. Development and validation of a clinical guideline for diagnosing blepharospasm. Neurology. 2013;81:236–240. [PMC free article] [PubMed]
10. Xiao J, Bastian RW, Perlmutter JS, Racette BA, Tabbal SD, Karimi M, et al. High-throughput mutational analysis of TOR1A in primary dystonia. BMC Med Genet. 2009;10:24. [PMC free article] [PubMed]
11. Lee MS, Harrison AR, Grossman DS, Sloan FA. Risk of glaucoma among patients with benign essential blepharospasm. Ophthal Plast Reconstr Surg. 2010;26:434–437. [PMC free article] [PubMed]
12. Marras C, Van den Eeden SK, Fross RD, Benedict-Albers KS, Klingman J, Leimpeter AD, et al. Minimum incidence of primary cervical dystonia in a multiethnic health care population. Neurology. 2007;69:676–680. [PubMed]
13. Defazio G, Abbruzzese G, Aniello MS, Bloise M, Crisci C, Eleopra R, et al. Environmental risk factors and clinical phenotype in familial and sporadic primary blepharospasm. Neurology. 2011;77:631–637. [PubMed]
14. Nguyen T, Sunahara R, Marchese A, Van Tol HH, Seeman P, O'Dowd BF. Transcription of a human dopamine D5 pseudogene. Biochem Biophys Res Commun. 1991;181:16–21. [PubMed]
15. Marchese A, Beischlag TV, Nguyen T, Niznik HB, Weinshank RL, George SR, et al. Two gene duplication events in the human and primate dopamine D5 receptor gene family. Gene. 1995;154:153–158. [PubMed]
16. Claes KB, De Leeneer K. Dealing with pseudogenes in molecular diagnostics in the next-generation sequencing era. Methods Mol Biol. 2014;1167:303–315. [PubMed]
17. Millson A, Lewis T, Pesaran T, Salvador D, Gillespie K, Gau CL, et al. Processed pseudogene confounding deletion/duplication assays for SMAD4. J Mol Diagn. 2015;17:576–582. [PubMed]
18. LeDoux MS. The genetics of dystonias. Adv Genet. 2012;79:35–85. [PMC free article] [PubMed]