PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbcThe Journal of Biological Chemistry
 
J Biol Chem. 2015 May 1; 290(18): 11578–11590.
Published online 2015 March 18. doi:  10.1074/jbc.M114.620237
PMCID: PMC4416861

The Coordinate Cellular Response to Insulin-like Growth Factor-I (IGF-I) and Insulin-like Growth Factor-binding Protein-2 (IGFBP-2) Is Regulated through Vimentin Binding to Receptor Tyrosine Phosphatase β (RPTPβ)*

Abstract

Insulin-like growth factor-binding protein-2 (IGFBP-2) functions coordinately with IGF-I to stimulate cellular proliferation and differentiation. IGFBP-2 binds to receptor tyrosine phosphatase β (RPTPβ), and this binding in conjunction with IGF-I receptor stimulation induces RPTPβ polymerization leading to phosphatase and tensin homolog inactivation, AKT stimulation, and enhanced cell proliferation. To determine the mechanism by which RPTPβ polymerization is regulated, we analyzed the protein(s) that associated with RPTPβ in response to IGF-I and IGFBP-2 in vascular smooth muscle cells. Proteomic experiments revealed that IGF-I stimulated the intermediate filament protein vimentin to bind to RPTPβ, and knockdown of vimentin resulted in failure of IGFBP-2 and IGF-I to stimulate RPTPβ polymerization. Knockdown of IGFBP-2 or inhibition of IGF-IR tyrosine kinase disrupted vimentin/RPTPβ association. Vimentin binding to RPTPβ was mediated through vimentin serine phosphorylation. The serine threonine kinase PKCζ was recruited to vimentin in response to IGF-I and inhibition of PKCζ activation blocked these signaling events. A cell-permeable peptide that contained the vimentin phosphorylation site disrupted vimentin/RPTPβ association, and IGF-I stimulated RPTPβ polymerization and AKT activation. Integrin-linked kinase recruited PKCζ to SHPS-1-associated vimentin in response to IGF-I and inhibition of integrin-linked kinase/PKCζ association reduced vimentin serine phosphorylation. PKCζ stimulation of vimentin phosphorylation required high glucose and vimentin/RPTPβ-association occurred only during hyperglycemia. Disruption of vimetin/RPTPβ in diabetic mice inhibited RPTPβ polymerization, vimentin serine phosphorylation, and AKT activation in response to IGF-I, whereas nondiabetic mice showed no difference. The induction of vimentin phosphorylation is important for IGFBP-2-mediated enhancement of IGF-I-stimulated proliferation during hyperglycemia, and it coordinates signaling between these two receptor-linked signaling systems.

Keywords: Akt PKB, Insulin-like Growth Factor (IGF), Serine/Threonine Protein Kinase, Vascular Smooth Muscle Cells, Vimentin

Introduction

The insulin-like growth factor-binding proteins were initially proposed as inert carriers of IGF-I whose primary function was to limit IGF-I access to receptors (1). Subsequent studies demonstrated that IGFBP3 modulated IGF-I cellular actions and that they had effects that were believed to be IGF-I-independent (2,4). Although several empiric observations have been published, the cell surface receptors that mediate these events and the signaling components that are required have rarely been characterized (5,7). Our recent studies demonstrated that IGFBP-2 significantly enhanced the ability of IGF-I to stimulate vascular smooth muscle cell (VSMC) proliferation and preosteoblast differentiation (8, 9). We further determined that IGFBP-2 binding to the specific cell surface receptor RPTPβ was required to mediate these effects (9). Knockdown of RPTPβ resulted in an inability of IGFBP-2 to stimulate these responses. Following RPTPβ polymerization, its phosphatase activity is inhibited. Utilization of a substrate-trapping mutant showed that the primary target of RPTPβ was PTEN and that RPTPβ polymerization was associated with enhanced PTEN tyrosine phosphorylation (9). PTEN tyrosine phosphorylation inhibited its activity leading to enhanced AKT activation. Therefore stimulation of RPTPβ polymerization following exposure to IGFBP-2 and IGF-I resulted in enhanced VSMC migration. IGFBP-2 binding to RPTPβ is also required for IGF-I to stimulate preosteoblast differentiation (10), and IGFBP-2 knockdown results in attenuation of osteoclast differentiation (11). Those studies showed that in addition to IGFBP-2 binding to RPTPβ, IGF-I receptor activation was required, and inhibition of the IGF-I receptor tyrosine kinase inhibited RPTPβ polymerization. Because activation of the IGF-I receptor as well as IGFBP-2 binding to RPTPβ was required to induce RPTPβ polymerization, we wished to determine the mechanism by which IGF-I functioned to stimulate this interaction. These studies were undertaken to determine post-receptor signaling events that led RPTPβ polymerization.

EXPERIMENTAL PROCEDURES

Human IGF-I was a gift from Genentech (San Francisco, CA). Immobilon-P membranes, an ILK inhibitor (Cpd 22), a myristoylated form of cell-permeable PKCζ pseudosubstrate inhibitor (catalog no. 539624) (12), and protein A- and G-agarose were purchased from EMD-Millipore (Billerica, MA). Dulbecco's modified medium (DMEM) containing 25 mm glucose, streptomycin, and penicillin were purchased from Life Technologies, Inc. PQ401 was purchased from Tocris Bioscience (Ellisville, MO). Antibodies against PTEN and phospho-AKT(S473) were from Cell Signaling Technology Inc. (Beverly, MA). The anti-phosphotyrosine (pY99), ILK, and vimentin antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). An anti-phosphoserine (Ser(P)) antibody was purchased from Abcam (Cambridge, MA). An anti-RPTPβ monoclonal antibody was purchased from BD Biosciences. SHPS-1 polyclonal antiserum was prepared as described previously (13). The IGFBP-2 antibody was prepared as described previously (8). The horseradish peroxidase-conjugated mouse anti-rabbit, goat anti-mouse, and mouse anti-rabbit light chain-specific antibodies were purchased from Jackson ImmunoResearch (West Grove, PA). All other reagents were purchased from Sigma unless otherwise stated. A synthetic peptide containing the cell permeability sequence of the protein transduction domain and the head domain sequence (underlined) from vimentin (YARAAARQARAR-SVSSSSYRRMF), hereafter referred as a disrupting peptide, and a peptide containing YARAAARQARAR-SVASAAYRRMF, wherein three serines were substituted with alanine (underlined), serving as a control peptide, were synthesized by the Protein Chemistry Core Facility at the University of North Carolina at Chapel Hill. Purity and the sequence were confirmed by mass spectrometry.

Cell Culture

The VSMC were isolated from the aortic explants obtained from 3-week-old pigs and were maintained as described previously (14). Cells were maintained in DMEM high glucose (25 mm) or DMEM with normal glucose (5 mm) with 10% fetal bovine serum (FBS) (Hyclone, Logan, UT), 100 μg/ml streptomycin, and 100 units/ml penicillin. In some experiments, 20 mm glucose was added to cells that had been exposed to normal glucose for different times prior to IGF addition. The cultures were used between passages 5 and 14.

Identification of RPTPβ Interaction Proteins by Tandem Mass Spectrometry (MALDI-TOF/MS)

VSMCs with or without IGF-I (50 ng/ml) treatment were lysed in the modified radioimmunoprecipitation assay (RIPA) buffer. Cell lysates (3 mg) were precleared with protein A/G-agarose for 30 min to eliminate nonspecific protein interactions and then incubated with an anti-RPTPβ antibody (6 μg) and protein A/G-agarose at 4 °C with gentle agitation for 3 h. The immunocomplexes were separated on a 4–20% gradient SDS-PAGE. The gel was stained with colloidal Blue G-250 (Thermo Fisher Scientific, Rockford, IL). The protein band that was increased in response to IGF-I was excised from the stained gel, destained with 200 mm ammonium bicarbonate (pH 8.0), 40% acetonitrile, twice at 37 °C for 30 min. The gel was exposed for 10 min to 100 mm ammonium bicarbonate, cut into small pieces, then dehydrated with 100% acetonitrile, and vacuum-dried. In-gel digestion was performed by adding 30 μl of modified porcine trypsin solution (Promega, Madison, WI) at 20 ng/μl in 50 mm ammonium bicarbonate following by a 14-h incubation at room temperature. Peptides were extracted with 50% (v/v) acetonitrile and 0.1% trifluoroacetic acid twice at 37 °C for 30 min, and the solution was completely dried in speed vacuum prior to MALDI-MS analysis conducted by the Proteomics Core Facility at the University of North Carolina at Chapel Hill.

Generation and Purification of Wild Type IGFBP-2 and an IGFBP-2 Mutant

Wild type mouse IGFBP-2 and heparin binding domain mutated IGFBP-2 (MT1) were generated and purified following the procedure described previously (9).

Establishment of VSMCs Expressing Wild Type SHPS-1 and Cytoplasmic Domain Truncated SHPS-1

VSMCs expressing wild type SHPS-1 (SHPS-1/WT) and cytoplasmic domain truncated SHPS-1 (SHPS-1/-CD) were prepared as described previously (15).

Establishment of VSMCs Expressing IGFBP-2 shRNA and Control shRNA

Based on Invitrogen website design tools, sequences containing 21 oligonucleotides (GG AGT TCT GAC ATG CGT ATT T) were used to construct a short hairpin RNA (shRNA) template plasmid in order to knock down IGFBP-2. Two-nucleotide substitutions (underlined GGAGTTCTGTGATGCGTATT) were inserted as a control shRNA. VSMCs expressing shRNA targeting IGFBP-2 and control shRNA were established following the procedure described previously (9).

Transient Transfection with siRNA Targeting Vimentin

siRNA targeting vimentin (sc-29523) and a control siRNA (sc-37007) were purchased from Santa Cruz Biotechnology, Inc. VSMCs were transfected using a concentration of 40 nm and the PepMute Plus reagent (SignaGen Laboratories) following the manufacturer's instructions. The experiments were initiated 72 h after transfection.

Immunoprecipitation and Immunoblotting

The immunoprecipitation and immunoblotting procedures were performed as described previously (9). Immunoprecipitation was performed by incubating 0.5 mg of cell lysate protein with 1 μg of each of the following antibodies: anti-vimentin, ILK, pY99, and Ser(P) at 4 °C overnight. Immunoblotting was performed using a dilution of 1:1000 for anti-pAKT(S473), PTEN, vimentin, and β-actin antibodies, a dilution of 1:500 for anti-RPTPβ antibody, and a dilution of 1:2000 for anti-IGFBP-2 antibody. The proteins were visualized using enhanced chemiluminescence (Thermo Fisher Scientific, Rockford, IL).

Chemical Cross-linking

The chemical cross-linking procedures were performed as described previously (9). Briefly, cells were washed three times with PBS and then incubated with 2 mg/ml bis[sulfosuccinimidyl]suberate, BS3 (Thermo Fisher Scientific, Rockford, IL) in PBS for 1 h on ice. Cross-linking was terminated by adding 50 mm Tris for 15 min. The cells were lysed, and the lysate was separated onto a 6% SDS-polyacrylamide gel.

Induction of Hyperglycemia in Mice and Preparation of Aortas for Analysis

All mouse experiments were approved by the Institutional Animal Care and Use Committees of the University of North Carolina at Chapel Hill. Hyperglycemia was induced in C57/B6 mice (Taconic, Hudson, NY) using the low dose streptozotocin (16). The mean weight and serum glucose concentration was 27.1 ± 0.6 g and 120.6 ± 22.6 mg/dl before streptozotocin injection. One week after injection, mean serum glucose concentration was 311.6 ± 21.4 mg/dl. The mice were maintained for another 2 weeks before any treatment. The mean weight and serum glucose concentration was 26.0 ± 0.9 g and 430.3 ± 59.2 mg/dl before sacrifice. There were 12 mice per treatment group. The disrupting peptide (4 mg/kg) or control peptide (4 mg/kg) was administered intraperitoneally twice (24 and 1 h before sacrifice) and IGF-I (1 mg/kg) or PBS was administered intraperitoneally 15 min before sacrifice. The aortic extracts were prepared following the procedure described previously (17). The protein concentration of aortic extracts was measured using a BCA assay (Thermo Scientific). Equal amounts of protein were used for each analysis.

Statistical Analysis

The results that are shown in all experiments are representative of at least three independent experiments and expressed as the mean ± S.D. The Student's t test was used to compare differences between two treatments for in vitro experiments. The Bonferroni correction was used when multiple variables were compared. One-way analysis of variance was applied for all data obtained from in vivo studies. In addition, repeated measures-analysis of variance was used where appropriate. p < 0.05 was considered statistically significant.

RESULTS

To determine whether a specific protein(s) associated with RPTPβ in response to IGF-I stimulation, we exposed VSMCs to IGF-I for 10 min in the presence of IGFBP-2 and then immunoprecipitated RPTPβ. The proteins that coimmunoprecipitated were separated by SDS-PAGE, and Colloidal Blue staining showed a major increase in a 58,000-kDa band in response IGF-I stimulation (Fig. 1A). Amino acid sequence analysis revealed that the band was the intermediate filament protein vimentin. That vimentin bound to RPTPβ in response to IGF-I was confirmed using immunoprecipitation (3.2 ± 0.6-fold increase) (Fig. 1B). To determine whether vimentin binding to RPTPβ mediated RPTPβ polymerization, siRNA was utilized to knock down vimentin, which resulted in 86 ± 5% inhibition of vimentin synthesis (p < 0.001) (Fig. 2A). Transient knockdown of vimentin did not result in a change in cell morphology, cytoskeletal structure, or increased cell death (data not shown). Exposure of cells expressing a control siRNA to IGF-I plus IGFBP-2 resulted in a 7.0 ± 0.4-fold greater stimulation of vimentin binding to RPTPβ compared with cells expressing the vimentin siRNA (p < 0.001) (Fig. 2B). To assess the functional significance of loss of RPTPβ/vimentin association, we determined the effect of IGF-I plus IGFBP-2 on RPTPβ polymerization. As shown in Fig. 2C, cells expressing vimentin siRNA had complete attenuation of RPTPβ polymerization indicating that vimentin binding to RPTPβ was absolutely required. To assess the functional significance of loss of RPTPβ polymerization, we analyzed PTEN tyrosine phosphorylation because RPTPβ specifically dephosphorylates this substrate (9). As shown in Fig. 2D, IGF-I stimulated a 4.3 ± 0.3-fold increase in PTEN tyrosine phosphorylation, whereas vimentin knockdown resulted in near complete loss of the IGF-I/IGFBP-2-stimulated response (e.g. 1.4 ± 0.2-fold increase) (p < 0.01 compared with control). IGF-I-stimulated a 7.2 ± 1.4-fold increase (p < 0.001) in AKT phosphorylation in control cells, and this response was significantly attenuated in cells treated with vimentin siRNA (p < 0.01) (Fig. 2E). Therefore, vimentin association with RPTPβ is required for IGF-I-stimulated RPTPβ polymerization and optimum enhancement of AKT activation.

FIGURE 1.
IGF-I stimulates vimentin/RPTPβ interaction in VSMCs during hyperglycemia. VSMCs were cultured in DMEM containing high glucose (25 mm) plus 10% FBS and then serum-deprived for 16 h before stimulation without (−) or with (+) IGF-I (50 ng/ml) ...
FIGURE 2.
Vimentin is required for IGF-I-stimulated RPTPβ polymerization, PTEN tyrosine phosphorylation, and AKT activation. VSMCs treated with the siRNA targeting vimentin (vimentin Si) and a control siRNA (Ctrl Si) were serum-deprived for 16 h and then ...

To determine the relative importance of IGFBP-2 binding to RPTPβ and whether IGF-I activation of IGF-IR is required for stimulation of vimentin binding to RPTPβ, we used cells expressing an IGFBP-2 shRNA that had been shown to have impaired RPTPβ polymerization (9). Cells expressing the IGFBP-2 shRNA had a 93 ± 8% decrease in IGFBP-2 secretion and showed no vimentin/RPTPβ binding (Fig. 3A). Exposure of the knockdown cells to IGFBP-2 and IGF-I rescued vimentin/RPTPβ association (5.4 ± 0.7-fold increase compared with 6.8 ± 0.2-fold in control cells). IGF-I receptor activation was also required for vimentin to bind to RPTPβ, because in the presence of an IGF-IR tyrosine kinase inhibitor, PQ401, there was a 72 ± 10% (p < 0.01) reduction in stimulation of vimentin/RPTPβ association (Fig. 3B). To determine the region of IGFBP-2 that was interacting with RPTPβ to facilitate vimentin binding, we utilized cells expressing an IGFBP-2 mutant (MT-1), which had been shown previously to have attenuated RPTPβ binding. This mutant has no reduction in its affinity for IGF-I. Stimulation of the cultures with IGF-I and the mutant form of IGFBP-2 resulted in significant attenuation of stimulation RPTPβ/vimentin association (79 ± 6% reduction, p < 0.001) (Fig. 3C).

FIGURE 3.
IGF-I-stimulated vimentin/RPTPβ association requires IGF-I receptor activation and the presence of IGFBP-2. A and C, VSMCs were transduced with control (Ctrl si) or IGFBP-2 shRNA (IGFBP-2 Si) template plasmids, and conditioned medium was analyzed ...

To determine the mechanism by which IGF-I receptor activation stimulated vimentin/RPTPβ association, we analyzed the role of vimentin serine phosphorylation because serine phosphorylation of the vimentin head domain has been shown to mediate protein/protein interactions (18). Following IGF-I stimulation, there was a 5.1 ± 0.4-fold increase in serine phosphorylation of vimentin (Fig. 4A). The IGF-IR tyrosine kinase inhibitor significantly inhibited IGF-I-stimulated vimentin serine phosphorylation (1.7 ± 0.3-fold increase) (82 ± 12% reduction compared with control, p < 0.001) (Fig. 4A). In contrast, when cells expressing IGFBP-2 shRNA were analyzed, there was no inhibition of IGF-I-stimulated vimentin phosphorylation (e.g. an 3.6 ± 0.6-fold increase in control cells and an 3.3 ± 0.9-fold increase in IGFBP-2 knockdown cells) (Fig. 4B). The vimentin head domain sequence contains 16 known serine phosphorylation sites (18). To identify the kinase that phosphorylated vimentin, we prepared cell-permeable peptides that contained sequence motifs that had been shown to be phosphorylated by specific kinases that were known to phosphorylate vimentin, and we then screened them for their ability to disrupt RPTPβ/vimentin association. The response to a cell-permeable peptide that contained the consensus sequence of a known PKCζ phosphorylation site located between residues 2 and 11 in the vimentin N terminus was compared to a control peptide in which three of the serines in this sequence had been substituted with alanine. The native peptide completely inhibited RPTPβ/vimentin association in response to IGF-I, whereas the control peptide had no effect (Fig. 5A). To assess the functional consequence of inhibiting vimentin/RPTPβ association, we repeated the experiment and then assessed the effect on RPTPβ polymerization. As shown in Fig. 5B, this was completely inhibited, and the ability of IGF-I/IGFBP-2 to stimulate PTEN tyrosine phosphorylation was also significantly decreased (Fig. 5C). Subsequent analysis of IGF-I-stimulated AKT activation revealed the predicted increase and a significant reduction (e.g. 76 ± 8% decrease, p < 0.01) in the degree of stimulation following exposure to the vimentin/RPTPβ-disrupting peptide (Fig. 5D). Exposure to the disrupting peptide had no effect on vimentin phosphorylation (Fig. 5E), thereby excluding the possibility that it functioned to inhibit kinase activity.

FIGURE 4.
IGF-I-stimulated vimentin serine phosphorylation requires IGF-I receptor activation but not IGFBP-2 stimulation. A, VSMCs were serum-deprived for 16 h and then incubated with the IGF-I receptor tyrosine kinase inhibitor, PQ401, or vehicle for 1 h prior ...
FIGURE 5.
Disruption of vimentin/RPTPβ association impaired IGF-I-stimulated RPTPβ polymerization, PTEN tyrosine phosphorylation, and AKT activation. VSMCs were serum-deprived for 16 h and then incubated with a control (Ctrl) peptide (CP) or a peptide ...

The results shown in Fig. 5 suggested PKCζ is the kinase that phosphorylates vimentin in response to IGF-I. Our prior studies have shown that in this cell type exposure to hyperglycemia and IGF-I specifically activates PKCζ and that PKCζ is required for optimal IGF-I stimulation of downstream signaling (17). Based on that result, we stimulated cultures with IGF-I and then examined vimentin serine phosphorylation in the presence or absence of a cell-permeable peptide containing the sequence of a PKCζ pseudosubstrate peptide inhibitor (12). IGF-I-stimulated vimentin serine phosphorylation was significantly attenuated in the cultures exposed to the PKCζ inhibitor (Fig. 6A), leading to impaired vimentin/RPTPβ association (Fig. 6B). In contrast, when cells were maintained in 5 mm glucose, there was no increase of vimentin serine phosphorylation and no vimentin/RPTPβ association (Fig. 6, C and D). To confirm that the peptide was inhibiting vimentin/RPTPβ association by inhibiting vimentin phosphorylation and not by inhibiting vimentin binding to PKCζ, we immunoprecipitated vimentin and immunoblotted for PKCζ following IGF-I stimulation. IGF-I stimulated PKCζ/vimentin association, and the pseudosubstrate inhibitor had no effect on this protein/protein interaction (Fig. 6E). We subsequently determined that exposure to the pseudosubstrate inhibitor completely inhibited RPTPβ polymerization (Fig. 6F) indicating that recruitment of this kinase to vimentin and its subsequent phosphorylation is critical for PKCζ stimulation of vimentin serine phosphorylation and RPTPβ polymerization.

FIGURE 6.
PKCζ mediates IGF-I-stimulated vimentin serine phosphorylation. VSMCs were serum-deprived for 16 h and then incubated without or with a PKCζ inhibitor (10 μm) for 1 h prior to IGF-I (50 ng/ml) stimulation (+) or no stimulation ...

In VSMC exposed to hyperglycemia, IRS-1 is down-regulated, and IGF-I receptor-linked signaling occurs through assembly of a signaling complex on the plasma membrane-associated scaffold, SHPS-1. SHPS-1 is tyrosine-phosphorylated in response to IGF-I receptor stimulation, and inhibition of formation of this signaling complex on the SHPS-1 scaffold results in major attenuation of AKT activation (19). Therefore, to identify the proximal signaling components that were required for PKCζ recruitment to vimentin, we investigated the role of the SHPS-1 signaling complex. Our prior proteomic screening studies had shown that ILK is preferentially recruited to SHPS-1 in response to IGF-I stimulation (15). Based on that result, we determined whether PKCζ was recruited to ILK following IGF-I stimulation. As shown in Fig. 7A, following IGF-I stimulation PKCζ was recruited to ILK, and this was inhibited by an ILK inhibitor (72 ± 8% decrease, p < 0.01). More importantly, exposure to the inhibitor also disrupted PKCζ recruitment to vimentin (Fig. 7B), and IGF-I stimulated vimentin serine phosphorylation (77 ± 7% reduction with 5 μm, compared with control, p < 0.01) (Fig. 7C). This was associated with the failure to recruit vimentin to RPTPβ (Fig. 7D) and loss of IGF-I-stimulated AKT phosphorylation (Fig. 7E). To determine whether ILK was facilitating PKCζ/vimentin association through recruitment of PKCζ to SHPS-1, we utilized cells expressing an SHPS-1 cytoplasmic domain-truncated mutant that did not bind ILK (15). Expression of this SHPS-1 mutant resulted in failure to recruit PKCζ to vimentin (Fig. 7F), and this was associated with inhibition of IGF-I-stimulated vimentin phosphorylation (Fig. 7G). Subsequently, we determined that in the absence of the SHPS-1 cytoplasmic domain, PKCζ was not recruited to SHPS-1 (Fig. 7H). This confirmed that the SHPS-1 scaffold was necessary for PKCζ/vimentin association. This failure to recruit PKCζ to SHPS-1 resulted in nearly complete loss of IGF-I-stimulated vimentin binding to RPTPβ (Fig. 7I).

FIGURE 7.
ILK is recruited to SHPS-1 and mediates IGF-I-stimulated vimentin/PKCζ interaction. A–E, VSMCs were serum-deprived for 16 h and then incubated without or with an ILK inhibitor (5 μm, or indicated concentrations) for 1 h prior to ...

To determine the significance of these signaling events in vivo, mice were made diabetic and then exposed to the peptide that inhibited vimentin/RPTPβ association. Analysis of the aortas following the injection of a biotinylated form of the peptide showed that it was taken up by the aortas in 1 h (data not shown). Following injection of IGF-I, there was marked stimulation of RPTPβ/vimentin binding, and this was significantly inhibited in the presence of disrupting the peptide (Fig. 8A). In contrast, the control peptide had no effect (Fig. 8A). IGF-I stimulated a 4.3 ± 0.7-fold increase in vimentin serine phosphorylation that was attenuated with exposure of the mice to the PCKζ inhibitor (Fig. 8B). In contrast, nondiabetic mice showed no increase in vimentin serine phosphorylation (Fig. 8C). The disrupting peptide also inhibited IGF-I-stimulated PTEN tyrosine phosphorylation (Fig. 8D) and AKT activation (a 78 ± 7% reduction compared with control, p < 0.01) (Fig. 8E). We have reported that these signaling events are attenuated in nondiabetic mice (9, 20). Therefore, this interconnected series of signaling events that had been delineated in smooth muscle cells in culture could be reproduced in intact aorta in diabetic mice.

FIGURE 8.
Disruption of vimentin/RPTPβ association impaired IGF-I-stimulated PTEN tyrosine phosphorylation and pAKT activation in vivo. A control peptide (CP) or a disrupting peptide (AP) (A, C, and D) or a PKCζ inhibitor (B) was injected (intraperitoneally) ...

DISCUSSION

Our prior studies showed that IGFBP-2 stimulates RPTPβ polymerization leading to inhibition of its tyrosine phosphatase activity and enhanced tyrosine phosphorylation of PTEN, its primary target in vascular smooth muscle cells and preosteoblasts (9, 10). This increase in PTEN tyrosine phosphorylation led to reduced PTEN enzymatic activity resulting in enhanced AKT activation and stimulation of vascular smooth muscle migration or osteoblast differentiation responses to IGF-I (9,11). Although binding of IGFBP-2 to RPTPβ through its heparin binding domain was required for RPTPβ polymerization, concomitant activation of the IGF-I receptor was also required. Therefore, these studies were undertaken to determine the mechanism by which IGF-I enhanced the ability of IGFBP-2 to stimulate RPTPβ polymerization. The results definitively show that IGF-I receptor activation stimulates vimentin binding to RPTPβ and that this is absolutely required for RPTPβ polymerization. Disruption of vimentin binding either by vimentin knockdown or the utilization of a cell-permeable peptide that inhibited the interaction of the two proteins resulted in failure of IGFBP-2/IGF-I to stimulate RPTPβ polymerization. That both IGFBP-2 and IGF-I were required was shown by utilizing cells in which IGFBP-2 had been knocked down to demonstrate that although IGF-I stimulated vimentin serine phosphorylation, it could not stimulate vimentin/RPTPβ association in the absence of IGFBP-2. Furthermore, addition of an IGF-I receptor tyrosine kinase inhibitor resulted in failure of IGF-I to stimulate vimentin/RPTPβ association even in the presence of optimal concentrations of IGFBP-2. Therefore, coordinate activation of both receptor signaling systems is required for this interaction to occur.

Vimentin binding to RPTPβ was mediated by its serine phosphorylation. Exposure of cells to IGF-I resulted in an increase in vimentin serine phosphorylation, and the serine/threonine kinase that phosphorylates vimentin was shown to be PKCζ. Inhibition of PKCζ activation resulted in complete attenuation of vimentin-stimulated RPTPβ polymerization. More importantly, a synthetic peptide that contained the sequence from the vimentin head domain that contained a consensus PKCζ phosphorylation site disrupted vimentin/RPTPβ binding, RPTPβ polymerization, PTEN tyrosine phosphorylation, and AKT activation. Therefore, these results definitively show that IGF-I-stimulated serine phosphorylation of the head domain of vimentin leads to RPTPβ polymerization. Blocking the vimentin/RPTPβ interaction in mice utilizing the disrupting peptide showed that it was required for RPTPβ polymerization and AKT activation. Therefore, we conclude this is the mechanism by which IGF-I and IGFBP-2 function to modulate the AKT activation in vivo. Our prior studies have shown that optimal activation of AKT in VSMC in response to IGF-I requires the presence of hyperglycemia and that in cells maintained in 5 mm glucose or in nondiabetic mouse aorta, IGF-I-stimulated AKT activation (9, 20) and ki67 labeling are attenuated (16, 17). This is due in part to reduced SHPS-1 phosphorylation (19) which results in a decrease in PKCζ recruitment and activation (17). The findings in this study are consistent with these results, showing that in the presence of normal glucose, IGF-I-stimulated vimentin serine phosphorylation and vimentin/RPTPβ association were decreased. We conclude that hyperglycemia is required for PKCζ activation and IGF-I-stimulated PKCζ recruitment to the SHPS-1 signaling complex. PKCζ phosphorylates vimentin, which then binds to RPTPβ. This association resulted in enhanced downstream signaling and biological responses.

The molecular mechanism by which vimentin was shown to interact with RPTPβ was through serine phosphorylation of the head domain. This domain, which encompasses the first 74 amino acids of the vimentin N terminus, contains multiple serine phosphorylation sites (21). A consensus sequence motif that is a known PKCζ phosphorylation site is encompassed by residues 2–11. Proteins containing this sequence motif are preferentially serine-phosphorylated by this kinase (22). Our studies confirmed the importance of this domain by showing that a peptide containing this sequence could completely disrupt vimentin/RPTPβ association thereby inhibiting RPTPβ polymerization and downstream signaling in vitro and in vivo. Confirmation that PKCζ-phosphorylated vimentin was established by using a specific PKCζ pseudosubstrate inhibitor and showing that it inhibited IGF-I stimulated vimentin serine phosphorylation as well as vimentin binding to RPTPβ. Other protein kinases have been shown to phosphorylate the head domain of vimentin including CAM kinase II, an important regulator of smooth muscle cell proliferation (23). In addition, IGF-I has been shown to induce CAM kinase II activation under certain circumstances (24). However, IGF-I also induces protein kinase C activation (25); therefore, taken together with the observation that a specific PKCζ inhibitor attenuated vimentin phosphorylation, we conclude that PKCζ is the kinase that phosphorylates vimentin and that it is activated by IGF-I receptor stimulation. Our observation that a peptide containing the PKCζ phosphorylation site inhibited vimentin binding to RPTPβ and RPTPβ polymerization suggests that this is the region of vimentin that is phosphorylated and that it interacts with RPTPβ to stimulate polymerization.

Serine phosphorylation of the vimentin head domain has been shown to lead to multiple protein/protein interactions and changes in target protein function (26). Tzivion et al. (27) demonstrated that phosphorylation of vimentin sequestered 14-3-3 and that this resulted in differential binding of signaling proteins, such as Raf, to vimentin thereby altering cellular signaling. Similarly phosphorylation of serine 56 by PAK-1 kinase was shown to alter p47 phox association with vimentin thereby regulating smooth muscle cell contraction (28, 29). Vimentin phosphorylation in smooth muscle has also been shown to regulate Crk-associated substrate association as well was translocation of Rho kinase (28). Phosphorylation of serines in the head domain regulates intermediate filament assembly and disassembly in smooth muscle cells, and this results in differential protein/protein interactions (18). This reassembly of intermediary filaments is thought to be an important regulator of cell migration (30). Phosphorylation of vimentin has also been shown to correlate with formation of glomerular lamellipodia, which is essential for migration (26).

Disruption of vimentin/RPTPβ association had effects on RPTPβ polymerization and downstream signaling events that were similar to those observed following vimentin knockdown. The mechanism by which vimentin and IGFBP-2 binding to RPTPβ coordinately regulate RPTPβ polymerization has not been determined. The proposed mechanism of RPTPβ polymerization has been thought to be due to solely ligand occupancy of the extracellular domain because the binding of ligands such as pleiotropin and midkine facilitates RPTPβ polymerization, presumably in the absence of concomitant binding of intracellular proteins (31). It is clear from our studies that IGFBP-2 association with RPTPβ alone is not sufficient to stimulate polymerization, and vimentin binding to the RPTPβ cytoplasmic domain is required. RPTPβ polymerization is thought to occur through formation of a wedge between catalytic domains in the dimer and that wedge formation effectively blocks substrate availability thereby inhibiting tyrosine dephosphorylation (32). The mechanism by which serine phosphorylation of vimentin would facilitate this interaction has not been defined.

Because regulation of PKCζ subcellular localization has been shown to be an important regulatory variable for determining substrate specificity, we analyzed factors that might result in differential PKCζ subcellular localization in response to IGF-I stimulation. In smooth muscle cells exposed to hyperglycemia, the primary target of the IGF-I receptor kinase is SHPS-1; therefore, we examined proteins that were differentially recruited to SHPS-1 phosphotyrosines (15). Our proteome-wide screening studies had shown that ILK is recruited to the SHPS-1 signaling complex in response to IGF-I. ILK is a pseudo-kinase and does not have catalytic activity; therefore, it was not a good candidate for directly phosphorylating vimentin (33). However, ILK has been shown to be important for the recruitment and subcellular localization of signaling molecules (34). ILK forms a complex with two other proteins, PINCH and parvin, that recruit a variety of signaling intermediates to this complex (35). To determine whether ILK mediated PKCζ recruitment, we utilized an ILK inhibitor that regulates protein recruitment to the PINCH-parvin-ILK complex (35,37). Addition of the ILK inhibitor resulted in inhibition of IGF-I-stimulated ILK/PKCζ association as well as vimentin phosphorylation leading to loss of vimentin/RPTPβ association. The importance of IGF-I stimulated recruitment of ILK to SHPS-1 was validated by showing that cells expressing the SHPS-1 cytoplasmic domain-truncated mutant failed to recruit PKCζ to vimentin. Therefore, we conclude that IGF-I-stimulated phosphorylation of SHPS-1 is required to recruit ILK-1 and that ILK or the ILK-PINCH-parvin complex recruits PKCζ, thereby facilitating PKCζ/vimentin interaction.

Several studies have demonstrated that assembly of the PINCH-parvin-ILK complex is important for subcellular localization of signaling molecules (35, 38). Rho kinase, MAPK, paxillin, NCK-2, PP-1, and β1 integrins are all recruited to this complex under various conditions (38, 39). During stimulation of cell migration, ILK interacts with multiple integrin receptors, principally the β-1 integrin, and recruitment of ILK to β1 in focal adhesions is thought to play an important role in this process (40). The ability of ILK to recruit specific signaling components to focal adhesions has been proposed as an important growth regulator mechanism (35). Overexpression of ILK has been shown to regulate smooth muscle cell differentiation (41), and the state of differentiation is an important component of maintenance of signaling through the SHPS-1/PI 3-kinase pathway, which is necessary for IGF-I-stimulated migration (17). Our results are consistent with this model because they show that ILK recruitment of PKCζ results in an enhancement of IGF-I-stimulated AKT activation in VSMC, which is important for optimal IGF-I-stimulated cell migration.

In summary, these studies have determined the mechanism by which IGF-I receptor stimulation collaborates with IGFBP-2 binding to RPTPβ to lead to enhancement of AKT pathway-dependent functions in vascular smooth muscle cells. IGF-I receptor stimulation is required for activation of PKCζ-stimulated vimentin serine phosphorylation, and this results in direct binding of vimentin to RPTPβ, which facilitates IGFBP-2-mediated RPTPβ polymerization (Fig. 9). These results emphasize the importance of collaborative signaling between the two receptor systems to obtain optimal IGF-I responsiveness and how these signaling pathways may be altered in diabetes. The findings clearly emphasize the need for analysis of similar interactions occurring between other IGF-binding proteins and their respective receptors and the role of these interactions mediating specific cellular functional responses following IGF-I stimulation.

FIGURE 9.
Vimentin/RPTPβ mediates IGF-I/IGFBP-2 cooperative signaling during hyperglycemia. Hyperglycemia activates PKCζ and IGF-I stimulates formation of an SHPS-1-associated signaling complex that includes SHP-2/ILK/PKCζ/vimentin. Activated ...

Acknowledgment

We thank Laura Lindsey (University of North Carolina at Chapel Hill), for her help in preparing the manuscript.

*This work was supported, in whole or in part, by National Institutes of Health Grant AG-02331. This work was also supported by Grant 31271983 from the National Natural Science Foundation of China (to X. S.).

3The abbreviations used are:

IGFBP-2
insulin-like growth factor-binding protein-2
RPTPβ
receptor tyrosine phosphatase β
ILK
integrin- linked kinase
VSMC
vascular smooth muscle cell
PTEN
phosphatase and tensin homolog.

REFERENCES

1. Hoeflich A., Nedbal S., Blum W. F., Erhard M., Lahm H., Brem G., Kolb H. J., Wanke R., Wolf E. (2001) Growth inhibition in giant growth hormone transgenic mice by overexpression of insulin-like growth factor binding protein-2. Endocrinology 142, 1889–1898 [PubMed]
2. Galiano R. D., Zhao L. L., Clemmons D. R., Roth S. I., Lin X., Mustoe T. A. (1996) Interaction between the insulin-like growth factor family and the integrin receptor family and the integrin receptor family in tissue repair processes–evidence in a rabbit ear dermal ulcer model. J. Clin. Invest. 98, 2462–2468 [PMC free article] [PubMed]
3. De Mellow J. S., Baxter R. C. (1988) Growth hormone-dependent insulin-like growth factor (IGF) binding protein both inhibits and potentiates IGF-I-stimulated DNA synthesis in human skin fibroblasts. Biochem. Biophys. Res. Commun. 156, 199–204 [PubMed]
4. Rajah R., Valentinis B., Cohen P. (1997) Insulin-like growth factor (IGF) binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-β1 on programmed cell death through a p53 and IGF-independent mechanism. J. Biol. Chem. 272, 12181–12188 [PubMed]
5. Jones J. I., Gockerman A., Busby W. H., Jr., Wright G., Clemmons D. R. (1993) Insulin-like growth factor binding protein 1 stimulates cell migration and binds to the α5β1 integrin by means of its Arg-Gly Asp sequence. Proc. Natl. Acad. Sci. U.S.A. 90, 10553–10557 [PubMed]
6. Ingermann A. R., Yang Y. F., Han J., Mikami A., Garza A. E., Mohanraj L., Fan L., Idowu M., Ware J. L., Kim H. S., Lee D. Y., Oh Y. (2010) Identification of a novel cell death receptor mediating IGFBP-3-induced anti-tumor effects in breast and prostate cancer. J. Biol. Chem. 285, 30233–30246 [PMC free article] [PubMed]
7. Firth S. M., Baxter R. C. (2002) Cellular actions of the insulin-like growth factor binding proteins. Endocr. Rev. 23, 824–854 [PubMed]
8. DeMambro V. E., Clemmons D. R., Horton L. G., Bouxsein M., Wood T. L., Beamer W. G., Canalis E., Rosen C. J. (2007) Gender-specific changes in bone turnover and skeletal architecture in igfbp-2-null mice. Endocrinology 149, 2015–2061 [PubMed]
9. Shen X., Xi G., Maile L. A., Wai C., Rosen C. J., Clemmons D. R. (2012) Insulin-like growth factor (IGF) binding protein 2 functions coordinately with receptor protein tyrosine phosphatase β and the IGF-I receptor to regulate IGF-I-stimulated signaling. Mol. Cell. Biol. 32, 4116–4230 [PMC free article] [PubMed]
10. Xi G., Wai C., DeMambro V., Rosen C. J., Clemmons D. R. (2014) IGFBP-2 directly stimulates osteoblast differentiation. J. Bone Miner. Res. 29, 2427–2438 [PMC free article] [PubMed]
11. DeMambro V. E., Maile L., Wai C., Kawai M., Cascella T., Rosen C. J., Clemmons D. (2012) Insulin-like growth factor-binding protein-2 is required for osteoclast differentiation. J. Bone Miner. Res. 27, 390–400 [PMC free article] [PubMed]
12. Standaert M. L., Galloway L., Karnam P., Bandyopadhyay G., Moscat J., Farese R. V. (1997) Protein kinase C-ζ as a downstream effector of phosphatidylinositol 3-kinase during insulin stimulation in rat adipocytes: potential role in glucose transport. J. Biol. Chem. 272, 30075–30082 [PubMed]
13. Radhakrishnan Y., Maile L. A., Ling Y., Graves L. M., Clemmons D. R. (2008) Insulin-like growth factor-I stimulates Shc-dependent phosphatidylinositol 3-kinase activation via Grb2-associated p85 in vascular smooth muscle cells. J. Biol. Chem. 283, 16320–16331 [PMC free article] [PubMed]
14. Gockerman A., Clemmons D. R. (1995) Porcine aortic smooth muscle cells secrete a protease for insulin-like growth factor binding protein-2. Circ. Res. 76, 514–521 [PubMed]
15. Shen X., Xi G., Radhakrishnan Y., Clemmons D. R. (2009) Identification of novel SHPS-1-associated proteins and their roles in regulation of insulin-like growth factor-dependent responses in vascular smooth muscle cells. Mol. Cell. Proteomics 8, 1539–1551 [PMC free article] [PubMed]
16. Maile L. A., Capps B. E., Miller E. C., Aday A. W., Clemmons D. R. (2008) Integrin-associated protein association with SRC homology 2 domain containing tyrosine phosphatase substrate 1 regulates igf-I-signaling in vivo. Diabetes 57, 2637–2643 [PMC free article] [PubMed]
17. Xi G., Shen X., Maile L. A., Wai C., Gollahon K., Clemmons D. R. (2012) Hyperglycemia enhances IGF-I-stimulated Src activation via increasing Nox4-derived reactive oxygen species in PKCζ-dependent manner in vascular smooth muscle cells. Diabetes 61, 104–113 [PMC free article] [PubMed]
18. Eriksson J. E., He T., Trejo-Skalli A. V., Härmälä-Braskén A. S., Hellman J., Chou Y. H., Goldman R. D. (2004) Specific in vivo phosphorylation sites determine the assembly dynamics of vimentin intermediate filaments. J. Cell Sci. 117, 919–932 [PubMed]
19. Radhakrishnan Y., Shen X., Maile L. A., Xi G., Clemmons D. R. (2011) IGF-I stimulates cooperative interaction between the IGF-I receptor and CSK homologues kinase that regulates SHPS-1 phosphorylation in vascular smooth muscle cells. Mol. Endocrinol. 25, 1636–1649 [PubMed]
20. Ning J., Xi G., Clemmons D. R. (2011) Phosphorylation of AMPK S485 by AKT is required for suppression of AMPK activation which allows the transduction of IGF-I signaling and biological actions in VSMC. Endocrinology 152, 3143–3154 [PubMed]
21. Brauksiepe B., Mujica A. O., Herrmann H., Schmidt E. R. (2008) The serine/threonine kinase Stk33 exhibits autophosphorylation and phosphorylates the intermediate filament protein vimentin. BMC Biochem. 9, 25–36 [PMC free article] [PubMed]
22. Xie Z., Dong Y., Zhang J., Scholz R., Neumann D., Zou M. H. (2009) Identification of the serine 307 of LKB1 as a novel phosphorylation site essential for its nucleocytoplasmic transport and endothelial cell angiogenesis. Mol. Cell. Biol. 29, 3582–3596 [PMC free article] [PubMed]
23. Ogawara M., Inagaki N., Tsujimura K., Takai Y., Sekimata M., Ha M. H., Imajoh-Ohmi S., Hirai S., Ohno S., Sugiura H. (1995) Differential targeting of protein kinase C and CaM kinase II signaling to vimentin. J. Cell Biol. 131, 1055–1066 [PMC free article] [PubMed]
24. Zuloaga R., Fuentes E. N., Molina A., Valdés J. A. (2013) The cAMP response element binding protein (CREB) is activated by insulin-like growth factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast. Biochem. Biophys. Res. Commun. 440, 258–264 [PubMed]
25. Liu Q., Ning W., Dantzer R., Freund G. G., Kelley K. W. (1998) Activation of protein kinase C-ζ and phosphatidylinositol 3′-kinase and promotion of macrophage differentiation by insulin-like growth factor-I. J. Immunol. 160, 1393–1401 [PubMed]
26. Helfand B. T., Mendez M. G., Murthy S. N., Shumaker D. K., Grin B., Mahammad S., Aebi U., Wedig T., Wu Y. I., Hahn K. M., Inagaki M., Herrmann H., Goldman R. D. (2011) Vimentin organization modulates the formation of lamellipodia. Mol. Biol. Cell 22, 1274–1289 [PMC free article] [PubMed]
27. Tzivion G., Luo Z. J., Avruch J. (2000) Calyculin A-induced vimentin phosphorylation sequesters 14-3-3 and displaces other 14-3-3 partners in vivo. J. Biol. Chem. 275, 29772–29778 [PubMed]
28. Tang D. D., Bai Y., Gunst S. J. (2005) Silencing of p21-activated kinase attenuates vimentin phosphorylation on Ser-56 and reorientation of the vimentin network during stimulation of smooth muscle cells by 5-hydrotryptamine. Biochem. J. 388, 773–783 [PubMed]
29. Li Q. F., Spinelli A. M., Wang R., Anfinogenova Y., Singer H. A., Tang D. D. (2006) Critical role of vimentin phosphorylation at Ser-56 by p21-activated kinase in vimentin cytoskeleton signaling. J. Biol. Chem. 281, 34716–34724 [PMC free article] [PubMed]
30. Ivaska J., Pallari H. M., Nevo J., Eriksson J. E. (2007) Novel functions of vimentin in cell adhesion, migration and signaling. Exp. Cell Res. 313, 2050–2062 [PubMed]
31. Xu C., Zhu S., Wu M., Han W., Yu Y. (2014) Functional receptors and intracellular signal pathways of midkine (MK) and pleiotrophin (PTN). Biol. Pharm. Bull. 37, 511–520 [PubMed]
32. Deuel T. F. (2013) Anaplastic lymphoma kinase: ligand independent activation mediated by the PTN/RPTPβ/ζ signaling pathway. Biochim. Biophys. Acta 1834, 2219–2223 [PubMed]
33. Fukuda K., Knight J. D., Piszczek G., Kothary R. (2011) Biochemical, proteomic, structural, and thermodynamic characterizations of integrin-linked kinase (ILK): cross-validation of the pseudokinase. J. Biol. Chem. 286, 21886–21895 [PMC free article] [PubMed]
34. Qin J., Wu C. (2012) ILK: a pseudokinase in the center stage of cell-matrix adhesion and signaling. Curr. Opin. Cell Biol. 24, 607–613 [PMC free article] [PubMed]
35. Wickström S. A., Lange A., Montanez E., Fässler R. (2010) The ILK/PINCH/parvin complex: the kinase is dead, long live the pseudokinase! EMBO J. 29, 281–291 [PubMed]
36. Widmaier M., Rognoni E., Radovanac K., Azimifar S. B., Fässler R. (2012) Integrin-linked kinase at a glance. J. Cell Sci. 125, 1839–1843 [PubMed]
37. Dobreva I., Fielding A., Foster L. J., Dedhar S. (2008) Mapping the integrin-linked kinase interactome using SILAC. J. Proteome Res. 7, 1740–1749 [PubMed]
38. Kimura M., Murakami T., Kizaka-Kondoh S., Itoh M., Yamamoto K., Hojo Y., Takano M., Kario K., Shimada K., Kobayashi E. (2010) Functional molecular imaging of ILK-mediated Akt/PKB signaling cascades and the associated role of β-parvin. J. Cell Sci. 123, 747–755 [PubMed]
39. Ghatak S., Morgner J., Wickström S. A. (2013) ILK: A pseudokinase with a unique function in the integrin-actin linkage. Biochem. Soc. Trans. 41, 995–1001 [PubMed]
40. Wang H. V., Chang L. W., Brixius K., Wickström S. A., Montanez E., Thievessen I., Schwander M., Müller U., Bloch W., Mayer U., Fässler R. (2008) Integrin-linked kinase stabilizes myotendinous junctions and protects muscle from stress-induced damage. J. Cell Biol. 180, 1037–1049 [PMC free article] [PubMed]
41. Dedhar S. (2000) Cell-substrate interactions and signaling through ILK. Curr. Opin. Cell Biol. 12, 250–256 [PubMed]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology