PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of iaiPermissionsJournals.ASM.orgJournalIAI ArticleJournal InfoAuthorsReviewers
 
Infect Immun. 2013 August; 81(8): 2768–2776.
PMCID: PMC3719587

Leptospiral Outer Membrane Protein LipL41 Is Not Essential for Acute Leptospirosis but Requires a Small Chaperone Protein, Lep, for Stable Expression

S. R. Blanke, Editor

Abstract

Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.

INTRODUCTION

Pathogenic species of Leptospira are important and emerging zoonotic pathogens. Animal hosts of Leptospira species include rodents, domestic animals, and livestock (1). The bacterium is transmitted to humans through water contaminated with animal urine or through direct contact with infected animals. The disease manifests as systemic infections differing in severity, ranging from fever and flu-like symptoms to renal and liver failure, pulmonary hemorrhages, and death (24).

Knowledge of leptospiral pathogenesis is limited, but the development of a transposon (Tn) mutagenesis system has enabled the identification of factors essential for virulence (5), seven of which have been described: Loa22 (6), HemO (7), lipopolysaccharide (LPS) (8), motility (9, 10), ClpB (11), KatE (12), and Mce (13). Further characterization of transposon mutants will advance the understanding of leptospiral pathogenesis and biology.

The outer membrane has been a major focus for the identification of leptospiral virulence-associated factors. Outer membrane components are at the forefront of the interface between the pathogen and the host cell and thus can play a key role in adhesion and initial infection. Surface exposure, expression in vivo, and conservation across pathogenic species or serovars are all features indicative of potential virulence factors (14).

LipL41 is the third most abundant protein on the surfaces of pathogenic leptospires (15). It is highly conserved in pathogenic leptospiral serovars but is absent in saprophytes (1619). LipL41 is surface exposed and is recognized by convalescent-phase human and hamster sera, indicating that it is expressed during leptospiral infection (15, 2023). Leptospires also express LipL41 during the colonization of, and excretion from, the rat kidney (24). LipL41, along with the transmembrane protein OmpL1, forms part of a very small subset of protein antigens that have been reported to elicit protection against acute infection in hamsters (25). Interestingly, however, LipL41 alone does not confer protection (25, 26).

To date, the role of LipL41 in pathogenesis has not been evaluated. The function of LipL41 is likewise currently unknown; it has been suggested that this protein binds hemin (27), but no definitive proof of such a function has been reported.

The lipL41 gene is located adjacent to a small gene, la0615, which we have designated lep (for LipL41 expression partner). In this study, we have characterized two transposon mutants, P52 (lipL41 mutant) and M874 (lep mutant). We have identified Lep as a LipL41-binding protein that is essential for efficient expression of LipL41, and we have evaluated the role of both proteins in leptospiral pathogenesis.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Escherichia coli and Leptospira interrogans strains and the construction of transposon mutants have been described previously (5, 28). Transposon mutants were generated in Leptospira interrogans serovar Manilae strain L495 and in Leptospira interrogans serovar Pomona strain LT993 (L523). LT993 was obtained from the WHO/FAO/OIE Collaborating Centre for Reference and Research on Leptospirosis, Brisbane, Australia. For this study, two transposon mutants with an intergenic insertion of TnSC189, P19 (Tn inserted at base 430860, based on the numbering of the serovar Lai genome [19]) and M777 (29), were used as controls for transposon mutants P52 (lipL41 mutant) and M874 (lep mutant), respectively. The locations of TnSC189 in the mutants were determined by direct sequencing of genomic DNA as described previously (30). Strain M777, with an intergenic insertion of TnSC189, has been shown previously to retain virulence (28). All L. interrogans strains were grown in Ellinghausen-McCullough-Johnson-Harris (EMJH) medium (Becton Dickinson) at 30°C.

Generation of an M874 complementation construct.

lep was amplified with primers BAP6108 (AAAAGGGCCCATGAAAAGCGGG CGAAAGT) (forward) and BAP6109 (AAAAGTCGACTCTATTTGTAGATTTTGAGAATA) (reverse), digested with restriction enzymes ApaI and KpnI, and then inserted into TnSC189 containing a spectinomycin resistance cassette (TnSC189 Spcr). The Borrelia burgdorferi flgB promoter (flgBp) was inserted upstream of lep. flgBp was amplified with primers BAP5066 (TTAGGTACCATAATACCCGAGCTTCAAG) (forward) and BAP6107 (AAAGGGCCCATGGAAACCTCCCTCATT) (reverse) and was digested with restriction enzymes KpnI and ApaI. The lep complementation construct was introduced into M874 by conjugation with E. coli, as described previously (31).

Genome sequencing.

The whole-genome shotgun (WGS) read data for L. interrogans serovar Manilae mutant strain M874 were determined as part of the diversity of the genome of Leptospira interrogans ST34 and are available under DDBJ Sequence Read Archive accession no. SRX101346. Similarly, the read data for the L. interrogans serovar Manilae parent strain, L495, are available under accession no. SRX101343. These read data were determined on an Illumina Genome Analyzer IIx instrument using a paired-end protocol at the J. Craig Venter Institute (JCVI, USA). Read mapping and de novo assembly analysis, used in the comparative analysis to examine genomic differences between these strains, were performed using SHRiMP2 (32) and Velvet (33), respectively.

SDS-PAGE and immunoblotting.

Leptospires were grown to 8 × 108 cells/ml, washed twice in phosphate-buffered saline, pH 7.2 (PBS), and resuspended in sample buffer, consisting of 50 mM Tris-HCl (pH 6.8), 14.4 mM β-mercaptoethanol, 2% sodium dodecyl sulfate (SDS), and 0.1% bromophenol blue in 20% glycerol, at a concentration of 1 × 109 cells/ml before serial 4-fold dilution. The whole-cell lysates (WCLs) and protein samples were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting using standard methods (34). The immunoblots were blocked with 5% skim milk in PBS containing 0.05% Tween 20 (PBS-T) and were probed with a rabbit antiserum against LipL41 (22) (diluted 1:2,000) or Lep (diluted 1:500) in PBS-T. The membranes were washed 3 times in PBS-T, probed with horseradish peroxidase-conjugated anti-rabbit IgG (diluted 1:5,000) (Millipore), developed using Amersham ECL Western blotting detection reagents (GE Healthcare), and exposed either to X-ray film or to a LAS-3000 chemiluminescent imager (Fujifilm). To quantify the reduction in LipL41 expression observed in M874 (lep mutant), the densities of the LipL41 bands in M874 and M777 WCLs from three biological replicates were compared using ImageJ (35). To confirm equal loading of the M777 and M874 WCLs, dilutions were also analyzed by Western blotting with an antiserum against LipL32 (diluted 1:4,000). Statistical analysis was performed using Student's t test.

Protein expression and purification.

The LipL41 protein, minus the signal sequence (first 30 amino acids), was expressed in multiple cloning site 1 of pETDuet-1 with an N-terminal His tag. lipL41 was amplified by PCR using primers BAP6247 (AAAAGGATCCGTTCCCGAAAGATAAAGAAGG) (forward) and BAP6248 (AAAAGTCGACTTTTGCGTTGCTTTCATCAAC) (reverse) and was inserted into pETDuet-1 after digestion with BamHI and SalI. The Lep protein, minus the first 25 amino acids, was expressed from multiple cloning site 2 of pETDuet-1 with a C-terminal S tag. lep was amplified by PCR with primers BAP6249 (AAAAAGATCTCAAAACTCCGAACGAAGAAGAA) (forward) and BAP6250 (AAAACTCGAGTTTTAATTCTTCTTTTCCGAATT) (reverse) and was inserted into pETDuet-1 after digestion with BglII and XhoI. The Loa22 protein, minus the signal sequence (first 23 amino acids), was expressed from multiple cloning site 1 of pETDuet-1 with an N-terminal His tag. loa22 was amplified by PCR with primers BAP6591 (CTCTGCGAATTCAGCTGAAAAAAAAGAGGAATCC) (forward) and BAP6523 (TTCTAGGTCGACTTATTGTTGTGGTGCGGAAGT) (reverse) and was inserted into pETDuet-1 after digestion with EcoRI and SalI.

Four truncations of LipL41 were generated and were expressed from multiple cloning site 1 of pETDuet-1. The PCR product of the N-terminal truncation construct LipL41Δ1-110 was amplified using primers BAP7247 (AAAAGAATTCTGGAATCACTAAAAATAGAGC) (forward) and BAP6248 (reverse). The PCR product of the N-terminal truncation construct LipL41Δ1-217 was amplified using primers BAP7249 (AAAAGAATTCTGTAGGGAATTTAGAATGTCCT) (forward) and BAP6248 (reverse). The PCR product of the C-terminal truncation construct LipL41Δ218-355 was amplified using primers BAP6247 (forward) and BAP7248 (AAAAGTCGACGCTATTGAAAATTTTCGCAGG) (reverse). The PCR products of the truncation constructs were inserted into pETDuet-1 after digestion with EcoRI and SalI. The C-terminal truncation construct LipL41Δ287-355 was generated by using an internal HindIII restriction site to remove the region corresponding to the last 68 amino acids of LipL41.

To generate an antiserum against Lep, the lep gene was amplified by PCR using primer BAP5772 (AAAACCATGGGAAAAACTCCGAACGAAGAA) (forward) and primer BAP5525, containing a (His)6 tag (TAATCATATGCTAGTGGTGATGATGATGATGTTTTGATTCTTCTTTTCCGAA) (reverse), and was inserted into pET15b after digestion with NcoI and NdeI.

All protein expression constructs were expressed in E. coli BL21-CodonPlus, induced with 1 to 5 mM isopropyl-β-d-thiogalactopyranoside (IPTG). Cells were disrupted by sonication, and proteins were purified from the soluble fraction. (His)6-LipL41 and (His)6-Loa22 were purified with Talon cobalt resin (Clontech Laboratories) according to the manufacturer's instructions. S-tagged Lep was purified with S protein agarose (Novagen, Merck) according to the manufacturer's instructions. (His)6-tagged Lep was insoluble and was purified under denaturing conditions by utilizing Talon cobalt resin (Clontech Laboratories) according to the manufacturer's instructions, except that 8 M urea was used in place of 6 M guanidine-HCl. After purification, (His)6-tagged Lep was dialyzed against 1 M urea. To generate an anti-Lep antiserum, two female New Zealand White rabbits were immunized intradermally with 100 μg recombinant (His)6-tagged Lep in 1 M urea with 20% Alhydrogel (Sigma-Aldrich). A second and a third immunization were given after 2 and 4 weeks, and the rabbits were bled 2 weeks later. Rabbit experiments were approved by the Monash University Animal Ethics Committee.

Cross-linking of leptospiral cells.

Leptospiral cells were grown to a density of 5 × 108/ml, pelleted at 4,000 × g, and washed twice with PBS, pH 8. The cells were cross-linked with 5 mM dimethyl 3,3′-dithiobispropionimidate dihydrochloride (DTBP) (Sigma-Aldrich) and were incubated on ice for 1 to 2 h. The cross-linking reaction was quenched by the addition of Tris-HCl, pH 8, at a final concentration of 50 mM and incubation on ice for a further 10 min. The cells were disrupted by sonication and were analyzed by SDS-PAGE and immunoblotting. To reduce the background, prior to anti-Lep immunoblotting, the cross-linked samples and whole-cell lysates were separated by SDS-PAGE, and the gel region corresponding to 64 kDa was then excised from each sample, separated by SDS-PAGE, and probed with the IgG fraction of anti-Lep antiserum, purified by using protein A-Sepharose beads (GE Healthcare) according to the manufacturer's instructions.

Triton X-114 extraction.

Outer membrane proteins were extracted with Triton X-114 as described previously (36). After extraction, the detergent and aqueous phases were precipitated with methanol-chloroform.

Hemin binding.

Hemin binding experiments were performed using hemin agarose (type I; Sigma-Aldrich). Wild-type and lipL41 mutant P52 cells were grown to mid-log phase; 109 cells were pelleted and were washed twice with Tris-buffered saline, pH 7.4. The cells were resuspended in 25 mM Tris-HCl and 100 mM NaCl, pH 7.4, and were disrupted by sonication; insoluble material was removed by centrifugation at 13,000 × g for 5 min. One hundred microliters of hemin agarose was washed twice with 25 mM Tris-HCl and 100 mM NaCl, pH 7.4, and the beads were pelleted at 800 × g for 5 to 10 min before incubation with the leptospiral cell lysates at 37°C for 1 to 2 h with gentle agitation. The unbound proteins were removed, and the hemin agarose was washed six times as described above. The hemin agarose was resuspended in sample buffer, boiled for 10 min, and analyzed by SDS-PAGE and anti-LipL41 immunoblotting.

Spectral analysis of the hemin-LipL41 complex was performed as described previously (30). Briefly, 24 μM bovine hemin (Sigma) was added to 0.7 μM purified recombinant LipL41 in 5-μl increments. The absorbance spectrum was measured after each addition of hemin.

Infection of hamsters.

L. interrogans serovar Manilae strains L495 and M874 and L. interrogans serovar Pomona strains L523 and P52 were tested for virulence in hamsters. Groups of 10 golden hamsters of either sex, aged 4 to 6 weeks, were infected intraperitoneally with 103 leptospires of serovar Manilae strains (50% infective dose [ID50], <10 leptospires) or 104 leptospires of serovar Pomona strains (ID50, <100 leptospires) in 100 μl EMJH medium and were monitored for 21 days. Moribund animals were euthanized in accordance with animal ethics requirements. Lung hemorrhages were assessed, and kidney tissue was collected postmortem for culture. Hamster experiments were approved by the Khon Kaen University Animal Ethics Committee.

RESULTS

Bioinformatic analysis of lipL41 and lep.

LipL41 (355 amino acids) is highly conserved within pathogenic Leptospira spp.; full-length LipL41 proteins share ≥96% identity within L. interrogans and Leptospira borgpetersenii serovars. LipL41 bears little sequence similarity to other leptospiral proteins; the closest match is LA2873 (L. interrogans serovar Lai), a putative fructose-1,6-bisphosphatase (23% identity for residues 179 to 340). Outside of the genus Leptospira, LipL41 shows very little similarity to other prokaryotic proteins; the closest is the hypothetical protein Lepil_1901 from Leptonema illini, a member of the family Leptospiraceae, which shares 29% identity with LipL41 over the length of the protein (residues 3 to 327).

Within the leptospiral genome, lipL41 is located in a putative operon 28 bp upstream of the small gene lep (333 bp) (Fig. 1). Both the lep gene and its genomic arrangement with lipL41 are highly conserved among L. interrogans and L. borgpetersenii serovars (≥87% identity) (16, 17, 19). Within the genus Leptospira, the closest homolog to Lep is another hypothetical protein, LA2279 (L. interrogans serovar Lai), sharing 29% identity (residues 36 to 93 of Lep). Like LipL41, Lep shows little similarity to other bacterial proteins. The most similar protein outside the genus Leptospira is a hypothetical protein from the marine myxobacterium Plesiocystis pacifica; 27% identity is observed from residue 13 to 91 of Lep. No conserved domains have been identified for either LipL41 or Lep, and their functions remain unclear. Neither Lep nor LipL41 is present in the saprophyte Leptospira biflexa; thus, these proteins are unique to pathogenic leptospiral species. Bioinformatic analysis was performed using the protein basic local alignment search tool (BLAST) (National Center for Biotechnology Information; http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Fig 1
Locations of transposon insertions in L. interrogans mutants of serovar (sv.) Pomona (A) and serovar Manilae (B) strains. Vertical arrowheads indicate TnSC189 insertions. TnSC189 was inserted 42 bp into the open reading frame of lipL41 (1,068 bp) in P52 ...

Inactivation of lep results in reduced LipL41 protein expression.

This study utilized two L. interrogans transposon mutants, P52 (serovar Pomona lipL41 mutant) and M874 (serovar Manilae lep mutant). These mutants were generated by random transposon mutagenesis as described previously (5, 28). TnSC189 was inserted 42 nucleotides (nt) (corresponding to 14 amino acid residues of 355) from the start of lipL41 in P52, while in M874, TnSC189 was inserted 232 nt (77 amino acid residues of 110) from the start of lep (Fig. 1). In cellular morphology, growth, and motility, P52 and M874 were indistinguishable from the corresponding wild-type strains.

The disruption of lipL41 and lep by transposon insertion is unlikely to affect the transcription of genes surrounding the lipL41-lep locus, since neighboring genes are transcribed in the direction opposite to that of the locus. The hypothetical gene la0617 is located 115 bp upstream of lipL41, and a putative ftsZ gene (la0612) is located 476 bp downstream of lep.

Protein immunoblot analysis was performed with anti-LipL41 and anti-Lep sera on whole-cell lysates (WCLs) of P52 and M874, and their respective wild-type controls, to confirm the phenotype of each mutant (Fig. 2A). P52 did not express LipL41 or Lep, while M874 did not express Lep. The lep mutant M874 showed reduced expression of LipL41. To quantify the level of LipL41 expression in M874, leptospiral WCLs were serially diluted and were analyzed by immunoblotting with an anti-LipL41 serum (Fig. 2B). Anti-LipL32 immunoblots served as loading controls (Fig. 2B). The lep mutant M874 showed significantly reduced LipL41 expression, producing only 12% of the amount of LipL41 found in the wild type (Fig. 2B). Total-membrane fractions of wild-type and M874 cells were also analyzed by 2-dimensional gel electrophoresis twice, in biological duplicate. No differentially expressed proteins other than LipL41 were observed; immunoblot analysis confirmed the reduction in LipL41 expression (data not shown).

Fig 2
(A) Immunoblot analysis of a wild-type (WT) serovar Pomona strain, P52, a WT serovar Manilae strain, and M874 with anti-LipL41 and anti-Lep antisera. The positions of molecular mass markers (in kilodaltons) are indicated on the left. (B) Quantification ...

The proximity of lipL41 and lep on the leptospiral genome suggested that they are cotranscribed; hence, the insertion of TnSC189 in lep may affect the transcription of lipL41 by destabilizing the lipL41 transcript. The levels of lipL41 and lep transcripts were analyzed by semiquantitative reverse transcriptase PCR (RT-PCR). lipL41-, lep-, and gene junction-specific products were amplified from M874 and wild-type cDNA by PCR. There was no difference in the amounts of lipL41-, lep-, and gene junction-specific products (data not shown), indicating that lipL41 and lep are cotranscribed and that the reduction in LipL41 expression in M874 was not due to reduced transcription of lipL41.

Attempted complementation and genome sequence of the lep mutant.

Numerous attempts were made to complement M874 with TnSC189 containing a spectinomycin resistance cassette and full-length lep. Spectinomycin-resistant transformants with an insertion of TnSC189 containing lep were obtained; however, no expression of Lep could be detected by immunoblotting with an anti-Lep antiserum. Therefore, the restoration of LipL41 protein expression could not be evaluated.

In the absence of complementation, the genome sequence of M874 was compared to that of the serovar Manilae parent strain. Paired-end WGS read data comprising 628.7 million bases, representing ~140-fold coverage of the genome, for the parent strain (L495) and 834 million bases, representing ~180-fold coverage of the genome, for M874 were used to examine differences between the genomes of these strains. The disruption of lep by TnSC189 was confirmed in M874, but comparative analysis of the genome sequence revealed no additional genomic rearrangements, deletions, or point mutations, confirming that the reduction of LipL41 expression was due to inactivation of the lep gene.

LipL41 and Lep proteins interact.

The reduced LipL41 levels in the lep mutant and the cotranscription of lipL41 and lep indicated a potential for interaction between the two proteins; Lep may act as a chaperone conferring stability on LipL41, which would be degraded in the absence of Lep. To assess protein-protein interactions, recombinant LipL41 and Lep were generated. LipL41 was initially expressed in pET28a with an N-terminal His tag but was found to be largely insoluble (data not shown). The expression of recombinant proteins with a chaperone or binding partner can increase their solubility (37, 38). Accordingly, lipL41 and lep were cloned into the pETDuet-1 expression vector, which allows the coexpression of proteins from independent plasmid sites with different protein tags. When LipL41 (with an N-terminal His tag) was coexpressed from pETDuet-1 with Lep (with a C-terminal S tag), LipL41 exhibited increased solubility, suggesting a stabilizing interaction between the two proteins.

Metal affinity resin was used to purify (His)6-LipL41 that was coexpressed with Lep. Purification of (His)6-LipL41 resulted in the copurification of S-tagged Lep (Fig. 3). In the reverse experiment, S-tagged Lep was purified on the S protein resin, and (His)6-LipL41 was found to copurify (Fig. 3). The copurification of LipL41 and Lep via the two different tags provides evidence that LipL41 and Lep interact. As a negative control for the copurification of LipL41 and Lep, Loa22, a leptospiral OmpA-like protein (6), was expressed from pETDuet-1 together with Lep. When coexpressed with S-tagged Lep, (His)6-Loa22 was purified using metal affinity resin and did not copurify with Lep. Likewise, no copurification was observed between (His)6-Loa22 and S-tagged Lep when the S protein resin was utilized (Fig. 3). The absence of copurification for Loa22 and Lep confirmed the specificity of the protein-protein interaction between LipL41 and Lep.

Fig 3
Copurification of LipL41 and Lep by affinity resin purification. Coexpressed recombinant proteins LipL41 and Lep, or Loa22 and Lep, were purified by metal affinity resin (His tag resin) or S protein resin (S tag resin) and were separated on a Coomassie ...

To further characterize the interaction between LipL41 and Lep, protein cross-linking was performed on leptospiral cells. The cross-linker dimethyl 3,3′-dithiobispropionimidate (DTBP), a membrane-permeant imidoester, was used to cross-link proteins that are associated or are in close proximity to each other in P52 (lipL41 mutant), M874 (lep mutant), and the wild-type strains. Immunoblotting with an anti-LipL41 serum (Fig. 4A) showed that in the wild-type strains, the monomeric form of LipL41 migrated at approximately 38 kDa. A LipL41-containing band, at an abundance lower than that of monomeric LipL41, was also detected, at approximately 64 kDa, in wild-type strains treated with the cross-linker DTBP (Fig. 4A); it was not present in the absence of cross-linking. This complex was not detected in P52 (lipL41 mutant). The 64-kDa LipL41 complex band was likewise not detected in M874 (lep mutant), in agreement with the notion that the complex contains Lep. To confirm the presence of Lep in the 64-kDa LipL41 complex, anti-Lep immunoblotting was performed. Non-cross-linked and cross-linked WCLs of the wild-type serovar Manilae strain and the lep mutant M874 were separated by SDS-PAGE. The region on the gel corresponding to 64 kDa was excised, separated by SDS-PAGE a second time, and probed with an anti-Lep antiserum (Fig. 4B.) A 64-kDa band was observed only in the wild-type cells treated with the cross-linker DTBP, confirming the presence of Lep in the LipL41 complex. The size of the LipL41-Lep complex, at 64 kDa, corresponds to 1 LipL41 protein unit (approximately 38 kDa) and 2 Lep protein units (approximately 13 kDa each).

Fig 4
Cross-linking of L. interrogans probed with an anti-LipL41 or anti-Lep antiserum. (A) A serovar Pomona wild-type (WT) strain, P52 (lipL41 mutant), a serovar Manilae WT strain, and M874 (lep mutant) were treated with the cross-linker DTBP (dimethyl 3,3′-dithiobispropionimidate), ...

Lep interacts predominantly with the N terminus of LipL41.

To identify the region of LipL41 involved in binding to Lep, four truncation constructs of LipL41 were coexpressed with Lep in pETDuet-1 (Fig. 5). The LipL41 truncation constructs were His tagged and were purified with metal affinity resin. LipL41 mutants deficient in the N-terminal region (LipL41Δ1-110 and LipL41Δ1-217) showed levels of Lep copurification lower than those of full-length LipL41 and the fragments in which the N terminus was present (LipL41Δ218-355 and LipL41Δ287-355) (Fig. 6A).

Fig 5
Schematic representation of recombinant LipL41 and LipL41 truncation constructs expressed in pETDuet-1 with Lep. (A) Full-length LipL41 (expressing amino acids 30 to 355); (B) LipL41Δ1-110 (amino acids 111 to 355); (C) LipL41Δ1-217 (amino ...
Fig 6
(A) Coomassie blue-stained 12% SDS-polyacrylamide gel of soluble lysates (S) and purified fractions (P) of recombinant LipL41 and LipL41 truncation constructs coexpressed with S-tagged Lep. Purifications were performed with metal affinity resin. (B) Molar ...

The amounts of LipL41 and Lep purified were quantified and standardized for the molecular masses of the purified proteins (Fig. 6B). Two Lep molecules were purified for each full-length LipL41 molecule; this ratio is consistent with the 64-kDa complex observed in leptospiral cells after cross-linking. This purification ratio was also observed for LipL41 truncation constructs LipL41Δ218-355 and LipL41Δ287-355. The copurification of Lep was not completely abolished by the removal of the N-terminal region of LipL41; however, the ratio of Lep units to LipL41 units purified was significantly reduced, to 0.5 (Fig. 6B).

Lep does not affect the trafficking of LipL41 to the outer membrane.

The LipL41-binding properties of Lep highlight it as a LipL41 chaperone; however, the specific role of Lep is unclear. The cellular location of Lep and its involvement in the trafficking of LipL41 to the outer membrane were therefore evaluated. The proportions of LipL41 in the outer membrane and cytoplasm were analyzed. Quadruplicate wild-type and M874 cultures were treated with Triton X-114, and the cytoplasmic and outer membrane fractions (aqueous and detergent-extracted fractions, respectively) were analyzed by immunoblotting. LipL41 localized to the detergent fraction, as reported previously (22), a common feature of leptospiral outer membrane lipoproteins. The proportion of LipL41 in each fraction was the same for the wild type and the lep mutant (approximately 50% in each fraction) (Fig. 7A), indicating that the loss of Lep in M874 did not affect the trafficking of LipL41 to the outer membrane. Analysis of Triton X-114-extracted cell fractions with an anti-Lep serum showed that Lep was found exclusively in the cytoplasmic fractions of wild-type cells (Fig. 7B). The quality of the Triton X-114 cell fractionation was verified by immunoblotting with antisera against LipL21 (an outer membrane protein) and LipL31 (a cytoplasmic membrane protein); the results indicated a clean separation, with no cross-contamination of fractions (Fig. 7B).

Fig 7
Analysis of the subcellular distribution of LipL41 in the wild type and M874 (lep mutant) by Triton X-114 extraction. (A) Wild-type and M874 cytoplasmic fractions (C) and detergent fractions (TX-114) were analyzed by anti-LipL41 immunoblotting, and the ...

Does LipL41 bind hemin?

The function of LipL41 remains unknown. A previous study using hemin-linked agarose beads proposed that LipL41 had hemin-binding properties (27); however, this proposal was presented with limited evidence. We investigated the hemin-binding capacity of LipL41 with hemin agarose, using a method similar to that described by Asuthkar et al. (27). Cell lysates of the wild-type serovar Pomona strain and lipL41 mutant P52 were incubated either with hemin agarose or with agarose beads without hemin. LipL41 immunoblot analysis revealed that LipL41 bound agarose in the absence of hemin. We also performed spectral analysis of the binding between recombinant LipL41 and hemin, as described by Murray et al. (30), and again found no evidence of hemin binding by LipL41. Our finding that LipL41 has an affinity for agarose beads (data not shown) could explain the observations made by Asuthkar et al. (27).

LipL41 and Lep are not essential for virulence in hamsters.

LipL41 is the third most abundant lipoprotein unique to pathogenic leptospires and has a number of features that suggest a role in leptospiral pathogenesis. Until now there has been no evaluation of the role that LipL41 plays in acute leptospirosis. P52 (lipL41 mutant) and M874 (lep mutant) were evaluated for virulence in the hamster model of acute disease. Groups of 10 hamsters were inoculated intraperitoneally with either P52, M874, the wild-type serovar Pomona strain, or the wild-type serovar Manilae strain. The serovar Manilae intergenic mutant M777 was not included in this experiment but has been shown previously to be virulent (28). P52 and M874 were not attenuated: all animals succumbed to infection (Table 1). Macroscopic lung hemorrhages occurred with similar frequencies and severities in animals infected with mutant or wild-type leptospires. Leptospires were cultured from the kidneys of 8 of 10 hamsters infected with P52 and from the kidneys of all hamsters infected with M874. The genotypes of reisolated mutants were confirmed by PCR, thus confirming the retention of the transposon.

Table 1
Survival of hamsters infected with control or mutant strains of L. interrogans serovar Manilae or L. interrogans serovar Pomona

DISCUSSION

The pathogenesis of leptospirosis remains poorly understood, and until the development of mutagenesis systems, it was extremely difficult to study the factors essential for this zoonotic pathogen to cause disease (14). LipL41 is a major outer membrane lipoprotein, and its high abundance, surface exposure, and exclusivity to pathogenic Leptospira species have made it an attractive putative virulence factor. In this study, we have characterized two L. interrogans transposon mutants: P52 (serovar Pomona), a lipL41 mutant, and M874 (serovar Manilae), a lep mutant. We found that lipL41 and lep are cotranscribed and that, as a consequence, P52 does not express either protein. Interestingly, we found that disruption of lep resulted in reduced LipL41 protein expression but did not affect the transcription of lipL41.

We were unable to complement M874. Insertion of TnSC189 containing full-length lep was achieved; however, no expression of the protein was detected by immunoblotting. We were therefore unable to assess the restoration of LipL41 expression. Importantly, however, genome sequence analysis of M874 confirmed the disruption of lep by TnSC189 and found no other mutations to account for the reduction in LipL41 protein expression in M874.

We hypothesized that the LipL41 and Lep proteins interact, with Lep acting as a chaperone to stabilize LipL41 expression. We have presented several lines of evidence to support this hypothesis: (i) coexpression of Lep with LipL41 increased the solubility of LipL41; (ii) copurification of the proteins by affinity purification revealed that LipL41 and Lep interact; (iii) cross-linking experiments showed that LipL41 and Lep form a complex of approximately 64 kDa, corresponding to the mass of 1 LipL41 molecule and 2 Lep molecules. The interaction between LipL41 and Lep appears to be transient due to the low abundance of the complex, consistent with the finding that Lep is restricted to the cytoplasm whereas LipL41 is trafficked to the outer membrane. The same ratio of 2 Lep units to 1 LipL41 unit was also observed during the copurification of recombinant proteins.

Many characterized bacterial chaperones have discrete regions for binding within the substrate (3941); we observed a similar phenomenon for binding between LipL41 and Lep, where removal of the N terminus of LipL41 resulted in reduced interaction with Lep. The loss of Lep in M874 did not impact on the trafficking of LipL41 to the outer membrane; cell fractionation revealed that wild-type and M874 (lep mutant) cells had similar proportions of LipL41 both in the cytoplasmic fractions and in the outer membrane fractions.

Another common feature of characterized chaperones is their requirement for stable expression of the substrate, such as the chaperone SseA of Salmonella spp., which is required for stable expression of SseB and SseD (42). This was also observed for Lep and LipL41. Lep exhibits many features that are typical of characterized chaperones, including cytoplasmic location, small size (<15 kDa), and the property of being functionally active as a dimer (4245). All these features of Lep are consistent with its role as a cytoplasmic chaperone stabilizing LipL41 expression.

The observed increase in LipL41 solubility with the coexpression of Lep is indeed interesting. Leptospira species have a large number of membrane lipoproteins, which, when expressed in E. coli, can be insoluble. The coexpression of other leptospiral membrane proteins with Lep, or with other chaperones, may help to increase the solubility and facilitate the purification and characterization of these membrane proteins.

This study showed, for the first time, that the major outer membrane protein LipL41 is not required for leptospiral virulence in the hamster model of acute leptospirosis. All the animals succumbed to infection, and lung hemorrhages were observed at the same frequency and severity in animals infected with mutant or wild-type leptospires. lipL41 and lep mutant leptospires also colonized the kidney. The lep mutant also retained the ability to colonize mouse kidneys in a carrier model of leptospirosis (R. A. Marcsisin, T. Bartpho, D. M. Bulach, A. Srikram, R. W. Sermswan, B. Adler, and G. L. Murray, submitted for publication). This result for M874 is in contrast with the findings of a previous preliminary study using small numbers of animals, which suggested that the lep (LA0615) transposon mutant might be attenuated in hamsters (28). The results presented in the present study clearly show that Lep is not required for acute leptospirosis in the hamster model.

It is surprising that the lipL41 mutant retained virulence; many features of LipL41 and its expression in vivo strongly suggested involvement in pathogenesis. However, similar results have been reported for LipL32 and LigB; both proteins bear all the hallmarks of virulence factors, including outer membrane location, expression in vivo, conservation in pathogenic leptospires, and demonstrated binding to host proteins in vitro, but like LipL41, both LipL32 and LigB are not required for virulence in hamsters or for the colonization of rat kidneys (29, 46). All of these results are consistent with a high degree of functional redundancy in leptospiral virulence genes (1).

The function of LipL41 remains unknown. A previous study proposed that LipL41 had hemin-binding properties (27); however, we observed no hemin binding by LipL41. Although we have shown that LipL41 is not essential for acute leptospirosis, it may still play an important role in pathogenic Leptospira species. One study has found downregulation of LipL41 during interaction with macrophage-derived cells (47). However, other studies have shown that LipL41 is expressed during acute infection, colonization of kidneys, and excretion from host kidneys (24, 48). The characterization of leptospiral mutants is fundamental to the understanding of the virulence factors of this global pathogen. It enables better understanding of leptospiral pathogenesis and allows leptospiral research to move toward more-efficient prevention and treatment strategies. We have shown in this study that the major outer membrane lipoprotein LipL41 is not essential for virulence. The function of this protein is still undetermined, but the expression of LipL41 is reliant on a small, novel chaperone protein, Lep.

ACKNOWLEDGMENTS

We thank Kunkun Zhang for technical assistance.

This work was supported by the Australian Research Council, the National Health and Medical Research Council, and the French Ministry of Research (ANR-08-MIE-018). Anti-LipL41 antiserum was a generous gift from D. A. Haake.

Footnotes

Published ahead of print 20 May 2013

REFERENCES

1. Adler B, de la Peña Moctezuma A. 2010. Leptospira and leptospirosis. Vet. Microbiol. 140:287–296. [PubMed]
2. Faine S, Adler B, Bolin C, Perolat P. 1999. Leptospira and leptospirosis, 2nd ed MediSci, Melbourne, Australia.
3. Ko AI, Goarant C, Picardeau M. 2009. Leptospira: the dawn of the molecular genetics era for an emerging zoonotic pathogen. Nat. Rev. Microbiol. 7:736–747. [PMC free article] [PubMed]
4. McBride AJA, Athanazio DA, Reis MG, Ko AI. 2005. Leptospirosis. Curr. Opin. Infect. Dis. 18:376–386. [PubMed]
5. Bourhy P, Louvel H, Saint Girons I, Picardeau M. 2005. Random insertional mutagenesis of Leptospira interrogans, the agent of leptospirosis, using a mariner transposon. J. Bacteriol. 187:3255–3258. [PMC free article] [PubMed]
6. Ristow P, Bourhy P, da Cruz McBride FW, Figueira CP, Huerre M, Ave P, Girons IS, Ko AI, Picardeau M. 2007. The OmpA-like protein Loa22 is essential for leptospiral virulence. PLoS Pathog. 3(7):e97. doi: 10.1371/journal.ppat.0030097. [PMC free article] [PubMed] [Cross Ref]
7. Murray GL, Srikram A, Henry R, Puapairoj A, Sermswan RW, Adler B. 2009. Leptospira interrogans requires heme oxygenase for disease pathogenesis. Microbes Infect. 11:311–314. [PubMed]
8. Murray GL, Srikram A, Henry R, Hartskeerl RA, Sermswan RW, Adler B. 2010. Mutations affecting Leptospira interrogans lipopolysaccharide attenuate virulence. Mol. Microbiol. 78:701–709. [PubMed]
9. Lambert A, Picardeau M, Haake DA, Sermswan RW, Srikram A, Adler B, Murray GL. 2012. FlaA proteins in Leptospira interrogans are essential for motility and virulence but are not required for formation of the flagellum sheath. Infect. Immun. 80:2019–2025. [PMC free article] [PubMed]
10. Liao S, Sun A, Ojcius DM, Wu S, Zhao J, Yan J. 2009. Inactivation of the fliY gene encoding a flagellar motor switch protein attenuates mobility and virulence of Leptospira interrogans strain Lai. BMC Microbiol. 9:253. doi: 10.1186/1471-2180-9-253. [PMC free article] [PubMed] [Cross Ref]
11. Lourdault K, Cerqueira GM, Wunder EA, Picardeau M. 2011. Inactivation of clpB in the pathogen Leptospira interrogans reduces virulence and resistance to stress conditions. Infect. Immun. 79:3711–3717. [PMC free article] [PubMed]
12. Eshghi A, Lourdault K, Murray GL, Bartpho T, Sermswan RW, Picardeau M, Adler B, Snarr B, Zuerner RL, Cameron CE. 2012. Leptospira interrogans catalase is required for resistance to H2O2 and for virulence. Infect. Immun. 80:3892–3899. [PMC free article] [PubMed]
13. Zhang L, Zhang C, Ojcius DM, Sun D, Zhao J, Lin X, Li L, Li L, Yan J. 2012. The mammalian cell entry (Mce) protein of pathogenic Leptospira species is responsible for RGD motif-dependent infection of cells and animals. Mol. Microbiol. 83:1006–1023. [PubMed]
14. Adler B, Lo M, Seemann T, Murray GL. 2011. Pathogenesis of leptospirosis: the influence of genomics. Vet. Microbiol. 153:73–81. [PubMed]
15. Cullen PA, Xu XY, Matsunaga J, Sanchez Y, Ko AI, Haake DA, Adler B. 2005. Surfaceome of Leptospira spp. Infect. Immun. 73:4853–4863. [PMC free article] [PubMed]
16. Bulach DM, Zuerner RL, Wilson P, Seemann T, McGrath A, Cullen PA, Davis J, Johnson M, Kuczek E, Alt DP, Peterson-Burch B, Coppel RL, Rood JI, Davies JK, Adler B. 2006. Genome reduction in Leptospira borgpetersenii reflects limited transmission potential. Proc. Natl. Acad. Sci. U. S. A. 103:14560–14565. [PubMed]
17. Nascimento ALTO, Ko AI, Martins EAL, Monteiro-Vitorello CB, Ho PL, Haake DA, Verjovski-Almeida S, Hartskeerl RA, Marques MV, Oliveira MC, Menck CFM, Leite LCC, Carrer H, Coutinho LL, Degrave WM, Dellagostin OA, El-Dorry H, Ferro ES, Ferro MIT, Furlan LR, Gamberini M, Giglioti EA, Góes-Neto A, Goldman GH, Goldman MHS, Harakava R, Jerônimo SMB, Junqueira-de-Azevedo ILM, Kimura ET, Kuramae EE, Lemos EGM, Lemos MVF, Marino CL, Nunes LR, de Oliveira RC, Pereira GG, Reis MS, Schriefer A, Siqueira WJ, Sommer P, Tsai SM, Simpson AJG, Ferro JA, Camargo LEA, Kitajima JP, Setubal JC, Van Sluys MA. 2004. Comparative genomics of two Leptospira interrogans serovars reveals novel insights into physiology and pathogenesis. J. Bacteriol. 186:2164–2172. [PMC free article] [PubMed]
18. Picardeau M, Bulach DM, Bouchier C, Zuerner RL, Zidane N, Wilson PJ, Creno S, Kuczek ES, Bommezzadri S, Davis JC, McGrath A, Johnson MJ, Boursaux-Eude C, Seemann T, Rouy Z, Coppel RL, Rood JI, Lajus A, Davies JK, Médigue C, Adler B. 2008. Genome sequence of the saprophyte Leptospira biflexa provides insights into the evolution of Leptospira and the pathogenesis of leptospirosis. PLoS One 3(2):e1607. doi: 10.1371/journal.pone.0001607. [PMC free article] [PubMed] [Cross Ref]
19. Ren SX, Fu G, Jiang XG, Zeng R, Miao YG, Xu H, Zhang YX, Xiong H, Lu G, Lu LF, Jiang HQ, Jia J, Tu YF, Jiang JX, Gu WY, Zhang YQ, Cai Z, Sheng HH, Yin HF, Zhang Y, Zhu GF, Wan M, Huang HL, Qian Z, Wang SY, Ma W, Yao ZJ, Shen Y, Qiang BQ, Xia QC, Guo XK, Danchin A, Saint Girons I, Somerville RL, Wen YM, Shi MH, Chen Z, Xu JG, Zhao GP. 2003. Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing. Nature 422:888–893. [PubMed]
20. Guerreiro H, Croda J, Flannery B, Mazel M, Matsunaga J, Reis MG, Levett PN, Ko AI, Haake DA. 2001. Leptospiral proteins recognized during the humoral immune response to leptospirosis in humans. Infect. Immun. 69:4958–4968. [PMC free article] [PubMed]
21. Haake DA, Walker EM, Blanco DR, Bolin CA, Miller JN, Lovett MA. 1991. Changes in the surface of Leptospira interrogans serovar Grippotyphosa during in vitro cultivation. Infect. Immun. 59:1131–1140. [PMC free article] [PubMed]
22. Shang ES, Summers TA, Haake DA. 1996. Molecular cloning and sequence analysis of the gene encoding LipL41, a surface-exposed lipoprotein of pathogenic Leptospira species. Infect. Immun. 64:2322–2330. [PMC free article] [PubMed]
23. Srikram A, Zhang K, Bartpho T, Lo M, Hoke DE, Sermswan RW, Adler B, Murray GL. 2011. Cross-protective immunity against leptospirosis elicited by a live, attenuated lipopolysaccharide mutant. J. Infect. Dis. 203:870–879. [PMC free article] [PubMed]
24. Monahan AM, Callanan JJ, Nally JE. 2008. Proteomic analysis of Leptospira interrogans shed in urine of chronically infected hosts. Infect. Immun. 76:4952–4958. [PMC free article] [PubMed]
25. Haake DA, Mazel MK, McCoy AM, Milward F, Chao G, Matsunaga J, Wagar EA. 1999. Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic immunoprotection. Infect. Immun. 67:6572–6582. [PMC free article] [PubMed]
26. Murray GL, Lo M, Bulach DM, Srikram A, Seemann T, Quinsey NS, Sermswan RW, Allen A, Adler B. 2013. Evaluation of 238 antigens of Leptospira borgpetersenii serovar Hardjo for protection against kidney colonisation. Vaccine 31:495–499. [PubMed]
27. Asuthkar S, Velineni S, Stadlmann J, Altmann F, Sritharan M. 2007. Expression and characterization of an iron-regulated hemin-binding protein, HbpA, from Leptospira interrogans serovar Lai. Infect. Immun. 75:4582–4591. [PMC free article] [PubMed]
28. Murray GL, Morel V, Cerqueira GM, Croda J, Srikram A, Henry R, Ko AI, Dellagostin OA, Bulach DM, Sermswan RW, Adler B, Picardeau M. 2009. Genome-wide transposon mutagenesis in pathogenic Leptospira species. Infect. Immun. 77:810–816. [PMC free article] [PubMed]
29. Murray GL, Srikram A, Hoke DE, Wunder EA, Henry R, Lo M, Zhang KK, Sermswan RW, Ko AI, Adler B. 2009. Major surface protein LipL32 is not required for either acute or chronic infection with Leptospira interrogans. Infect. Immun. 77:952–958. [PMC free article] [PubMed]
30. Murray GL, Ellis KM, Lo M, Adler B. 2008. Leptospira interrogans requires a functional heme oxygenase to scavenge iron from hemoglobin. Microbes Infect. 10:791–797. [PubMed]
31. Picardeau M. 2008. Conjugative transfer between Escherichia coli and Leptospira spp. as a new genetic tool. Appl. Environ. Microbiol. 74:319–322. [PMC free article] [PubMed]
32. David M, Dzamba M, Lister D, Ilie L, Brudno M. 2011. SHRiMP2: sensitive yet practical short read mapping. Bioinformatics 27:1011–1012. [PubMed]
33. Zerbino DR, Birney E. 2008. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 18:821–829. [PubMed]
34. Cullen PA, Haake DA, Bulach DM, Zuerner RL, Adler B. 2003. LipL21 is a novel surface-exposed lipoprotein of pathogenic Leptospira species. Infect. Immun. 71:2414–2421. [PMC free article] [PubMed]
35. Abrámoff MD, Magalhães PJ, Ram SJ. 2004. Image processing with ImageJ. Biophotonics Int. 11:36–41.
36. Haake DA, Chao G, Zuerner RL, Barnett JK, Barnett D, Mazel M, Matsunaga J, Levett PN, Bolin CA. 2000. The leptospiral major outer membrane protein LipL32 is a lipoprotein expressed during mammalian infection. Infect. Immun. 68:2276–2285. [PMC free article] [PubMed]
37. Kyratsous CA, Silverstein SJ, DeLong CR, Panagiotidis CA. 2009. Chaperone-fusion expression plasmid vectors for improved solubility of recombinant proteins in Escherichia coli. Gene 440:9–15. [PMC free article] [PubMed]
38. Tundup S, Akhter Y, Thiagarajan D, Hasnain SE. 2006. Clusters of PE and PPE genes of Mycobacterium tuberculosis are organized in operons: evidence that PE Rv2431c is co-transcribed with PPE Rv2430c and their gene products interact with each other. FEBS Lett. 580:1285–1293. [PubMed]
39. Parsot C, Hamiaux C, Page AL. 2003. The various and varying roles of specific chaperones in type III secretion systems. Curr. Opin. Microbiol. 6:7–14. [PubMed]
40. Wang B, Mo ZL, Mao YX, Zou YX, Xiao P, Li J, Yang JY, Ye XH, Leung KY, Zhang PJ. 2009. Investigation of EscA as a chaperone for the Edwardsiella tarda type III secretion system putative translocon component EseC. Microbiology 155:1260–1271. [PubMed]
41. Zurawski DV, Stein MA. 2004. The SPI2-encoded SseA chaperone has discrete domains required for SseB stabilization and export, and binds within the C-terminus of SseB and SseD. Microbiology 150:2055–2068. [PubMed]
42. Zurawski DV, Stein MA. 2003. SseA acts as the chaperone for the SseB component of the Salmonella pathogenicity island 2 translocon. Mol. Microbiol. 47:1341–1351. [PubMed]
43. Akeda Y, Kodama T, Saito K, Iida T, Oishi K, Honda T. 2011. Identification of the Vibrio parahaemolyticus type III secretion system 2-associated chaperone VocC for the T3SS2-specific effector VopC. FEMS Microbiol. Lett. 324:156–164. [PubMed]
44. Ghosh P. 2004. Process of protein transport by the type III secretion system. Microbiol. Mol. Biol. Rev. 68:771–795. [PMC free article] [PubMed]
45. Page AL, Parsot C. 2002. Chaperones of the type III secretion pathway: Jacks of all trades. Mol. Microbiol. 46:1–11. [PubMed]
46. Croda J, Figueira CP, Wunder EA, Santos CS, Reis MG, Ko AI, Picardeau M. 2008. Targeted mutagenesis in pathogenic Leptospira species: disruption of the ligB gene does not affect virulence in animal models of leptospirosis. Infect. Immun. 76:5826–5833. [PMC free article] [PubMed]
47. Xue F, Dong H, Wu J, Wu Z, Hu W, Sun A, Troxell B, Yang XF, Yan J. 2010. Transcriptional responses of Leptospira interrogans to host innate immunity: significant changes in metabolism, oxygen tolerance, and outer membrane. PLoS Negl. Trop. Dis. 4(10):e857. doi: 10.1371/journal.pntd.0000857. [PMC free article] [PubMed] [Cross Ref]
48. Nally JE, Whitelegge JP, Bassilian S, Blanco DR, Lovett MA. 2007. Characterization of the outer membrane proteome of Leptospira interrogans expressed during acute lethal infection. Infect. Immun. 75:766–773. [PMC free article] [PubMed]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)