PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Genomics. Author manuscript; available in PMC 2014 April 1.
Published in final edited form as:
PMCID: PMC3785290
NIHMSID: NIHMS475573

Intrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms

Abstract

Amplicons – large, nearly identical repeats in direct or inverted orientation – are abundant in the male-specific region of the human Y chromosome (MSY) and provide targets for intrachromosomal non-allelic homologous recombination (NAHR). Thus far, NAHR events resulting in deletions, duplications, inversions, or isodicentric chromosomes have been reported only for amplicon pairs located exclusively on the short arm (Yp) or the long arm (Yq). Here we report our finding of four men with Y chromosomes that evidently formed by intrachromosomal NAHR between inverted repeat pairs comprising one amplicon on Yp and one amplicon on Yq. In two men with spermatogenic failure, sister-chromatid crossing-over resulted in pseudoisoYp chromosome formation and loss of distal Yq. In two men with normal spermatogenesis, intrachromatid crossing-over generated pericentric inversions. These findings highlight the recombinogenic nature of the MSY, as intrachromosomal NAHR occurs for nearly all Y-chromosome amplicon pairs, even those located on opposing chromosome arms.

Keywords: Human Y chromosome, Non-allelic homologous recombination, Structural variation, Male infertility

1. Introduction

The male-specific region of the human Y chromosome (MSY) contains many amplicons – large, nearly identical repeats – whose sequence similarity is maintained by gene conversion [1,2]. These long segments of high sequence identity render the Y chromosome susceptible to intrachromosomal homologous recombination that can result in interstitial deletions, duplications, inversions, or isodicentric chromosomes [3-13]. Interstitial Y deletions and isodicentric Y chromosomes are associated with a wide range of sex disorders, including male infertility, Turner syndrome, and sex reversal (reviewed in [14]).

Whereas each of the intrachromosomal homologous recombination events reported to date involve amplicons located on the same Y-chromosome arm, the reference Y chromosome also contains two sets of inverted repeats (IRs) that are composed of one amplicon on the short arm (Yp) and one amplicon on the long arm (Yq), namely IR1 and IR4 [1]. IR1 is composed of two amplicons that share >99% sequence identity over ~62 kilobases (kb), and IR4 is composed of two amplicons that share ~94% sequence identity over ~303 kb. Of note, the IR1 repeat on Yq is located within the azoospermia factor c (AZFc) region that contains genes essential for spermatogenesis and is almost entirely ampliconic [6].

We hypothesized that intrachromosomal homologous recombination between amplicons of IR1 or between amplicons of IR4 can generate two types of rearrangements: pseudoisochromosomes, in which the two chromosome ends are identical and in mirror-image orientation, and pericentric inversions (Fig. 1). For example, resolution of a double-strand break (DSB) in the Yq copy of IR1 by inter-sister-chromatid crossing-over with the Yp copy would produce a pseudoisoYp chromosome, which carries a partial duplication of Yp and a partial deletion of Yq, and a pseudoisoYq chromosome, which carries a partial duplication of Yq and partial deletion of Yp. Transmission of the former would likely result in a male offspring with impaired spermatogenesis due to the absence of multiple genes from the AZFc region. Alternatively, resolution of a DSB in the Yq copy of IR1 by intrachromatid crossing-over with the Yp copy would lead to a pericentric inversion in that chromatid. Although pseudoisoY chromosomes and Y-chromosome pericentric inversions have been described previously [15-26], it is unknown if these rearrangements indeed are generated via homologous recombination between inverted amplicons.

Fig. 1
Mechanisms of pseudoisochromosome formation and pericentric inversion.

Here, we report four Y chromosomes – two pseudoisoYp chromosomes and two with pericentric inversions – that evidently formed by homologous recombination between amplicons of IR1 or of IR4. We then catalog all copies of IR1 and of IR4 that could be potential targets for such ectopic homologous recombination events, as well as the putative resultant pseudoisoY chromosomes and pericentric inversions. Finally, we discuss the spermatogenic phenotypes of two men with pseudoisoYp chromosomes and the relationship of these findings to an inclusive model of ectopic homologous recombination in the human MSY.

2. Results

2.1 IR1 and IR4: pairs of inverted repeats on opposing Y-chromosome arms

We closely examined the MSY reference sequence to determine the precise structure of the IR1 and IR4 repeats on Yp and on Yq (Fig. 2A-B, Table 1, and Supplementary Table S1) [1]. On Yp, the IR1 and IR4 amplicons are each present in one complete copy. Similarly, on Yq, the IR4 amplicon is present in only one contiguous copy. In contrast, the IR1 amplicon on Yq is located within the 3.5-megabase (Mb) AZFc region, which comprises multiple copies of five different amplicons arrayed in direct and inverted orientations: four copies of blue (b1–b4), two copies of turquoise, three copies of green (g1–g3), four copies of red (r1–r4), and two copies of yellow [6]. IR1 on Yq partially overlaps two of the AZFc amplicons; it is composed of 30.3 kb of the 228-kb amplicon b2 and 7.6 kb of the 314.7-kb amplicon g1, as well as of 24.5 kb of intervening sequence termed u3. Thus, there are four additional Yq loci – portions of amplicons b3, g2, g3, and b4 – that share high sequence identity with segments of IR1. (The segment of IR1 that overlaps b2 and is repeated in b3 and b4 is absent in b1.) We termed these loci IR1-b3, IR1-g2, IR1-g3, and IR1-b4 (Fig. 2B and Supplementary Table S1).

Fig. 2
Locations and orientations of Yp-Yq inverted repeats on the human Y chromosome.
Table 1
Catalog of inverted repeat targets involving IR1 or IR4 amplicons on Yp and Yq.

To examine the sequence structure of the AZFc region in relation to Yp, we generated a triangular dot plot of the Yp region encompassing IR1 and IR4 against the Yq region encompassing AZFc (Fig. 2C). The 7.6-kb IR1-g2 and 30.3-kb IR1-b4 segments on Yq are in inverted orientation relative to IR1 on Yp and thus present additional targets for recombination by our model (Table 1).

2.2 Cases

On the basis of karyotyping, we identified from our sample collections two men, WHT5557 and AMC1574, with pseudoisoYp chromosomes, and two men, AMC0972 and AMC0973, with pericentric inverted Y chromosomes. WHT5557 and AMC1574 were diagnosed with azoospermia and severe oligozoospermia, respectively. In contrast, both men with pericentric inversions had normal spermatogenesis. We hypothesized that each of these rearrangements was generated through intrachromosomal homologous recombination between one of the pairs of Yp-Yq repeats. To test this hypothesis, we employed two tools to define the recombination breakpoints in these cases: 1) a series of precisely mapped sequence-tagged sites (STSs), whose presence or absence is readily assayed by PCR on genomic DNA; and 2) fluorescence in situ hybridization (FISH) of Y-specific probes, whose copy number and chromosomal location enabled us to distinguish between various MSY structures.

2.3 PseudoisoYp chromosomes

We had previously localized, in case WHT5557, a single breakpoint in the IR4 amplicon on Yq bounded by STSs sY1279 and sY1278: all STSs on Yp and proximal to IR4 on Yq were present, and all STSs distal to IR4 on Yq were absent [13]. We used high-resolution breakpoint mapping to further delineate the breakpoint region in this case. Making use of the ~6% sequence divergence between IR4 on Yp and IR4 on Yq, we employed plus/minus STS assays specific to the Yq repeat unit to precisely localize the breakpoint to an 800-bp interval (Fig. 3A and Supplementary Table S2) [27]. We then designed a primer pair for junction amplification by PCR, with one primer immediately proximal to the Yq breakpoint interval and a second primer immediately distal to the homologous interval on Yp. This primer pair amplified a product in WHT5557 but not in control individuals. Sequencing of the junction product confirmed the expected sequences to be those of Yq and Yp on each side of a 153-bp segment of perfect identity (Fig. 3B), indicating that the pseudoisoYp chromosome in this case had formed by inter-sister-chromatid recombination between IR4 amplicons (Fig. 3C).

Fig. 3
Location of the breakpoints in two men with pseudoisoYp chromosomes.

In AMC1574, STS mapping revealed a single breakpoint between the proximal copy of sY1206 and sY1201, in the distal part of AZFc (Fig. 3A and Supplementary Table S2). Since this breakpoint region contains the IR1-g2 and IR1-b4 repeat units, we reasoned that the pseudoisoYp chromosome observed by karyotyping had arisen by inter-sister-chromatid recombination between either IR1-g2 or IR1-b4 on Yq and IR1 on Yp. Both such events preserve highly sequence-similar IR1 amplicons on Yq, thus high-resolution breakpoint mapping was not feasible for this case. Instead, we performed single-color FISH experiments on metaphase and interphase spreads to assay the copy number and chromosome-arm location of several loci ordinarily located only on either Yp or Yq (Fig. 4A).

Fig. 4
Characterization of Y-chromosome structures by FISH.

Metaphase FISH in AMC1574 demonstrated that probe pDP1335, normally mapping to SRY on distal Yp, was present on both chromosome arms (Fig. 4B). Similarly, FISH probes RP11-199M2, targeting AMELY, and 17224/17225, located immediately distal to the Yp copy of IR1, were present on both chromosome arms in AMC1574, but only on Yp in a control sample. In contrast, two other FISH probes from Yp – 17228/17229, located immediately proximal to the Yp copy of IR1, and RP11-516H8, a BAC targeting the TSPY array on proximal Yp – were present exclusively on one chromosome arm in AMC1574. These results suggested that the recombination event on Yp had occurred in the region between 17224/17225 and 17228/17229, that is, in IR1. On Yq, all green, red, and yellow amplicons from the AZFc region remained exclusively on this chromosome arm in AMC1574 (Fig. 4B). Interphase FISH demonstrated reference copy numbers of green, red, and yellow amplicons, indicating that the recombination event was distal to these amplicons, in IR1-b4 (Supplementary Table S3). In sum, these results indicate that the pseudoYp isochromosome in AMC1574 was formed by an inter-sister-chromatid recombination event between the IR1-b4 amplicon on Yq and the IR1 amplicon on Yp (Fig. 4C).

2.4 Y-chromosome pericentric inversions

Because DNA material is not deleted in an inversion, STS screening was not useful for characterizing recombination events for the two patients whose karyotypes had revealed pericentric inversions in the Y chromosome. For these cases, we relied on FISH to determine the copy number and location of several Y-chromosome loci and then to infer the recombination event that had generated each inversion. In contrast to the pseudoisoYp chromosomes described above, in which the large Yq heterochromatic repeat is deleted, Y chromosomes with pericentric inversions retain this chromosomal landmark, which is clearly visible when metaphase spreads are counterstained with DAPI (Fig. 4B). This enabled us to assign metaphase FISH signals to either Yp or Yq, or to both arms.

When we assayed Yp FISH probes on metaphase spreads of AMC0972, our results indicated that the IR1 amplicon on Yp had been targeted (Fig. 4B). pDP1335, 17224/17225, and RP11-199M2, three probes that are normally distal to the Yp amplicon of IR1, remained only on Yp. In contrast, 17228/17729 and RP11-516H8, two probes located proximal to IR1 on Yp, hybridized only to Yq. Next, we assayed FISH probes normally in the AZFc region on Yq. In AMC0972, we found copies of the green, red, and yellow amplicons both on Yp and on Yq, suggesting that the inverted segment included at least one copy of each amplicon and that the Yq inversion breakpoint was located within the AZFc region. Indeed, two-color FISH on interphase spreads showed a green-red-green amplicon cluster clearly separated from a red-green amplicon cluster, in contrast to a control sample where these amplicons were arranged in a single cluster with a green-red-green-red-green organization (Fig. 4D). When we performed two-color interphase FISH with probe pDP1335 to distal Yp and a probe to the green amplicon, we found that two of the three green amplicons were located on Yp in AMC0972 (data not shown). The most likely explanation for the metaphase and interphase FISH results involves a two-step model: 1) gr/rg inversion within AZFc (a previously described polymorphism [9-11]), followed by 2) intrachromatid recombination between IR1 on Yp and IR1-b3 on Yq (Fig. 4E and Supplementary Fig. S1).

For AMC0973, single-color FISH on metaphase spreads showed that green, yellow and red amplicons were present on Yp and on Yq, indicating that – similar to our findings for AMC0972 – the inversion breakpoint was located within the AZFc region (data not shown). Two-color FISH on interphase spreads showed a red-green amplicon organization in one cluster separated from a green-red-green amplicon organization in a second cluster (Fig. 4D). In contrast to AMC0972, only a single green amplicon was located on Yp (data not shown). These results suggest that the pericentric inversion in AMC0973 was the result of intrachromatid recombination between IR1 on Yp and IR1-g2 on Yq. Insufficient cells were available for additional FISH experiments for this case.

2.5 Catalog of IR1 and IR4 inverted repeat pairs

Having identified four unique recombination events, including one that had evidently formed on a Y chromosome carrying an inversion polymorphism, we sought to generate a more extensive catalog of Yp-Yq inverted repeats by accounting for known inversion polymorphisms. The IR1 and IR4 amplicons on Yp and all IR1 amplicons on Yq are located in regions known to be subject to large-scale inversion (Supplementary Fig. S2). On Yp, a 3.6-Mb region containing the IR1 and IR4 amplicons and bounded by the IR3 inverted repeats has been inverted repeatedly during human history [1,11,28-31]. On Yq, the orientations of segments that contain IR1 amplicons can be polymorphic due to the frequently occurring b2/b3 and gr/rg inversions [9-11]. Thus, additional inverted repeat pairs potentially exist among extant human Y chromosomes. Taking these relatively common inversions into account, we schematized six dot plots – the two IR3 orientations plotted against each of the three AZFc orientations – and identified a total of 18 inverted repeat pairs involving IR1 or IR4. Each of the 18 inverted repeats is a putative substrate for the proposed model of inter-arm homologous recombination (Supplementary Fig. S2 and Table 1).

To facilitate future molecular characterization of non-reference Y chromosomes, we determined the Y-chromosome structures that could arise by our proposed model at these 18 inverted repeats (Supplementary Fig. S3). For each of these 18 repeat pairs, sister-chromatid crossing-over would generate a pseudoisoYp chromosome and a pseudoisoYq chromosome, whereas intrachromatid crossing-over would produce a pericentric inversion in one chromatid. Homologous recombination between IR1 pairs or between IR4 pairs could produce a total of 50 different non-reference Y-chromosome structures, which can be distinguished by the series of FISH probes reported here.

3. Discussion

We and others have shown in previous studies that nearly all amplicons located on the same Y-chromosome arm – in direct or inverted (palindromic) orientation – are substrates for ectopic homologous recombination [3-13]. Recently, we proposed an inclusive model that unites these findings as well as evidence of sequence homogenization of palindromic repeats on primate Y chromosomes [13]. In our model, a double-strand break (DSB) formed in one repeat is resolved by inter-sister-chromatid or intrachromatid repair using the other repeat as a template. Repair with crossing-over alters the structure of the Y chromosome, resulting in deletions, duplications, inversions, or isodicentric chromosomes. Alternatively, DSB repair involving noncrossover resolution leads to gene conversion, homogenizing the repeat sequences and thus maintaining opportunities for further ectopic recombination events.

The findings we report here indicate that our model extends to inverted repeats located on opposing arms of the human Y chromosome. We identified among individuals in our collections four unrelated men with non-reference Y-chromosome structures that appear to have arisen via ectopic homologous recombination between such inverted repeat pairs. Two men harbored pseudoisoYp chromosomes that apparently had formed by sister-chromatid crossing-over. In two other men, intrachromatid crossing-over apparently had generated Y-chromosome pericentric inversions. Furthermore, analysis of the reference sequence indicates that such inverted repeat pairs are also undergoing sequence homogenization. For example, the copies of IR1 on Yp and Yq share 99.66% sequence identity (0.34% sequence divergence) over 62.4 kb, an average of one difference per 295 nucleotides (Table 1). However, the amplicons include a 6142-nucleotide interval of 100% identity, which is highly unlikely without sequence homogenization. Similarly, the IR4 amplicons contain a 590-nucleotide interval of 100% sequence identity, despite overall sequence divergence of >6% over 303.2 kb (in both cases p<0.0001, computer simulation). Thus, inverted repeat pairs located on opposing Y-chromosome arms appear to undergo NAHR-mediated sequence homogenization, which renders them susceptible to further ectopic recombination.

Whereas pericentric inversions do not impact genomic content and thus should not influence spermatogenesis, recombination events that result in pseudoisoYp chromosome formation can disrupt spermatogenesis through loss of some distal Yq DNA. Indeed, both men with pseudoisoYp chromosomes displayed severe spermatogenic failure: WHT5557 and AMC1574 were diagnosed with non-obstructive azoospermia (no sperm in semen) and severe oligozoospermia (total sperm count <5×106), respectively. The difference in severity may be explained by the fact that WHT5557 lacked the entire AZFc region, a region essential for sperm production [6], whereas no protein-coding genes were deleted in AMC1574 (Supplementary Table S4). Reduced spermatogenesis in AMC1574 may be attributable to germline instability of the abnormal Y chromosome, as we have hypothesized previously for isodicentric Y chromosomes [13]. Alternatively, absence of the Yq pseudoautosomal region (PAR2), which can recombine during meiosis with its homologous counterpart on the X chromosome, may disrupt X-Y chromosome pairing, thereby impairing spermatogenesis [32]. In contrast and as expected, both individuals with pericentric inversions were phenotypically normal men with normal fertility.

We do not know whether the pseudoisoYp chromosomes or pericentric Y inversions reported here arose de novo or were inherited, because we lack requisite material (cells or genomic DNA) from patrilineal relatives. However, previous studies of individuals with pericentric Y inversions, whose frequency is estimated at 1–2 per 1,000 males, have found the inversions in male relatives, indicating that such inversions are heritable and thus compatible with fertility [17-24]. Indeed, a pericentric Y inversion of a single origin was found at high frequency (~30%) among a South African population whose ancestors originated from the Indian state of Gujarat [23,24].

Of a total of 50 different non-reference Y chromosome structures predicted to arise from 18 intrachromosomal homologous recombination events between IR1 repeats or between IR4 repeats (Supplementary Fig. S3), we identified four: two pseudoisoYp chromosomes (between IR4 repeats or IR1/IR1-b4 repeats) and two pericentric Y inversions (between IR1/IR1-b3 repeats or IR1/IR1-g2 repeats). A recent report classified pericentric Y inversions found in nine unrelated men into three types, based on the Yq inversion breakpoints determined by FISH [26]. For each type, the FISH results are compatible with intrachromatid recombination between IR1 amplicons or between IR4 amplicons. It is possible that all 50 predicted structures exist in the human population, but the chance of their ascertainment is expected to vary. For example, Y-chromosome pericentric inversions do not influence spermatogenesis (nor, presumably, other phenotypes), thus their detection depends on additional analysis of worldwide structural polymorphism [11] or on fortuitous cytological identification. In contrast, pseudoisoYp chromosomes are expected to impair spermatogenesis. Thus, such chromosomes will be identified by karyotype analysis during the clinical work-up of men seeking fertility treatment. Similarly, an individual carrying a pseudoisoYq chromosome is expected to be anatomically female since SRY, normally located in distal Yp, is absent, and she may present with Turner syndrome stigmata.

The relative likelihood of identifying the 50 predicted structures and the isodicentric Y chromosomes we described previously [13] also depends on their relative rates of formation. In all cases, the Y chromosome must experience a DSB in an amplicon, which must then interact and recombine with a non-allelic counterpart. For pseudoisochromosomes and pericentric inversions to form, Yp and Yq – on sister chromatids or within one chromatid – must enter into proximity. On the other hand, isodicentric Y chromosomes form by crossing-over between inverted repeats located in similar positions on sister chromatids; such repeats likely remain, after replication and through to chromosome segregation, in closer physical proximity than amplicon pairs separated by the centromere. Thus, the rates at which different repeat pairs interact and recombine to form non-reference Y chromosome structures are almost certainly affected by chromosome dynamics that could sterically hinder or favor some interactions over others.

In conclusion, we have found that in addition to generating isodicentric Y chromosomes and Y chromosomes that carry deletions, duplications, or inversions, intrachromosomal homologous recombination can also generate pseudoisoY chromosomes and Y-chromosome pericentric inversions. The catalog of all possible MSY structures resulting from homologous recombination between IR1 or IR4 copies as well as the methods used to detect them will facilitate the molecular classification of all aberrant Y-chromosome structures. These methods include 1) single-locus-specific PCR-based assays that discriminate between sequence variants in sequence-similar regions and, when feasible, lead to junction amplification; and 2) FISH assays that enable the characterization of recombination events involving large amplicons with high sequence identity.

4. Materials and Methods

4.1 Dot plots

Dot plots were generated using the program self_dot_plot.pl (available at http://pagelab.wi.mit.edu/research) [1]. To preclude showing matches caused by short interspersed repeats or by low-complexity repetitive sequences, such repeat elements were masked using RepeatMasker version open-4.0.1 (http://www.repeatmasker.org).

4.2 Cases

The men studied originated from sample collections of the Whitehead Institute, Cambridge; Onze Lieve Vrouwe Gasthuis, Amsterdam; the Maastricht University Medical Center; and the Academic Medical Center, Amsterdam. They were selected based on their karyotype data that indicated a pseudoisoYp chromosome or a pericentric inversion. Karyotyping of these men was performed as part of either fertility workup or prenatal screening. Genomic DNA was extracted from venous blood and leukocytes were isolated for FISH analysis. This study was approved by the institutional review boards of the Massachusetts Institute of Technology and the Academic Medical Center. Informed consent was obtained from all participants.

4.3 STS deletion screening

All four men were screened for deletions using plus/minus PCR for the following low-resolution STSs: sY142, sY1197, sY1191, sY1291, sY1206, and sY1201, as described previously [6, 10]. WHT5557 was additionally screened for deletions using MSY Breakpoint Mapper (http://breakpointmapper.wi.mit.edu) [27]. STSs and their GenBank accession numbers are listed in Supplementary Table S2.

4.4 Amplification and sequencing of WHT5557 junction sequence

The junction sequence in WHT5557 was PCR-amplified using primer 19760 (AGTGAGCCCAGTTTGCATG) specific to IR4 on Yq and primer 19761 (GGATAGCCTGAAATATAGGCAAATAT) specific to IR4 on Yp. The resulting PCR product was sequenced on an ABI3730 automated sequencer using the PCR primers and the BigDye Terminator protocol (Applied Biosystems). See GenBank accession number EU747132 for junction sequence.

4.5 Fluorescence in situ hybridization

Metaphase and interphase nuclei were hybridized, as previously described [13], with the following FISH probes: plasmid pDP1335 (SRY on distal Yp), BAC RP11-199M2 (AMELY), long-range PCR product 17224/17225 (immediately distal to IR1 on Yp), long-range PCR product 17228/17229 (immediately proximal to IR1 on Yp), BAC RP11-516H8 (TSPY array on proximal Yp), BAC RP11-363G6 (green amplicon in AZFc), cosmid 18E8 (red amplicon in AZFc), and BAC RP11-79J10 (yellow amplicon in AZFc). Long-range PCR product 17224/17225 was amplified with primers 17224 (GGTGTATGTGTGCATGGATTTCTGCTTG) and 17225 (AGCAGGTAGGCTTCATCAGTTGTGGTTG) using BAC RP11-305H21 as template. 17228/17229 was amplified with primers 17228 (AACTGGAATAGTGTTTCCTGGGGCTGAA) and 17229 (TCTGGGCCAGTGTATGGGGCTTATTAAC) using BAC RP11-109F19 as template. Long-range PCR was performed using Advantage 2 Taq polymerase (BD Biosciences) according to the manufacturer’s instructions. Each primer was at 1 μM final concentration. For a 100 μL reaction, template DNA was 50 ng of extracted BAC DNA. Amplification conditions were 95°C for 1 minute; 30 cycles of 95°C for 30 seconds, 68°C for 10 minutes; 68°C for 10 minutes.

Highlights

  • We molecularly characterize four structural rearrangements of the human Y chromosome.
  • Rearrangements arise by ectopic homologous recombination between Y chromosome arms.
  • Repeat pairs located on opposing arms of the Y chromosome can undergo recombination.
  • Fifty such rearrangements are predicted to arise on common Y chromosome structures.

Supplementary Material

01

02

03

Acknowledgments

We thank Lia Knegt for karyotype analysis, Laura Brown for patient data curation, and Jennifer Hughes for valuable comments on the manuscript. This work was supported by the National Institutes of Health, the Howard Hughes Medical Institute, the Netherlands Organization for Scientific Research, and the Academic Medical Center of the University of Amsterdam.

Abbreviations

MSY
male-specific region of the Y chromosome
NAHR
non-allelic homologous recombination
AZFc
azoospermia factor c
IR
inverted repeat
DSB
double-strand break
STS
sequence-tagged site
FISH
fluorescence in situ hybridization
PAR
pseudoautosomal region

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1. Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, Brown LG, Repping S, Pyntikova T, Ali J, Bieri T, Chinwalla A, Delehaunty A, Delehaunty K, Du H, Fewell G, Fulton L, Fulton R, Graves T, Hou SF, Latrielle P, Leonard S, Mardis E, Maupin R, McPherson J, Miner T, Nash W, Nguyen C, Ozersky P, Pepin K, Rock S, Rohlfing T, Scott K, Schultz B, Strong C, Tin-Wollam A, Yang SP, Waterston RH, Wilson RK, Rozen S, Page DC. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature. 2003;423:825–837. [PubMed]
2. Rozen S, Skaletsky H, Marszalek JD, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Page DC. Abundant gene conversion between arms of palindromes in human and ape Y chromosomes. Nature. 2003;423:873–6. [PubMed]
3. Sun C, Skaletsky H, Rozen S, Gromoll J, Nieschlag E, Oates R, Page DC. Deletion of azoospermia factor a (AZFa) region of human Y chromosome caused by recombination between HERV15 proviruses. Hum Mol Genet. 2000;9:2291–2296. [PubMed]
4. Kamp C, Hirschmann P, Voss H, Huellen K, Vogt PH. Two long homologous retroviral sequence blocks in proximal Yq11 cause AZFa microdeletions as a result of intrachromosomal recombination events. Hum Mol Genet. 2000;9:2563–2572. [PubMed]
5. Blanco P, Shlumukova M, Sargent CA, Jobling MA, Affara N, Hurles ME. Divergent outcomes of intrachromosomal recombination on the human Y chromosome: male infertility and recurrent polymorphism. J Med Genet. 2000;37:752–758. [PMC free article] [PubMed]
6. Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Silber S, Oates R, Rozen S, Page DC. The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet. 2001;29:279–286. [PubMed]
7. Repping S, Skaletsky H, Lange J, Silber S, Van Der Veen F, Oates RD, Page DC, Rozen S. Recombination between palindromes P5 and P1 on the human Y chromosome causes massive deletions and spermatogenic failure. Am J Hum Genet. 2002;71:906–922. [PubMed]
8. Repping S, Skaletsky H, Brown L, van Daalen SK, Korver CM, Pyntikova T, Kuroda-Kawaguchi T, de Vries JW, Oates RD, Silber S, van der Veen F, Page DC, Rozen S. Polymorphism for a 1.6-Mb deletion of the human Y chromosome persists through balance between recurrent mutation and haploid selection. Nat Genet. 2003;35:247–251. [PubMed]
9. Fernandes S, Paracchini S, Meyer LH, Floridia G, Tyler-Smith C, Vogt PH. A large AZFc deletion removes DAZ3/DAZ4 and nearby genes from men in Y haplogroup N. Am J Hum Genet. 2004;74:180–7. [PubMed]
10. Repping S, van Daalen SK, Korver CM, Brown LG, Marszalek JD, Gianotten J, Oates RD, Silber S, van der Veen F, Page DC, Rozen S. A family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region. Genomics. 2004;83:1046–52. [PubMed]
11. Repping S, van Daalen SK, Brown LG, Korver CM, Lange J, Marszalek JD, Pyntikova T, van der Veen F, Skaletsky H, Page DC, Rozen S. High mutation rates have driven extensive structural polymorphism among human Y chromosomes. Nat Genet. 2006;38:463–7. [PubMed]
12. Jobling MA, Lo IC, Turner DJ, Bowden GR, Lee AC, Xue Y, Carvalho-Silva D, Hurles ME, Adams SM, Chang YM, Kraaijenbrink T, Henke J, Guanti G, McKeown B, van Oorschot RA, Mitchell RJ, de Knijff P, Tyler-Smith C, Parkin EJ. Structural variation on the short arm of the human Y chromosome: recurrent multigene deletions encompassing Amelogenin Y. Hum Mol Genet. 2007;16:307–16. [PMC free article] [PubMed]
13. Lange J, Skaletsky H, van Daalen SK, Embry SL, Korver CM, Brown LG, Oates RD, Silber S, Repping S, Page DC, Isodicentric Y. chromosomes and sex disorders as byproducts of homologous recombination that maintains palindromes. Cell. 2009;138:855–69. [PMC free article] [PubMed]
14. Carvalho CM, Zhang F, Lupski JR. Structural variation of the human genome: mechanisms, assays, and role in male infertility. Syst Biol Reprod Med. 2011;57:3–16. [PMC free article] [PubMed]
15. Jacobs PA, Brunton M, Brown WM. Cytogenetic studies in leucocytes on the general population: subjects of ages 65 years and more. Ann Hum Genet. 1964;27:353–65. [PubMed]
16. Jacobs PA, Ross A. Structural abnormalities of the Y chromosome in man. Nature. 1966;210:352–4. [PubMed]
17. Sparkes RS, Muller HM, Veomett IC. Inherited pericentric inversion of a human Y chromosome in trisomic Down’s syndrome. J Med Genet. 1970;7:59–62. [PMC free article] [PubMed]
18. Friedrich U, Nielsen J. Chromosome studies in 5,049 consecutive newborn children. Clin Genet. 1973;4:333–43. [PubMed]
19. Zeuthen E, Nielsen J, Pericentric Y. inversion in the general population. Humangenetik. 1973;19:265–70. [PubMed]
20. Verma RS, Rodriguez J, Dosik H. The clinical significance of pericentric inversion of the human Y chromosome: a rare “third” type of heteromorphism. J Hered. 1982;73:236–8. [PubMed]
21. Toth A, Gaal M, Laszlo J. Familial pericentric inversion of the Y chromosome. Ann Genet. 1984;27:60–1. [PubMed]
22. Shapiro LR, Pettersen RO, Wilmot PL, Warburton D, Benn PA, Hsu LY. Pericentric inversion of the Y chromosome and prenatal diagnosis. Prenat Diagn. 1984;4:463–5. [PubMed]
23. Bernstein R, Wadee A, Rosendorff J, Wessels A, Jenkins T. Inverted Y chromosome polymorphism in the Gujerati Muslim Indian population of South Africa. Hum Genet. 1986;74:223–9. [PubMed]
24. Spurdle A, Jenkins T. The inverted Y-chromosome polymorphism in the Gujarati Muslim Indian population of South Africa has a single origin. Hum Hered. 1992;42:330–2. [PubMed]
25. Pasantes JJ, Rottger S, Schempp W. Part of the RBM gene cluster is located distally to the DAZ gene cluster in human Yq11.23. Chromosome Res. 1997;5:537–40. [PubMed]
26. Knebel S, Pasantes JJ, Thi DA, Schaller F, Schempp W. Heterogeneity of pericentric inversions of the human Y chromosome. Cytogenet Genome Res. 2011;132:219–26. [PubMed]
27. Lange J, Skaletsky H, Bell GW, Page DC. MSY Breakpoint Mapper, a database of sequence-tagged sites useful in defining naturally occurring deletions in the human Y chromosome. Nucleic Acids Res. 2008;36:D809–14. [PMC free article] [PubMed]
28. Page DC. Sex reversal: deletion mapping the male-determining function of the human Y chromosome. Cold Spring Harb Symp Quant Biol. 1986;51(Pt 1):229–35. [PubMed]
29. Affara NA, Ferguson-Smith MA, Tolmie J, Kwok K, Mitchell M, Jamieson D, Cooke A, Florentin L. Variable transfer of Y-specific sequences in XX males. Nucleic Acids Res. 1986;14:5375–87. [PMC free article] [PubMed]
30. Jobling MA, Williams GA, Schiebel GA, Pandya GA, McElreavey GA, Salas GA, Rappold GA, Affara NA, Tyler-Smith C. A selective difference between human Y-chromosomal DNA haplotypes. Curr Biol. 1998;8:1391–4. [PubMed]
31. Tilford CA, Kuroda-Kawaguchi T, Skaletsky H, Rozen S, Brown LG, Rosenberg M, McPherson JD, Wylie K, Sekhon M, Kucaba TA, Waterston RH, Page DC. A physical map of the human Y chromosome. Nature. 2001;409:943–5. [PubMed]
32. Mohandas TK, Speed RM, Passage MB, Yen PH, Chandley AC, Shapiro LJ. Role of the pseudoautosomal region in sex-chromosome pairing during male meiosis: meiotic studies in a man with a deletion of distal Xp. Am J Hum Genet. 1992;51:526–33. [PubMed]