PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Oncogene. Author manuscript; available in PMC Feb 5, 2014.
Published in final edited form as:
PMCID: PMC3914638
NIHMSID: NIHMS549263
Dual regulation of Myc by Abl
Victor Javier Sanchez-Arévalo Lobo,1# Mirko Doni,1 Alessandro Verrecchia,1 Serena Sanulli,1§ Giovanni Fagà,1 Andrea Piontini,1 Marco Bianchi,2 Maralice Conacci-Sorrel,3 Giovanni Mazzarol,1 Vicente Peg,4 Javier Hernandez Losa,4 Paola Ronchi,5,6 Maurilio Ponzoni,6,7 Robert N. Eisenman,3 Claudio Doglioni,7 and Bruno Amati1,8*
1Department of Experimental Oncology, European Institute of Oncology (IEO), Via Adamello 16, 20139 Milan, Italy
2The FIRC Institute of Molecular Oncology (IFOM), Via Adamello 16, 20139 Milan, Italy
3Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA
4Hospital Vall de Hebron, Passeig de la Vall d'Hebron, 119-129 08035 Barcelona, Spain
5Immunohematology and Transfusion Medicine Service, San Raffaele Scientific Institute, Milan, Italy
6Leukemia Unit, San Raffaele Scientific Institute, Milan, Italy
7Pathology Unit, San Raffaele Scientific Institute, Milan, Italy
8Center for Genomic Science of IIT@SEMM, Fondazione Istituto Italiano di Tecnologia (IIT), Via Adamello 16, 20139 Milan, Italy
*To whom correspondence should be addressed. bruno.amati/at/iit.it
#Present address: Centro Nacional de Investigaciones Oncologicas, Melchor Fernandez Almagro 3, 28029 Madrid, Spain
§Present address: Institut Curie, 26 rue d'Ulm, 75005 Paris, France
The Tyrosine kinase c-Abl (or Abl) and the prolyl-isomerase Pin1 cooperatively activate the transcription factor p73 by enhancing recruitment of the acetyl-transferase p300. Since the transcription factor c-Myc (or Myc) is a known target of Pin1 and p300, we hypothesized that it might be regulated in a similar manner. Consistent with this hypothesis, over-expression of Pin1 augmented Myc's interaction with p300 and transcriptional activity. The action of Abl, however, was more complex than predicted. On one hand, Abl indirectly enhanced phosphorylation of Myc on Ser 62 and Thr 58, its association with Pin1 and p300, and its acetylation by p300. These effects of Abl were exerted through phosphorylation of substrate(s) other than Myc itself. On the other hand, Abl interacted with the C-terminal domain of Myc and phosphorylated up to five Tyrosine residues in its N-terminus, the principal of which was Y74. Indirect immunofluorescence or immuno-histochemical staining suggested that the Y74-phosphorylated form of Myc (Myc-pY74) localized to the cytoplasm and co-existed either with active Abl in a subset of mammary carcinomas, or with Bcr-Abl in Chronic Myeloid Leukemia. In all instances, Myc-pY74 constituted a minor fraction of the cellular Myc protein. Thus, our data unravel two potential effects of Abl on Myc: first, Abl signaling can indirectly augment acetylation of Myc by p300, and most likely also its transcriptional activity in the nucleus; second, Abl can directly phosphorylate Myc on Tyrosine: the resulting form of Myc appears to be cytoplasmic, and its presence correlates with Abl activation in cancer.
The prolyl-isomerase Pin1 selectively isomerizes Proline residues immediately preceded by phosphorylated Serine or Threonine, generating conformational changes that modulate the activities of its substrates (1). Pin1 positively regulates a variety of transcription factors, including p53, p73, c-Jun and c-Fos (2-5). These transcription factors recruit a diversity of co-factors, including the histone acetyl-transferase (HAT) p300 (2, 3, 6). Pin1 has been shown to enhance recruitment of p300 by p53 and p73, leading to augmented acetylation of the transcription factors themselves (2, 3). In the case of p73, this effect of Pin1 is modulated by the Tyrosine kinase c-Abl (hereafter Abl): in response to DNA damage, Abl directly phosphorylated p73 on Tyrosine and, through activation of the p38-MAP Kinase pathway, also favored phosphorylation of p73 on Serine and Threonine. This led to a chain of events including enhanced Pin1 binding, p300 recruitment, acetylation and stabilization of p73, culminating in enhanced transcriptional activity (3).
Myc is a target of Pin1 (7) as well as of p300 (8-11), but opposite effects have been reported. Pin1 targets phospho-T58-P59 in Myc, enhancing recruitment of Protein Phosphatase 2A (PP2A), thereby facilitating dephosphorylation of the adjacent phospho-S62-P63 site and subsequent degradation of Myc by the ubiquitin-proteasome pathway (7). On the other hand, p300 stabilizes Myc, and does so independently from its HAT activity (9). Like other HATs (12), p300 also acetylates Myc (8, 9, 11) and augments its transcriptional activity. Myc can also recruit various HAT complexes to chromatin, thereby enhancing histone acetylation and transcription (11, 13, 14).
None of the above studies addressed whether Pin1 and p300 might act in concert to regulate Myc activity. Furthermore, no study has investigated whether Myc may also be targeted by Abl and, by analogy with the regulation of p73, whether Pin1 and Abl may synergize to augment p300 recruitment (Fig. 1a). In this study, we addressed the concerted action of Pin1, p300 and Abl on Myc. Our data reveal a more complex regulation of Myc than initially hypothesized (Fig. 1b): while over-expression of Pin1 and p300 augments Myc acetylation and transcriptional activity, Abl acts indirectly in this setting, via the enhancement of Myc T58/S62 phosphorylation. On the other hand, direct phosphorylation of Myc on several tyrosines (in particular Y74), appears to give rise to a cytoplasmic form of Myc, the action of which remains to be unraveled.
Fig. 1
Fig. 1
Schematic summary. (a). Working hypothesis: based on the concerted action of Abl and Ser/Thr Kinases on the function of p73, we tested whether a similar scheme might apply for Myc. (b.) Model: the dual action of Abl (or Bcr-Abl) on Myc, based on the data (more ...)
Abl indirectly stimulates Myc phosphorylation on S62/T58, binding to Pin1 and p300, and acetylation
Transient transfection with a Luciferase reporter driven by the Myc-responsive Nucleolin promoter (Ncl-Luc) (15) showed that Pin1 and p300 additively enhanced the transcriptional activity of Myc (Fig. 2a). Abl could not be tested in this assay, because it deregulated the activity of all reporters used (whether Ncl-Luc, other Luc reporters, or the Renilla Luciferase used as a normalizer). Hence, we addressed whether Abl and Pin1 might influence acetylation of Myc by p300: 293T cells were transfected with vectors expressing Myc, Pin1, p300 or Abl, each with the indicated epitope tags. Immunoblot analysis of Flag-Myc immunoprecipitates with an anti acetyl-Lysine antibody confirmed that p300 acetylates Myc (9, 12); co-expression of Pin1 and Abl together with p300 further increased Myc acetylation, while adding only Abl or Pin1 had no consistent effect (Fig. 2b, c). This cooperative effect was lost when using catalytically inactive mutants of either Pin1 (Y23A: Fig. 2b) (16) or Abl (KD: Fig. 2d) (17), or when inhibiting Abl activity with STI571 (Fig. 2e). Co-immunoprecipitation analysis of the transfected cells showed that Pin1 and Abl markedly enhanced binding of p300 to Myc (Fig. 2c). In the above experiments, Myc was substantially acetylated when co-expressed with p300 alone, which might conceivably have depended upon endogenous Pin1 in 293T cells. In mouse embryo fibroblasts homozygous for a Pin1 knockout allele (3) co-expression of p300 also caused Myc acetylation, showing that Pin1 is not obligatory for this event; however, Myc acetylation was now markedly increased by co-expression of Pin1 and Abl (Fig. 2f). Altogether, our data demonstrate that Pin1 and Abl cooperate to enhance the interaction of Myc with p300 and its resulting acetylation.
Fig. 2
Fig. 2
Abl enhances Myc transcriptional activity trough Pin1 and p300. (a). U2OS cells were transfected with the reporter plasmid pNuc-Luc either alone or together with expression plasmids for Flag-Myc, HA-Pin1 or HA-p300, as indicated. The transcriptional activity (more ...)
The association of Pin1 with Myc depends upon phosphorylation of Myc on T58 by GSK3, which in turn depends upon a priming phosphorylation event at S62 (7, 18). Immunoblotting with phospho-specific antibodies revealed that Abl significantly enhanced phosphorylation of Myc on both S62 and T58 in co-transfected cells (Fig. 2a, WT). Mutation of T58 and/or S62 to Alanine (T58A, S62A) confirmed the specificity of the antibodies used, as well as the dependency of T58 phosphorylation upon prior S62 phosphorylation. Consistent with the increase in T58 phosphorylation, Abl also enhanced the interaction between Pin1 and Myc, as assayed by either pull-down with a recombinant GST-Pin1 protein (Fig. 3a, b) or co-immunoprecipitation (Fig. 3c). As expected, mutation of Myc S62, T58 or both significantly reduced (albeit did not abrogate) the interaction with Pin1 (Fig. 3a), and Myc did not co-precipitate with the Pin1Y23A mutant, which shows impaired binding to Pin1 substrates (Fig. 3c) (16).
Fig. 3
Fig. 3
Pin1 binds P-T58 and P-S62 enhancing Myc acetylation independently of Tyrosine phosphorylation. (a). 293T cells were transfected with vectors encoding wild-type Flag-Myc or the indicated mutants, and/or Abl. Cell extracts were subjected to a Pull-down (more ...)
In the above experiments, co-expression of Abl with Myc caused phosphorylation of Myc on Tyrosine, as revealed by immunoblot analysis of Myc immunoprecipitates with antibodies raised either against generic phospho-tyrosine (Fig. 2d, 3b, d) or against phospho-tyrosine 74 on Myc (pY74, Fig. 3a). As will be described in detail below, the major phospho-tyrosines on Myc were Y74 and Y32, while five substitutions altogether (mutant Myc-5YF) abrogated phosphorylation of Myc by Abl. Most relevant here, Abl still enhanced T58/S62 phosphorylation in the Myc Y32F/Y74F mutant (Fig. 3a), as well as acetylation of the Myc-5YF mutant in concert with Pin1 and p300 (Fig. 3d), implying that these effects did not require direct phosphorylation of Myc by Abl.
Altogether, the data presented so far showed that Abl triggers a series of effects on Myc, including enhanced T58/S62 phosphorylation, Pin1 and p300 binding and acetylation, resulting most likely in elevated Myc transcriptional activity (Fig. 1b). These effects are indirect in the sense that they do not depend upon direct phosphorylation of Myc by Abl, and must therefore involve the regulation of additional signaling pathways (see Discussion). Most importantly, however, our data revealed that Abl also phosphorylates Myc on Tyrosine, a new connection that we decided to characterize in the remainder of this work.
Abl directly binds and phosphorylates Myc
Co-expression of Abl and Flag-Myc, followed by anti-Flag IP and immunoblotting with an anti Phospho-Tyrosine antibody confirmed Tyrosine-phosphorylation on Myc (Fig 4a, SI Fig. S1a). This was lost either with the inactive Abl KD mutant, or upon treatment of cells with the Abl inhibitor STI571 (SI Fig. S1a, b). In the same experiments, Abl was co-immunoprecipitated with Flag-Myc (Fig. 4a). To map the region of Myc targeted by Abl, we used a series of Flag-or HA-tagged Myc deletion mutants (Fig. 4b). Notably, only full-length Myc was both bound and phosphorylated by Abl: Myc proteins lacking the C-Terminal region (mutants B, C, D) were unable to co-immunoprecipitate Abl, but were still phosphorylated on Tyrosine upon co-transfection with Abl, albeit with lower efficiency than full-length Myc (Fig. 4c, black arrowheads). Conversely, proteins lacking the N-terminal domain (mutants A, E, F) associated with Abl, but contained no detectable phospho-tyrosine (Fig. 4c, d white arrowheads). Thus, as summarized in Fig. 4b, Abl bound the C-terminus of Myc (as defined by mutant A), but phosphorylated residues within its N-terminal 110 residues (deleted in mutant E). In human Myc, this region included six Tyrosines (Y12, 16, 22, 24, 32 and 74; Fig. 4e).
Fig. 4
Fig. 4
Abl interacts with and phosphorylates Myc. (a). 293T cells were transfected with Myc- and Abl-expressing plasmids. Thirty-six hours post-transfection, cell extracts were immunoprecipitated using anti-Flag beads followed by immunoblotting using anti-phosphotyrosine (more ...)
In order to identify the Tyrosine(s) phosphorylated by Abl, we mutated candidate residues. We first analyzed a mutant deleted of residues 1-24 that retained only two of the six Tyrosines (Y32, Y74: mutant G, Fig. 4b), and mutated these to Phenylalanine: in this context, substitution of Y32 (mutant H) decreased phosphorylation by Abl, while that of Y74 alone, or Y32 and Y74 together (mutants I, J) abrogated all detectable phosphorylation (Fig. 4f). In the context of full-length Myc, we targeted Y32, Y74, or a cluster of three residues (Y12/16/22): each of these mutations was introduced alone or in combination with the others. The sixth Tyrosine (Y24) was excluded from our analysis, as it was the only one to be (i.) conserved in N-Myc (which was not phosphorylated by Abl) (SI Fig. S1c) and (ii.) not conserved in mouse c-Myc (Fig. 4e). Substitution of Y74 alone in full-length Myc substantially decreased phosphorylation, while that of either Y32 or Y12/16/22 had little effect (Fig. 4g). The phospho-tyrosine signal was essentially lost when Y74 was substituted together with either Y32, the Y12/16/22 group, or all together (the mutant referred hereafter as Myc 5YF). Instead, a mutant retaining only Y74 (with substitution of Y12/16/22 and Y32) showed residual phosphorylation (Fig. 4g). Altogether, these data imply that Abl phosphorylates Y74, Y32 and one or more residues among Y12/16/22 in a hierarchical manner, phosphorylation of Y74 being important (although not strictly essential) for that of the others, and retention of either Y32 or Y12/16/22 alone being insufficient to support significant phosphorylation by Abl.
Because Y74 was the main target of Abl, a rabbit antiserum was raised against a Y74-phosphorylated peptide (anti-pY74). Immunoblot and immunoprecipitation analysis on WT or mutant Myc in co-transfected 293T cells showed that the anti-pY74 antibody recognized Myc in a Y74- and Abl-dependent manner (Fig 3a, SI Fig. S1d, e). These experiments confirmed that Myc Y74 is phosphorylated by Abl, and provided us with a reagent to detect this form of Myc in cells (see below).
Finally, two experiments were performed to confirm that Abl, rather than a secondary kinase, was directly responsible for Myc phosphorylation. First, we immunoprecipitated Flag-Myc from transfected 293T cells, incubated the precipitates with recombinant Abl and ATP, resolved the reactions by SDS-PAGE, and immunoblotted them with the anti phospho-tyrosine antibody. Wild-type Flag-Myc was effectively phosphorylated in this assay, above the background observed with the 5YF mutant (SI Fig. S2a). Second, a bacterially expressed GST-Myc (1-262) protein was incubated in the presence of recombinant Abl and ATP, and analyzed as above, demonstrating direct phosphorylation of the Myc N-terminal domain by Abl (SI Fig. S2b).
Staining for Y74-phosphorylated Myc indicates cytoplasmic localization
To test the specificity of anti-pY74 in immuno-fluorescence (IF) and immuno-histochemistry (IHC) we expressed Abl and simultaneously knocked down Myc in HeLa cells by cotransfection with vectors expressing Abl and either an shRNA directed against the c-myc mRNA (shMyc), or a control scramble shRNA. As expected, a Myc-specific antibody yielded a prevalently nuclear signal: this was largely reduced by shMyc, while Abl had no significant effect (SI Fig. S3a, S4a). 30-35% of the cells co-transfected with Abl and the control shRNA scored positive for Myc-pY74 but, unlike total Myc, the Myc-pY74 signal was cytoplasmic (SI Fig. S3b, S4b). In both assays, co-transfection with shMyc reduced to similar extents the percentages of cells positive for either Myc-pY74, or total Myc, indicating that anti-pY74 was truly recognizing a form of Myc located in the cytoplasm, and not a different cross-reacting protein. In IHC, an antibody recognizing Abl auto-phosphorylated on Y412 (P-Abl) stained the same number of cells as Myc-pY74, and as expected the P-Abl signal was insensitive to shMyc (compare SI Fig S4b and c); note that the IF signal for P-Abl was very weak).
To visualize Myc and Abl in individual cells, we transfected HeLa cells with a plasmid expressing a GFP-Abl fusion protein, and stained by IF for Myc (either total or pY74): Myc-pY74 was detected exclusively in the cytoplasm of GFP-positive cells and, as above, co-transfection with shMyc reduced Myc-pY74 and total Myc to the same extent (Fig. 5). This result was confirmed in the same experiment by a second shRNA (shMyc2, SI Fig. S5).
Fig. 5
Fig. 5
Myc-pY74 localizes to the cytoplasm. HeLa cells were transfected with GFP-Abl and shMyc or shScramble (Control) vectors. DAPI staining, GFP fluorescence and IF for Myc (total or pY74) were imaged on the Confocal microscope. The percentages of Myc-and (more ...)
Altogether, our IF and IHC assays indicate that the form of Myc phosphorylated on Y74 is strictly dependent upon Abl and is localized to the cytoplasm. This form must constitute a minor fraction of the total Myc protein in Abl-expressing cells, explaining the predominantly nuclear localization of the total Myc protein in all conditions, as well as our inability to detect this form above background in biochemical assays (Western or IP/Western: data not shown). Although we cannot formally rule out the cross-reaction of anti-pY74 with a different Abl substrate, loss of the signal upon Myc knockdown by two different c-myc-directed shRNAs constitutes a very strong indication - albeit not formal proof - that this corresponds to cytoplasmic Myc-pY74.
Mutation of Y74 decreases Myc activity in a Bcr-Abl/Myc co-transformation assay
To investigate the potential role of Y74 phosphorylation in Myc transforming activity, we monitored the co-transformation of Rat1 cells by Myc and Bcr-Abl (19, 20). The cells were sequentially infected with retroviruses encoding Bcr-Abl (WT or a kinasedefective mutant: KD) and Myc (WT or Y74F; the 5YF mutant was not efficiently expressed in this assay and was not studied further). The expression of active Bcr-Abl was confirmed by immunoblotting whole-cell lysates with an anti phospho-Tyrosine antibody (SI Fig. S6a). WT and Y74F Myc were expressed at similar levels and independently from Bcr-Abl activity (SI Fig. S6b). Double-infected cells were plated in soft-agar, and colonies counted after 2 weeks. As expected, cells co-expressing Bcr-Abl WT and Myc formed colonies in soft-agar (SI Fig. S6c, left). Expression of either protein alone, or of Bcr-Abl KD with or without Myc, did not allow colony formation (data not shown). The Y74F mutation did not abolish Myc-transforming activity together with Bcr-Abl WT, but caused a 2- to 3-fold reduction in colony numbers, as shown in two independent experiments (SI Fig. S6c). This result implies that Y74 is critical for maximal Myc activity in cellular transformation, whether due to phosphorylation of Y74 by Abl, or to another effect of this residue.
Cytoplasmic Myc-pY74 is detectable in mammary carcinomas with active Abl
A fraction of breast cancer cell lines (5 out of 9 tested) were reported to express active Abl (21, 22). However, it remained to be addressed whether Abl activation - and in the context of this work also Myc Y74 phosphorylation - occurs in tumors. We thus performed an immuno-histochemical screen for phospho-Abl, Myc-pY74 and total Myc on a series of 70 breast cancer samples spotted on a Tissue Microarray. A minor fraction of all tumors (6/70 or 8,6%) scored positive for P-Abl, all of which also scored with Myc-pY74. Among the 64 remaining samples, only four (6,3%) scored with Myc-pY74 but not P-Abl, most likely due to phosphorylation of Y74 by another tyrosine kinase. Thus, albeit rare, Abl activation in mammary carcinoma appears to be systematically associated with Myc Y74 phosphorylation (P=1.6E-06). Of the six P-Abl/Myc-pY74 double-positive tumors, five (83%) were metastatic, compared with 31/60 (51,7%) of the double-negative cases; this difference, however, did not reach statistical significance (P=0,12). Of the 4 Myc-pY74-only tumors, only 1 was metastatic. Larger number will be required to address whether Abl activation correlates with metastasis, as reported in melanoma (23). Similarly, no clear correlation could be established between phospho-Abl/Myc-pY74 and other clinical features such as ER or PR, p53 or HER2 status.
Close examination of our IHC sections revealed that the Myc-pY74 signal was mainly cytoplasmic while total Myc was predominantly nuclear (Fig. 6a, SI Fig. S7). Thus, in agreement with our data on transfected HeLa cells, Abl activation in mammary carcinoma is accompanied by the appearance of the Myc-pY74 signal in the cytoplasm.
Fig 6
Fig 6
Cytoplasmic Myc-pY74 is detectable by IHC in p-Abl positive carcinomas. (a) Representative images from our breast cancer tissue microarray stained with the indicated antibodies. (b) Tissue sections of the positive ovarian carcinoma identified in the second (more ...)
In a parallel experiment, we used a TMA including a total of 416 cases of 15 different types of solid tumors. IHC analysis revealed seven cases positive for P-Abl, and four for Myc-pY74: of these, two scored as double-positives, including a cervical and an ovarian carcinoma (SI Fig. S8). The latter was also analyzed in whole sections, showing prevalent nuclear staining for total Myc and cytoplasmic staining for Myc-pY74 (Fig. 6b).
Myc-Y74 phosphoryation by Bcr-Abl in Chronic Myeloid Leukemia
The Bcr-Abl fusion is the driving oncogene in Chronic Myeloid Leukemia (CML) (24). As shown above for Abl, Bcr-Abl induced Myc Y74 phosphorylation when co-expressed with Myc in 293T cells (SI Fig. S2c, d). IF with anti-pY74 yielded a clear cytoplasmic staining in three CML cell lines (MOLM, KYO and K562) but not in HL60, a Bcr-Abl-negative Promyelocytic leukemia cell line (Fig 7a). Knockdown of Myc in K562 cells by infection with the shMyc vector led to a proportional reduction in cells reactive with total Myc and pY74 antibodies, while only the Myc-pY74 signal was eliminated by treatment of the cells with STI571 (SI Fig. S9). The cytoplasmic Myc-pY74 signal was also detectable in a substantial fraction (15 to 25%) of precursors and more mature myeloid cells in bone marrow samples from CML patients (Fig. 7b), while non-neoplastic bone marrow specimens were negative (Fig. 7c). Altogether, our data indicate that cytoplasmic Myc-pY74 occurs in CML as a consequence of Bcr-Abl activity.
Fig 7
Fig 7
Myc-pY74 is located in the cytoplasm of CML cells. Representative images of immunofluorescence using the Myc-pY74 antibody, performed on (a) three CML cell lines (MOLM, KYO and K562) and a promyelocytic leukemia cell line (HL60), (b) bone marrow samples (more ...)
Abl indirectly regulates Myc T58/S62 phosphorylation, interaction with Pin1 and p300, and acetylation
In the first part of our work, we have described a series of effects of Abl on Myc, which are likely to be intimately inter-connected: (i.) enhancement of Myc S62 and T58 phosphorylation, (ii.) increased binding of Pin1 and p300, and (iii.) hyper-acetylation of Myc by p300. These effects are likely to result in augmented transcriptional activity of Myc (Fig. 1b). Although the latter could not be tested directly due to the interference by Abl with reporter constructs, Pin1 and p300 together showed additive positive effects on Myc transcriptional activity. Most importantly, this chain of events – as demonstrated for hyper-phosphorylation of S62/T58 and hyper-acetylation of Myc by p300 – does not require direct Tyrosine phosphorylation of Myc, and must therefore depend on the phosphorylation of different Abl substrates.
Positive effects of Abl on p300-mediated acetylation have been described in different settings (17, 25, 26). Besides possible effects on p300 recruitment or activity, Abl may be boosting signaling pathways that can promote Myc-S62 phosphorylation, such as the ERK, JNK or p38 MAP kinase pathways (27-30). Phosphorylated S62 will in turn prime T58 phosphorylation and Pin1 binding (7). How Pin1 would contribute to enhancing p300 interaction and Myc acetylation remains to be addressed. Most importantly in this context, our data reveal a new facet of Pin1 activity on Myc: previous data indicated that Pin1 is required upon phosphorylation of T58 for recruitment of Protein Phosphatase 2A (PP2A) to Myc, S62 de-phosphorylation and Myc turnover (7). In our experiments, instead, both S62 and T58 phosphorylation were enhanced by co-expression of Pin1 and Abl, accompanied by enhanced p300 binding and Myc acetylation. In preliminary experiments, we have observed no consistent effects of Abl on the Myc-PP2A interaction or bulk Myc levels (e.g. Fig. 2b, c). We surmise that the promotion of S62-T58 phosphorylation and p300 recruitment may be distinct effects of Pin1 and Abl.
Our data also indicate that Pin1 and p300, in the absence of Abl activity, augment transcriptional activation by Myc. This is consistent with previous work showing that Pin1 and p300 together modulate the activity of other transcription factors. Examples include STAT3 in the regulation of epithelial-to-mesenchymal transition (31), or c-Jun and c-Fos in response to growth factors (4, 5). A similar mechanism has been described for the co-activator SRC-3, which binds Pin1 and enhances the transcriptional activity of the Estrogen Receptor (ER) through p300 (32). The transcriptional activities of p53 and p73 can be regulated in a similar way (3, 33). In the case of p73, distinct effects co-exist, one direct and the other not (Fig. 1a): first, phosphorylation of p73 on Y99 by Abl is responsible for stabilization of the transcription factor (17, 34, 35); second, Abl also activates p38 MAPK, which phosphorylates p73, generating binding sites for Pin1 that enhance p73 acetylation through p300 recruitment (3). These observations provide a strong mechanistic rationale for our results on Myc, including (i.) the cooperative effect of Pin1 and p300 in enhancing Myc transcriptional activity, and (ii.) the enhancement of Pin1/p300 recruitment and Myc acetylation by Abl, albeit independently from direct phosphorylation of Myc on tyrosine. Indeed, as will be discussed below, direct phosphorylation of Myc by Abl appears to have a wholly different consequence (Fig. 1b).
The notion that Abl signaling promotes Myc acetylation and - as we infer -transcriptional activity (Fig. 1b) lends new significance to previous reports indicating that Myc is essential for Abl transforming activity (36) and that Myc over-expression in a CML cell line can antagonize induction of differentiation by Abl inhibitors (37). Altogether, these observations indicate that Abl indirectly enhances Myc activity (Fig. 1b), which in turn is an essential effector of Abl in cellular transformation.
Abl phosphorylates Myc on Tyrosine: cytoplasmic localization of Myc-pY74
Our data show that Abl phosphorylates Myc in vivo and in vitro. We mapped the residues phosphorylated by Abl to a group of five tyrosines located in the N-Terminal part of the protein, flanking the first conserved Myc box (MBI). These residues include Y74 - which is the main target of Abl – as well as Y32, and one or more among Y12, Y16 or Y22. Our data indicate that Y74-phosphorylated Myc (Myc-pY74) constitutes a minor part of the Myc protein and is localized to the cytoplasm (Fig. 1b).
In IF and IHC assays, the anti-pY74 antibody allowed us to detect endogenous Myc-Y74 in the cytoplasm, in a manner dependent upon Abl activity. With the reagents available to date, we have not been able to provide a biochemical detection of endogenous Myc-pY74 above background (whether in the nucleus or cytoplasm), most likely owing to the low amounts of this form of Myc in cells. Thus, a plausible criticism to our data is that the cytoplasmic signal seen by IF and IHC might be due to a cross-reacting phospho-epitope on an unrelated Abl substrate(s). To address this issue, we knocked down Myc expression through RNA interference with two independent shRNA constructs: in all our experiments, the percentage of cells scoring positive for cytoplasmic Myc-pY74 and nuclear total Myc decreased to similar extents. Albeit still short of definitive biochemical confirmation, these data provide strong evidence for the presence of Myc-pY74 in the cytoplasm as a consequence of Abl activation.
Our co-transfection and co-immunoprecipitation data showed that a distinct C-terminal region of Myc mediates stable interaction with Abl. Most importantly, in cells, this interaction is rate limiting for phosphorylation of the N-terminal Tyrosines. The Ablbinding domain in the Myc C-terminal region overlaps with the basic helix-loop-helix leucine zipper (bHLH-LZ) domain, responsible for its dimerization with Max and DNA binding (38). As the bulk of Myc in cells in associated with Max and is localized to the nucleus, it remains unclear whether Abl initially interacts with free Myc or with Myc/Max dimers, and whether this occurs in the nucleus or in the cytoplasm. In an analogous manner, we presently do not know whether Y74 phosphorylation directly instructs cytoplasmic retention and/or nuclear export of Myc, or whether it occurs in the cytoplasm as a consequence of an independent localization mechanism.
Myc-Nick is a cytoplasmic form of Myc resulting from cleavage by Calpain and loss of the C-terminal domain (39). Myc-Nick interacts with alpha-tubulin, promotes its acetylation and, unlike full-length Myc, favors cellular differentiation. Thus, conceivably, Myc-Nick might be the form of Myc phosphorylated by Abl in vivo. We deem this possibility unlikely, based on our finding that binding of Abl to the Myc C-terminus is rate-limiting for phosphorylation of the N-terminal tyrosines. Nonetheless, Abl was capable of phosphorylating N-terminal fragments of Myc in our transfected cells: conceivably, other mechanisms may bring Myc-Nick and Abl in close proximity under physiological settings, perhaps in association with tubulins, as Abl interacts with the tubulin-associated protein Rack1 (40). As an alternative possibility Tyrosine phosphorylation of Myc may promote its cleavage by Calpain, resulting in the accumulation of Tyrosine-phosphorylayed Myc-Nick in the cytoplasm. Our transfection and IP/western experiments clearly showed that Abl can phosphorylate full-length Myc (Fig. 4), but did not allow us to conclude about the effect of Abl on the processing of Myc. Moreover, most likely because of the low fraction of Myc phosphorylated on Y74 combined with the poor sensitivity of the anti-pY74 antibody, we have not been able to detect endogenous Myc-pY74 biochemically in cells, whether in the full-length or the truncated form. Hence, the existence of tyrosine-phosphorylated Myc-Nick remains a formal possibility.
In additional experiments based on cleavage of in vitro-translated Myc (39) we have observed that K562 cytoplasmic lysates show very high calpain activity: this was unaffected by treatment of the cells with Imatinib prior to preparation of the lysate, suggesting that Bcr-Abl activity does not directly affect calpain activity.
Cytoplasmic Myc-pY74 is detectable in tumors with active Abl or Bcr-Abl
Immunohistochemical analysis of tissue microarrays with a phospho-Abl antibody revealed Abl activation in a small minority of mammary carcinomas, associated with the presence of the cytoplasmic Myc-pY74 signal. Consistent with previous studies associating Abl activity to invasiveness in breast cancer cell lines (21, 22), the majority of the P-Abl/Myc-pY74 positive cases in our dataset were metastatic. Whether Myc-pY74 or other Abl substrates contribute to the metastatic phenotype remains to be addressed.
Our co-transfection experiments showed that the Chronic Myeloid Leukemia (CML)-associated oncoprotein Bcr-Abl was as effective as Abl in phosphorylating Myc. Immunofluorescence analysis of CML cell lines revealed a cytoplasmic Myc-pY74 signal that was sensitive to either Myc knockdown, or treatment with STI571. Altogether, these data indicate that the activation of Bcr-Abl in CML leads to the appearance of cytoplasmic Myc-pY74.
Several studies reported the existence of a cytoplasmic Myc signal in tumors (41-43), although those observations had remained unexplained. We surmise that this may be due to Y74 phosphorylation, to the cleaved form Myc-Nick (39), or both. Our findings warrant future analysis of the biological function of Myc-pY74 in the cytoplasm, and of its contribution to the pathogenesis of CML and other Abl-associated tumors.
Plasmids
pEBB-Abl WT and pSG5-Abl KD (expressing the kinase-dead mutant K290R) were supplied by Ricardo Sanchez-Prieto, pCMV-N-Myc, pCMV-HA-p300, pCDNA3-HA-Pin1 WT and Y23A were supplied by Gianni del Sal, the Bcr-Abl plasmids pKI-210 WT and pKI 210 KD (expressing the kinase-dead mutant) were supplied by Warren Pear and pCEFL-GFPAbl by Silvio Gutkind. pcDNA-210 was supplied by Dr Pier Giuseppe Pelicci. For the mapping of interaction and phosphorylation sites on Myc we used plasmids pCβF-Myc Flag, pCβF-MycΔ1-110 Flag, pCβF-MycΔ1-180 Flag, kindly provided by M. Cole, as well as pCDNA3-Myc (1-262)-HA (mutant C in Fig. 2B; our ref. number BA1594), pCDNA3-Myc(1-347)-HA (mutant B; BA1595), pCDNA3-Myc(1-145)-HA (mutant C; BA1593), pCDNA3-Myc(263-439)-HA (mutant A; BA1518), pCMV-Myc-T58A-Flag (BA1987), pCMV-Myc-S62A-Flag (BA1986), pCMV-Myc-T58A-S62A-Flag (BA2235) and pGEX-Myc 1-262 (BA91). The Myc deletion mutant Δ1-24 and point mutants thereof were generated using site-directed mutagenesis by PCR, subcloning in a pCMV Myc-Flag vector, and confirmation by DNA sequencing. The constructs were pCMV-Δ1-24 Myc Flag (mutant G; BA2029), pCMV-Δ1-24 Y32F Myc Flag (mutant H; BA2030), pCMV-Δ1-24 Y74F Myc Flag (mutant I; BA2088), pCMV-Δ1-24 Y32-74F Myc Flag (mutant J; BA2089), pCMV-Myc Flag (BA2046), pCMV-Y12,16,22,32,74F Myc Flag (mutant 5YF; BA2095), pCMV-Y12,16,22,74F Myc Flag (BA2094), pCMV-Y12,16,22,32F Myc Flag (BA2093), pCMV-Y12,16,22F Myc Flag (BA2023), pCMV-Y32F Myc Flag (BA2090), pCMV-Y74F Myc Flag (BA2091). To generate these mutant constructs we performed PCR with the following primers:
Myc Y12,16,22F
PCR1: 5′primer (AP5435): GAAGAAGGATCCCCGGGCGAGC; 3′primer (AP5438): CGGCTGCACCGAGTCGWAGTCAAGGTCGWAGTTCCTGTTGGT
PCR2: 5′ primer (AP5437): GACTCGGTGCAGCCGTWCTTCTACTGCGAC 3′primer (AP5436 after the ClaI site in c-myc): AGCAGAAGGTGATCCAGACTCTGAC
PCR3: Used the combined PCR1 and PCR2 products as template, with primers AP5435 and AP5436
Myc Δ1-24 Y32F
PCR1: 5′primer (AP5441): GAAGAAGGATCCAACATGTGCGACGAGGAGGAGAACTTCTWCCAGCA; 3′primer (AP5436).
Myc Y32F
PCR1: 5′primer (AP5435): GAAGAAGGATCCCCGGGCGAGC; 3′primer (AP5568): GCTGCTGGAAGAAGTTCTCCTC
PCR2: 5′ primer (AP5567): GAACTTCTTCCAGCAGCAGCA; 3′primer (AP5436 after the ClaI site in c-myc): AGCAGAAGGTGATCCAGACTCTGAC
PCR3: 5′primer (AP5435); 3′primer (AP5436)
Myc Y74F
PCR1: 5′primer (AP5435) GAAGAAGGATCCCCGGGCGAGC; 3′primer (AP5570): GCAACGAAGGAGGGCGA
PCR2: 5′ primer (AP5569): CCTCCTTCGTTGCGGTCA; 3′primer (AP5436 after the ClaI site in c-myc): AGCAGAAGGTGATCCAGACTCTGAC
PCR3: 5′primer (AP5435); 3′primer (AP5436)
Fusion of 12/16/22 mutations and 32/74 mutations
PCR1: 5′primer (AP5435): GAAGAAGGATCCCCGGGCGAGC; 3′primer (AP6008): GAAGTTCTCCTCCTCGTCGCA
PCR2: 5′ primer (AP6007): TTCTACTGCGACGAGGAGGAGAAC; 3′primer (AP5436 after the ClaI site in c-myc): AGCAGAAGGTGATCCAGACTCTGAC
PCR3: 5′primer (AP5435); 3′primer (AP5436)
For Rat1 infection we used pBH2-HA-Flag-Myc (BA2313) and pBH2-HA-Flag-Myc Y74F (BA2315)
Antibodies
The following antibodies were used: anti Abl (K-19), anti Myc (C-33) anti Myc (N-262) and anti N-Myc (H-50) from Santa Cruz, Myc (Y69) from Abcam; anti HA from Covance (MMS-101P); anti Flag (F3165), anti-Flag beads (A2220) and anti-Vinculin (V9264) from Sigma; anti phosphotyrosine (4G10) and anti-Pin1 (PC270) from Upstate; anti acetyl lysine (#9441), anti P-Abl (Y412), and anti-Myc phospho-Thr 58/Ser 62 (#9401) from Cell Signaling.
The antibody directed against phospho-Tyr 74 in Myc (here anti Myc-pY74) was generated by Abcam upon our request and is commercially available (Abcam ab46848).
In order to selectively investigate the phosphorylation status of Myc Ser 62, rabbit polyclonal antisera were raised against a phosphorylated peptide containing phospho-Ser 62. For the immunization and subsequent affinity purification steps the following peptides were synthesized:
- Myc ELL pS62:ELLPTPPL(p)SPSRRSGLC
- Myc ELL pT58:ELLP(p)TPPLSPSRRSGLC
- Myc ELL pT58-S62:ELLP(p)TPPL(p)SPSRRSGLC
- Myc ELL:ELLPTPPLSPSRRSGLC
Crude bleeds were first immunodepleted with Myc ELL pT58, Myc ELL pT58-S62 and non-phosphorylated Myc ELL, and then affinity purified against the immunogenic peptide (Myc ELL p-S62). For characterization, the purified antibodies were used to immunoblot lysates from 293T cells transfected with expression vectors encoding either Flag-tagged Myc wild type or T58A/S62A mutants. As shown in figure S1, purified anti-Myc p62 efficiently recognized both Myc WT and T58A while, as expected, no signal was detected for the S62A mutant (Fig. S10).
Cell Culture, Transfections and Reagents
K562, MOLM, KYO, 293T, U2OS, and HeLa cells were growth under standard conditions. Pin1 KO MEFs were cultivated in DMEM medium supplemented with Glutamine 10% FBS, 100 units/ml penicillin and 100 mg/ml streptomycin, NEAA and β-mercaptoethanol. Cells were transfected using lipofectamine (Invitrogen) following the protocol supplied by the vendor. The Abl inhibitor STI571 was kindly provided by Novartis (Basel, Switzerland).
Immunoprecipitation, co-immunoprecipitation and In Vitro Binding
GST-Pin1 pull-down assays were performed as described (Zacchi el al 2002). Immunoprecipitation was carried out essentially as described in (Haupt et al 1996).
Immunofluorescence and Immunohistochemistry
For Immunofluorescence, adherent cells were grown on glass slides and fixed for 10 min in 4% paraformaldehyde. Cells growing in suspension were subjected to a cytospin (20g 5 min) and fixed as above. Cells were permeabilized with 0.2 % Triton in PBS (10 min) and blocked in 5% BSA (30 min, RT), followed by incubation with the primary antibody in 5% BSA (1h 30 min, RT), and with the secondary antibody (cy3 anti-rabbit) in 5% BSA (60 min, RT). The slides were finally stained with DAPI and mounted with Mowiol Mounting Media.
Immunohistochemical staining was performed with the avidin-biotin-peroxidase technique. Five- micrometer-thick sections were cut from the tissue specimens and placed on poly-L-lysine–coated glass slides. Sections were deparaffined by xylene and rehydrated in graded alcohol. Endogenous peroxidase was blocked by immersing the sections in 0.1% hydrogen peroxidase in absolute methanol for 20 min. For antigen retrieval, the tissue sections were heated in a pressure cooker in citric acid monohydrate 10 mM, pH 9.0, for 5 min, and then incubated with the primary antibody at room temperature. IHC was performed with Benchmark XT (Ventana Medical Systems, Inc, Tucson, AZ). The primary antibodies and dilutions used were: anti-p-Abl (p-Y412 Cell Signalling Technology 1:50), anti-Myc-pY74 (Abcam ab46848 1:50), anti-Myc (Y69 rabbit monoclonal, Abcam ab32072, 1/100). The incubation time for the antibodies was 60, 120 and 32 min respectively. All slides were hematoxylin counterstained, dehydrated, and mounted. Negative controls were performed by omitting the primary antibody.
Kinase Assay
293T cells were transfected with Myc WT or 5YF mutant. Myc was immunoprecipitated using anti-Flag beads, followed by three washes in IP buffer (50mM Tris pH 8, 5mM EDTA, 150-300mM NaCl, 0.5% NP-40) and one wash in kinase buffer. Immunoprecipitates were resuspended in kinase buffer (60mM HEPES, 5mM MgCl2, 5mM MnCl2, 3mM Na2VO4, 1.25mM DTT, 200 mM ATP) adding 50ng Abl1 Kinase (Cell Signalling). The reaction was incubated at room temperature for 30min. Immunoprecipitates were analysed by immunoblot with the anti-phosphotyrosine 4G10 antibody.
Dual Luciferase assay
U2OS cells were transfected with Fugene with 200ng of pNuc-Luc reporter, 200ng of pCMV-Flag-Myc, 100ng pcDNA-HA-Pin1, 50ng pCMV-HA-p300. For normalization and transfection efficiency control we used 8ng of pRL-TK reporter (Promega) that constitutively expresses the Renilla luciferase. After 36 hours cells were lysed and assayed for luciferase activity using the Dual Luciferase kit (Promega).
Rat1 co-transformation assay
Co-transformation of Rat1 cells by Myc and Bcr-Abl was as previously described (19, 20). To produce recombinant retroviruses, Phoenix eco cells were transfected with retroviral constructs expressing Bcr-Abl (pKI-Bcr-Abl WT or KD) or Myc (pBabe-Hygro-Myc-Flag, WT or Y74F). Rat1 cells were infected with either form of the Bcr-Abl viruses, selected with Puromycin, super-infected with either form of the Myc viruses, and selected with Hygromycin. Infected cells were directly plated in triplicate in medium containing 0.3% Bacto-agar laid on top of a layer of 0.6% Bacto-agar, and cultured for 2 weeks. Fresh media was changed every 2 days. Colonies were visualized by 0.1% p-iodonitro tetrazolium violet (INT, Sigma) staining.
Supplementary Material
FIg S3
Fig S1
Fig S10
Fig S2
Fig S4
Fig S5
Fig S6
Fig S7
Fig S8
Fig S9
Legends
Acknowledgments
We thank Theresia Kress, Stefano Campaner and Giorgio Scita for critical reading of the manuscript, Gianni Del Sal for scientific discussion and reagents, Warren Pear, Ricardo Sanchez-Prieto, Silvio Gutkind, Michael Cole and Pier Giuseppe Pelicci for reagents, Arianna Vino, Lorenzo Spagnuolo and Teresa Moliné for technical assistance, and the Antibody facility at the IFOM-IEO Campus. STI571 was supplied by Novartis. VJSAL was supported by a post-doctoral fellowship from the Ministerio de Ciencia e Inovacion. Work in the Amati lab was supported by grants from the European Commission FP7 Program (EuroSyStem and MODHEP), the European Research Council, the Association for International Cancer Research (AICR), the Cariplo Foundation, the Italian Health Ministry and the Italian Association for Cancer Research (AIRC).
Footnotes
Conflict of Interest: None of the authors has to report any conflicts of interest.
1. Lu KP, Finn G, Lee TH, Nicholson LK. Prolyl cis-trans isomerization as a molecular timer. Nature chemical biology. 2007 Oct 01;3(10):619–29. [PubMed]
2. Mantovani F, Tocco F, Girardini J, Smith P, Gasco M, Lu X, et al. The prolyl isomerase Pin1 orchestrates p53 acetylation and dissociation from the apoptosis inhibitor iASPP. Nature structural & molecular biology. 2007 Oct 01;14(10):912–20. [PubMed]
3. Mantovani F, Piazza S, Gostissa M, Strano S, Zacchi P, Mantovani R, et al. Pin1 links the activities of c-Abl and p300 in regulating p73 function. Molecular cell. 2004 Jul 04;14(5):625–36. [PubMed]
4. Wulf GM, Ryo A, Wulf GG, Lee SW, Niu T, Petkova V, et al. Pin1 is overexpressed in breast cancer and cooperates with Ras signaling in increasing the transcriptional activity of c-Jun towards cyclin D1. The EMBO Journal. 2001 Jul 02;20(13):3459–72. [PubMed]
5. Monje P, Hernández-Losa J, Lyons RJ, Castellone MD, Gutkind JS. Regulation of the transcriptional activity of c-Fos by ERK. A novel role for the prolyl isomerase PIN1. The Journal of biological chemistry. 2005 Oct 21;280(42):35081–4. [PubMed]
6. Bitomsky N, B√[partial differential]hm M, Klempnauer KH. Transformation suppressor protein Pdcd4 interferes with JNK-mediated phosphorylation of c-Jun and recruitment of the coactivator p300 by c-Jun. Oncogene. 2004;23(45):7484–93. doi: 10.1038/sj.onc.1208064. [PubMed] [Cross Ref]
7. Yeh E, Cunningham M, Arnold H, Chasse D, Monteith T, Ivaldi G, et al. A signalling pathway controlling c-Myc degradation that impacts oncogenic transformation of human cells. Nature cell biology. 2004 May 01;6(4):308–18. [PubMed]
8. Adhikary S, Marinoni F, Hock A, Hulleman E, Popov N, Beier R, et al. The ubiquitin ligase HectH9 regulates transcriptional activation by Myc and is essential for tumor cell proliferation. Cell. 2005 Nov 04;123(3):409–21. [PubMed]
9. Faiola F, Liu X, Lo S, Pan S, Zhang K, Lymar E, et al. Dual regulation of c-Myc by p300 via acetylation-dependent control of Myc protein turnover and coactivation of Myc-induced transcription. Molecular and cellular biology. 2005 Dec 01;25(23):10220–34. [PMC free article] [PubMed]
10. Zhang K, Faiola F, Martinez E. Six lysine residues on c-Myc are direct substrates for acetylation by p300. Biochemical and biophysical research communications. 2005 Oct 14;336(1):274–80. [PubMed]
11. Vervoorts J, Luscher-Firzlaff JM, Rottmann S, Lilischkis R, Walsemann G, Dohmann K, et al. Stimulation of c-MYC transcriptional activity and acetylation by recruitment of the cofactor CBP. EMBO Rep. 2003 May;4(5):484–90. [PubMed]
12. Patel JH, Du Y, Ard PG, Phillips C, Carella B, Chen CJ, et al. The c-MYC oncoprotein is a substrate of the acetyltransferases hGCN5/PCAF and TIP60. Molecular and cellular biology. 2004 Dec 01;24(24):10826–34. [PMC free article] [PubMed]
13. Frank SR, Schroeder M, Fernandez P, Taubert S, Amati B. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes & Development. 2001;15(16):2069–82. doi: 10.1101/gad.906601. [PubMed] [Cross Ref]
14. Frank SR, Parisi T, Taubert S, Fernandez P, Fuchs M, Chan HM, et al. MYC recruits the TIP60 histone acetyltransferase complex to chromatin. EMBO reports. 2003;4(6):575–80. doi: 10.1038/sj.embor.embor861. [PubMed] [Cross Ref]
15. Greasley PJ, Bonnard C, Amati B. Myc induces the nucleolin and BN51 genes: possible implications in ribosome biogenesis. Nucleic Acids Res. 2000;28(2):446–53. [PMC free article] [PubMed]
16. Lu PJ, Zhou XZ, Shen M, Lu KP. Function of WW domains as phosphoserine- or phosphothreonine-binding modules. Science (New York, NY) 1999;283(5406):1325–8. [PubMed]
17. Gong JG, Costanzo A, Yang HQ, Melino G, Kaelin WG, Jr, Levrero M, et al. The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature. 1999 Jun 24;399(6738):806–9. [PubMed]
18. Gregory MA, Qi Y, Hann SR. Phosphorylation by glycogen synthase kinase-3 controls c-myc proteolysis and subnuclear localization. The Journal of biological chemistry. 2003;278(51):51606–12. doi: 10.1074/jbc.M310722200. [PubMed] [Cross Ref]
19. Blackwood EM, Lugo TG, Kretzner L, King MW, Street AJ, Witte ON, et al. Functional analysis of the AUG- and CUG-initiated forms of the c-Myc protein. Mol Biol Cell. 1994;5(5):597–609. [PMC free article] [PubMed]
20. Lugo TG, Witte ON. The BCR-ABL oncogene transforms Rat-1 cells and cooperates with v-myc. Mol Cell Biol. 1989;9(3):1263–70. [PMC free article] [PubMed]
21. Srinivasan D, Sims JT, Plattner R. Aggressive breast cancer cells are dependent on activated Abl kinases for proliferation, anchorage-independent growth and survival. Oncogene. 2008 Mar 14;27(8):1095–105. [PubMed]
22. Srinivasan D, Plattner R. Activation of Abl tyrosine kinases promotes invasion of aggressive breast cancer cells. Cancer research. 2006 Jul 01;66(11):5648–55. [PubMed]
23. Ganguly SS, Fiore LS, Sims JT, Friend JW, Srinivasan D, Thacker MA, et al. c-Abl and Arg are activated in human primary melanomas, promote melanoma cell invasion via distinct pathways, and drive metastatic progression. Oncogene. 2011 Sep 5; [PMC free article] [PubMed]
24. Deininger MWN, Goldman JM, Melo JV. The molecular biology of chronic myeloid leukemia. Blood. 2000 Oct;19:15. [PubMed]
25. Levy D, Adamovich Y, Reuven N, Shaul Y. Yap1 phosphorylation by c-Abl is a critical step in selective activation of proapoptotic genes in response to DNA damage. Molecular cell. 2008 Mar 15;29(3):350–61. [PubMed]
26. Oh AS, Lahusen JT, Chien CD, Fereshteh MP, Zhang X, Dakshanamurthy S, et al. Tyrosine phosphorylation of the nuclear receptor coactivator AIB1/SRC-3 is enhanced by Abl kinase and is required for its activity in cancer cells. Mol Cell Biol. 2008 Nov;28(21):6580–93. [PMC free article] [PubMed]
27. Sánchez-Prieto R, Sanchez-Arevalo VJ, Servitja JM, Gutkind JS. Regulation of p73 by c-Abl through the p38 MAP kinase pathway. Oncogene. 2002 Feb 31;21(6):974–9. [PubMed]
28. Barilá D, Mangano R, Gonfloni S, Kretzschmar J, Moro M, Bohmann D, et al. A nuclear tyrosine phosphorylation circuit: c-Jun as an activator and substrate of c-Abl and JNK. The EMBO Journal. 2000 Feb 17;19(2):273–81. [PubMed]
29. Kharbanda S, Pandey P, Yamauchi T, Kumar S, Kaneki M, Kumar V, et al. Activation of MEK kinase 1 by the c-Abl protein tyrosine kinase in response to DNA damage. Molecular and cellular biology. 2000 Jul;20(14):4979–89. [PMC free article] [PubMed]
30. Pandey P, Raingeaud J, Kaneki M, Weichselbaum R, Davis RJ, Kufe D, et al. Activation of p38 mitogen-activated protein kinase by c-Abl-dependent and -independent mechanisms. The Journal of biological chemistry. 1996 Sep 27;271(39):23775–9. [PubMed]
31. Lufei C, Koh TH, Uchida T, Cao X. Pin1 is required for the Ser727 phosphorylation-dependent Stat3 activity. Oncogene. 2007 Dec 06;26(55):7656–64. [PubMed]
32. Yi P, Wu RC, Sandquist J, Wong J, Tsai SY, Tsai MJ, et al. Peptidyl-prolyl isomerase 1 (Pin1) serves as a coactivator of steroid receptor by regulating the activity of phosphorylated steroid receptor coactivator 3 (SRC-3/AIB1) Molecular and cellular biology. 2005 Nov 01;25(21):9687–99. [PMC free article] [PubMed]
33. Zacchi P, Gostissa M, Uchida T, Salvagno C, Avolio F, Volinia S, et al. The prolyl isomerase Pin1 reveals a mechanism to control p53 functions after genotoxic insults. Nature. 2002 Oct 24;419(6909):853–7. [PubMed]
34. Agami R, Blandino G, Oren M, Shaul Y. Interaction of c-Abl and p73alpha and their collaboration to induce apoptosis. Nature. 1999 Jun 24;399(6738):809–13. [PubMed]
35. Yuan ZM, Shioya H, Ishiko T, Sun X, Gu J, Huang YY, et al. p73 is regulated by tyrosine kinase c-Abl in the apoptotic response to DNA damage. Nature. 1999;399(6738):814–7. doi: 10.1038/21704. [PubMed] [Cross Ref]
36. Sawyers CL, Callahan W, Witte ON. Dominant negative MYC blocks transformation by ABL oncogenes. Cell. 1992;70(6):901–10. [PubMed]
37. Gomez-Casares MT, Garcia-Alegria E, Lopez-Jorge CE, Ferrandiz N, Blanco R, Alvarez S, et al. MYC antagonizes the differentiation induced by imatinib in chronic myeloid leukemia cells through downregulation of p27(KIP1) Oncogene. 2012 Jun 18; [PubMed]
38. Adhikary S, Eilers M. Transcriptional regulation and transformation by Myc proteins. Nat Rev Mol Cell Biol. 2005 Aug;6(8):635–45. [PubMed]
39. Conacci-Sorrell M, Ngouenet C, Eisenman RN. Myc-Nick: A Cytoplasmic Cleavage Product of Myc that Promotes alpha-Tubulin Acetylation and Cell Differentiation. Cell. 2010 Aug 06;142(3):480–93. [PMC free article] [PubMed]
40. Huang CC, Liu CH, Chuang NN. An enhanced association of RACK1 with Abl in cells transfected with oncogenic ras. Int J Biochem Cell Biol. 2008;40(3):423–31. [PubMed]
41. Craig RW, Buchan HL, Civin CI, Kastan MB. Altered cytoplasmic/nuclear distribution of the c-myc protein in differentiating ML-1 human myeloid leukemia cells. Cell growth & differentiation: the molecular biology journal of the American Association for Cancer Research. 1993 Jun 01;4(5):349–57. [PubMed]
42. Sundaresan V, Forgacs IC, Wight DG, Wilson B, Evan GI, Watson JV. Abnormal distribution of c-myc oncogene product in familial adenomatous polyposis. Journal of clinical pathology. 1987 Nov 01;40(11):1274–81. [PMC free article] [PubMed]
43. Williams AR, Piris J, Wyllie AH. Immunohistochemical demonstration of altered intracellular localization of the C-Myc oncogene product in human colorectal neoplasms. J Pathol. 1990 Apr;160(4):287–93. [PubMed]