PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jbcThe Journal of Biological Chemistry
 
J Biol Chem. 2013 June 28; 288(26): 18811–18824.
Published online 2013 May 9. doi:  10.1074/jbc.M113.464644
PMCID: PMC3696657

Transcriptional Regulation by the Wilms Tumor Protein, Wt1, Suggests a Role of the Metalloproteinase Adamts16 in Murine Genitourinary Development*

Abstract

ADAMTS16 (a disintegrin and metalloproteinase with thrombospondin motifs) is a secreted mammalian metalloproteinase with unknown function. We report here that murine Adamts16 is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. Adamts16 mRNA levels were significantly reduced upon transfection of embryonic murine kidney explants with Wt1 antisense vivo-morpholinos. Antisense knockdown of Adamts16 inhibited branching morphogenesis in kidney organ cultures. Adamts16 was detected by in situ mRNA hybridization and/or immunohistochemistry also in embryonic gonads and in spermatids and granulosa cells of adult testes and ovaries, respectively. Silencing of Wt1 by transfection with antisense vivo-morpholinos significantly increased Adamts16 mRNA in cultured embryonic XY gonads (11.5 and 12.5 days postconception), and reduced Adamts16 transcripts in XX gonads (12.5 and 13.5 days postconception). Three predicted Wt1 consensus motifs could be identified in the promoter and the 5′-untranslated region of the murine Adamts16 gene. Binding of Wt1 protein to these elements was verified by EMSA and ChIP. A firefly luciferase reporter gene under control of the Adamts16 promoter was activated ~8-fold by transient co-transfection of human granulosa cells with a Wt1 expression construct. Gradual shortening of the 5′-flanking sequence successively reduced and eventually abrogated Adamts16 promoter activation by Wt1. These findings demonstrate that Wt1 differentially regulates the Adamts16 gene in XX and XY embryonic gonads. It is suggested that Adamts16 acts immediately downstream of Wt1 during murine urogenital development. We propose that Adamts16 is involved in branching morphogenesis of the kidneys in mice.

Keywords: ADAM ADAMTS, Development, Gene Expression, Gene Regulation, Gene Silencing, Gene Transcription, Transcription Factors, Transcription Target Genes, Tumor Suppressor Gene

Introduction

ADAMTS16 (a disintegrin and metalloproteinase with thrombospondin motifs) designates a growing family of secreted metalloproteinases in mammals and invertebrates (1, 2). Their structural and functional properties are related to, although distinct from, the ADAM3 group of proteinases. ADAMTSs have several functional domains, including a pro-domain, an N-terminal catalytic domain, a disintegrin domain, and a C-terminal ancillary domain. The last one contains several thrombospondin-like repeats and is crucial for specific interactions with substrates (2, 3). ADAMTS proteins lack the transmembrane domain present in ADAMs (4). To date, 20 ADAMTS family members have been identified, whose multiple functions include proteolytic degradation of proteoglycans, collagen processing, inhibition of angiogenesis, and the control of blood coagulation (1, 2, 58). Additional roles of ADAMTS molecules may extend to embryonic development, inflammatory responses, and fertility (913). Mutations in ADAMTS genes can give rise to human disorders. For example, the Ehlers-Danlos syndrome type VIIC (MIM 2254109) is a recessive connective tissue disease, which results from mutations in the gene for the procollagen N-proteinase, ADAMTS2 (14). Mutations in the gene encoding ADAMTS13, which cleaves the von Willebrand factor, can lead to inherited thrombotic thrombocytopenia (15).

ADAMTS16 is a recently cloned family member, whose physiological functions are currently unknown. A full-length recombinant protein was capable of cleaving the proteinase inhibitor α2-macroglobulin in vitro (16). ADAMTS16 mRNA was initially detected in human fetal lung and kidney but also in adult brain and ovary (1). The cell types that express ADAMTS16 in these tissues have not yet been identified. Later studies demonstrated ADAMTS16 transcripts in human cartilage (17) and pancreas (16). Expression of ADAMTS16 in cartilage and synovium was increased in patients suffering from osteoarthritis compared with the tissues of healthy individuals (17). Variants of the ADAMTS16 gene were recently linked to inherited arterial hypertension (18), and high levels of ADAMTS16 could be detected in a significant portion of esophageal squamous cell carcinomas (19).

Although a role of ADAMTS16 in development and disease is beginning to emerge, very little is known about the molecular mechanisms regulating its tissue-specific expression. ADAMTS16 mRNA levels were increased in differentiated luteinizing human granulosa cells following treatment with follicle-stimulating hormone (FSH) and forskolin (16). These observations suggested that ADAMTS16 expression is activated via the cyclic AMP pathway (16). The promoter of the ADAMTS16 gene is GC-rich and contains several consensus motifs for Egr1 and Sp1 (20). Both transcription factors were found to activate ADAMTS16 promoter constructs in transient co-transfection experiments (20). However, it is not known whether Egr1 and Sp1 are physiological regulators of ADAMTS16 in vivo; nor have other trans-acting factors been ascertained thus far.

In view of this background, our study was aimed at providing novel insights into the gene regulatory mechanisms underlying the characteristic expression pattern of ADAMTS16. For this purpose, we analyzed the cellular distribution of Adamts16 protein in various organs of mice and rats. Furthermore, we sought to determine transcription factors that are involved in the tissue-specific control of Adamts16. We report here that Adamts16 is a transcriptional downstream target gene of the Wilms tumor protein, Wt1. Importantly, knockdown of Adamts16 by transfection with antisense vivo-morpholinos impaired branching morphogenesis in murine embryonic kidney cultures. These findings suggest a role for Adamts16 in the development of the genitourinary system in mice.

EXPERIMENTAL PROCEDURES

Plasmids

A 3250-base pair (bp) DNA sequence (from −3000 bp to +250 bp relative to the transcription start site) of the murine Adamts16 gene (NCBI accession number NM_172053) was cloned by PCR, utilizing a bacterial artificial chromosome (imaGenes, Berlin, Germany, clone RPCIB731I01114Q) as template. The amplified product was ligated into the SacI and HindIII restriction sites of the pGL3basic reporter plasmid (Promega, Mannheim, Germany). Adamts16 promoter constructs with gradually shortened sequences were generated by PCR. The PCR primers that were used for DNA amplification are listed in Table 1. All constructs were analyzed by automated DNA sequencing (Eurofins MWG, Ebersberg, Germany). The expression construct for the murine Wt1(−KTS) protein was kindly provided by Dr. Daniel Haber (Massachusetts General Hospital, Boston, MA).

TABLE 1
PCR primers

Animals

A heterozygous (Wt1+/−) mouse breeding pair (C57/BL6 (B6) strain) was obtained from the Jackson Laboratory (Bar Harbor, ME) and mated in the local animal facility in compliance with the current laws. The morning of vaginal plugs was considered as 0.5 days postconception (d.p.c.).

Cell Culture

COV434 human granulosa cells (catalog no. 07071909, HPACC) were maintained in DMEM nutrient (PAA Laboratories, Pasching, Austria) supplemented with 10% FCS (Biochrom KG, Berlin, Germany) and l-glutamine (PAA Laboratories). The UB27 and UD28 cell lines, which contain the murine Wt1(−KTS) and Wt1(+KTS) protein isoforms, respectively, regulated through a tetracycline-dependent promoter, were the gift of Dr. Christoph Englert. UB27 and UD28 cells and the murine mesonephros-derived M15 cell line (21) were cultured as described elsewhere (22, 23).

Organ Culture Experiments

Kidneys, gonads, and hearts were excised from embryos of timed pregnant mice (C57BL6 strain). The matched organs of each embryo were cultured separately on two polyethylene terephthalate Transwell® filters with 0.4-μm pore size (Corning, Inc.). This procedure allowed for a pairwise comparison between cultured explants from a single donor that had been transfected with either Wt1 antisense or mismatch vivo-morpholinos (see below). The Transwell® filters were kept in DMEM nutrient with stable l-glutamine (PAA Laboratories) supplemented with 10% FCS (Biochrom KG), 100 IU/ml penicillin (PAA Laboratories), and 100 μg/ml streptomycin (PAA Laboratories) at 37 °C in a humidified atmosphere with 5% CO2. Embryonic hearts were kept in 96-well plates for 5 days to allow outgrowth of epicardium-derived cells. The epicardial origin of outgrown cells was proven by their characteristic cobblestone-like appearance and robust expression of Wt1 (data not shown). Prior to morpholino treatment of the cells, the hearts were removed from the tissue culture plates. In vitro cultured organs and epicardial cell monolayers were incubated for 72 h with either Wt1 antisense (CAGGTCCCGCACGTCGGAACCCAT) or mismatch (CAGCTCCGGCACCTCGCAACCGATG) vivo-morpholinos at 10 μm each (Gene Tools, Philomath, OR) (24). Whole cell lysates and total RNA were prepared from cultured organs and cells as described below. Sex determination of the embryos was performed by PCR amplification of the Y-chromosomal gene Kdm5d from DNA using the following primers: mKdm5d-F, CTGAAGCTTTTGGCTTTGAG; mKdm5d-R, CCACTGCCAAATTCTTTGG (25).

In order to study branching morphogenesis, the kidneys were isolated from mouse embryos at embryonic day 11.5 (Taylor stage 20) and cultured in vitro as described above. The organ rudiments were transfected either with Adamts16 antisense (5′-CGCAGCACAACCTCGGGACTCCATG-3′) or mismatch vivo-morpholino (5′-CGGAGCAGAACGTCGGCACTCGATG-3′) at 10 μm each (Gene Tools) (24). After 72 h, the explants were formalin-fixed and double-stained with FITC-conjugated anti-pancytokeratin (diluted 1:100, Sigma-Aldrich) and anti-Wt1 antibody (C19, diluted 1:50, Santa Cruz Biotechnology, Santa Cruz, CA). Cy3-coupled donkey anti-rabbit IgG (diluted 1:100, Jackson ImmunoResearch, Hamburg, Germany) was used for the detection of bound Wt1 antibody. Photographs were taken, and branching of the pancytokeratin-stained ureter was analyzed using ImageJ software (National Institutes of Health, Bethesda, MD).

Cell Transfections and Reporter Gene Assays

COV434 cells were expanded to ~40% confluence in 24-well tissue culture plates. Firefly luciferase constructs, 200 ng each, harboring gradually shortened sequences of the murine Adamts16 promoter and the 5′-UTR were transiently transfected along with a Wt1(−KTS) expression construct (200 ng) and a Renilla luciferase plasmid (100 ng), using the Fugene6® reagent (4 μl/well) as described in the supplier's manual (Roche Applied Science). As negative controls, transfections were performed with the pGL3basic reporter plasmid (Promega) and the empty pCB6+ expression vector, respectively. After 24 h, the transfected cells were lysed in Reporter Lysis Buffer (Promega), and luciferase activities were measured in a luminometer (Microlite TLX1, MGM Instruments, Hamden, CT) as described (26, 27). Data are presented as firefly luciferase activities normalized to Renilla luciferase activities.

Transfection of siRNA

M15 cells were grown to ~60% confluence in 6-well culture plates. A pool of four different siRNAs (50 pmol/well, Dharmacon, Thermo Fisher Scientific) targeting the murine Wt1 gene (ON-TARGETplus, SMARTpool siRNA, L-040686-01-0005, NM_144783) were transfected using the DharmaFECT 1 reagent (Dharmacon) according to the manufacturer's protocol (22). Four different non-targeting siRNAs (siGENOME non-targeting siRNA pool 2, Dharmacon) were used as negative control. The cells were harvested for mRNA and protein analysis 2 days after siRNA transfection.

Reverse Transcription (RT) Real-time PCR

Total RNA was isolated from primary tissues and cells with the RNeasy Micro Kit (Qiagen, Hilden, Germany) and from permanent cell lines with the TRIzol LS reagent (Invitrogen). First-strand cDNA synthesis was carried out using oligo(dT) primers and SuperScriptTM II reverse transcriptase (Invitrogen). Real-time PCR amplification was performed with the SYBR® Green PCR Master Mix and the StepOnePlusTM system (Invitrogen) as described in detail elsewhere (28). The PCR primers for real-time RT-PCR are listed in Table 1. Relative transcript levels were obtained by subtracting the threshold cycle (Ct) value of the housekeeping gene (β-actin or Gapdh) from the corresponding Ct value of the gene of interest. Differences in mRNA levels were calculated according to the expression 2ΔΔCt.

SDS-PAGE and Immunoblotting

Cells and tissues were lysed in Laemmli buffer (50 mm Tris-HCl, pH 6.8, 4 m urea, 1% (w/v) SDS, 0.001% (w/v) bromphenol blue, 7.5 mm DTT), disrupted by ultrasonication (Labsonic U, B. Braun, Melsungen, Germany), and subsequently heated to 95 °C for 5 min. Protein concentrations were measured spectrophotometrically according to the method of Warburg and Christian (29). Twenty μg of protein were loaded per lane and separated on a 10% denaturing polyacrylamide gel. The proteins were transferred onto a polyvinylidene difluoride membrane (GE Healthcare) with the use of a semidry blotting apparatus (Bio-Rad). Nonspecific binding activity was reduced by incubating the membrane for 60 min at room temperature in 5% nonfat milk (Roth, Karlsruhe, Germany) in TBS, 0.1% Tween 20. Incubation with Wt1 antibody (C19, catalog no. sc-192, diluted 1:400, Santa Cruz Biotechnology, Inc.) in 2.5% nonfat milk (Roth) in TBS/Tween was performed overnight at 4 °C. A polyclonal antibody raised in rabbit (diluted 1:5,000, ab45048, Abcam (Cambridge, UK)) was used for immunoblotting of Adamts16. After washing with TBS/Tween, the antibodies were detected with a peroxidase-coupled IgG (donkey anti-rabbit IgG-HRP, catalog no. sc-2313, diluted 1:20,000, Santa Cruz Biotechnology, Inc.), and the reaction products were visualized with Western LightningTM Plus ECL reagents (PerkinElmer Life Sciences) following the user's manual. Equal protein loading was assessed with antibodies against actin (anti-actin clone C4, catalog no. MAB1501R, diluted 1:6,000, Millipore (Darmstadt, Germany)) and Gapdh (anti-Gapdh, catalog no. MAB374, diluted 1:300, Millipore), respectively, after stripping of the membranes with 1:5 diluted 1 n NaOH in distilled water for 10 min.

Electrophoretic Mobility Shift Assay (EMSA)

Non-radioactive EMSAs were performed with purified GST-tagged recombinant Wt1 proteins (30) and double-stranded oligonucleotides (Table 2), which were selected on the basis of predicted Wt1 binding sites in the promoter of the murine Adamts16 gene. All oligonucleotides were 3′-digoxigenin (DIG)-labeled using the DIG Oligonucleotide 3′-End Labeling Kit (Roche Applied Science). Likewise, double-stranded oligonucleotides with mutations of the Wt1 binding motifs (Table 2) were DIG-labeled. For competition experiments, we used an oligonucleotide with a previously identified Wt1 binding site in the promoter of the Ntrk2 gene (31). The binding reactions were carried out at room temperature for 1 h using 0.75 μg of recombinant Wt1 protein and 1 pmol of labeled oligonucleotide in 1× reaction buffer (10 mm Tris-HCl, pH 7.5, 50 mm KCl, 50 mm NaCl, 1 mm MgCl2, 1 mm EDTA, 5 mm DTT, 5 mm phenylmethylsulfonyl fluoride, PMSF). DNA-bound proteins were separated on a non-denaturing 6% polyacrylamide gel and transferred with a semidry blotting system (Bio-Rad) on a positively charged nylon membrane (Roche Applied Science). After UV cross-linking (Stratalinker® UV cross-linker, Stratagene) and treatment with blocking reagent (Roche Applied Science), the membrane was incubated with anti-DIG-alkaline phosphatase antibody (catalog no. 11093274910, diluted 1:10.000, Roche Applied Science). Proteins were detected by nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate staining (Roche Applied Science).

TABLE 2
Oligonucleotides used for gel shift experiments (mutated nucleotides are underlined)

Chromatin Immunoprecipitation (ChIP) Assays

UB27 and UD28 cells were kept for 72 h in the presence or absence of tetracycline (1 μg/ml) to either inhibit or stimulate expression of Wt1(−KTS) and Wt1(+KTS) proteins, respectively. ChIP assays were performed with ~4 × 106 cells. After fixation with 4% formaldehyde, the cells were disrupted by ultrasonication (Labsonic U, B. Braun) and centrifuged. The supernatants were diluted in immunoprecipitation buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-HCl, pH 8.1) and precleared for 1 h at 4 °C with DNA-blocked protein G-agarose (Millipore). The following antibodies and control sera were used (0.6 μg each) for overnight incubation at 4 °C: normal rabbit IgG (catalog no. sc-2027, Santa Cruz Biotechnology, Inc.), rabbit polyclonal anti-Wt1 antibody (catalog no. sc-192, Santa Cruz Biotechnology, Inc.). Immunoprecipitates were bound to DNA-blocked protein G-agarose (Millipore) during a 1-h incubation at 4 °C. Following several washing steps, the DNA was eluted in 1% SDS, 0.1 m NaHCO3, extracted in 25:24:1 phenol/chloroform/isoamyl alcohol according to the supplier's instructions (Invitrogen), and subsequently precipitated in 100% ethanol. This protocol was also applied to M15 cells, which were used at ~1 × 106 cells for ChIP assays. Immunoprecipitation with an anti-histone H3 antibody (catalog no. 07-690, Millipore) was performed as a control. Immunoprecipitated DNA was amplified by quantitative PCR using primer pairs that flanked the identified Wt1 binding sites in the murine Adamts16 promoter (Table 1).

Immunohistochemistry

Immunofluorescent stainings were performed on mouse and rat tissues as described in detail elsewhere (26, 31). Briefly, embryos between 13.5 and 16.5 d.p.c. and tissues from adult animals were frozen in tissue-Tek O.C.T. compound (Sakura Finetek, Zoeterwoude, Netherlands) and sectioned using a cryostat. Frozen sections (8 μm) were treated with acetone/methanol (3:2) for 10 min at −20 °C and subsequently blocked for 5 min at room temperature in serum-free DakoCytomation protein block (catalog no. X0909, Dako, Hamburg, Germany). Single immunostainings for Wt1 and Adamts16 were performed on mouse tissue using the following primary antibodies diluted in ready-to-use antibody diluent (Zymed Laboratories Inc.. Berlin, Germany): Adamts16 rabbit (diluted 1:500, ab45048, Abcam), Adamts16 rabbit (diluted 1:50, catalog no. sc-50490, Santa Cruz Biotechnology, Inc.), anti-Wilms tumor protein Alexa Fluor® 488 (diluted 1:200, catalog no. ab140484, Abcam). Double immunostainings were performed on rat tissue using the above mentioned Adamst16 antibodies in combination with the Wt1 monoclonal mouse F6 antibody (diluted 1:600, catalog no. MAB4234, Millipore). For visualization of the bound primary antibodies, Cy3-AffiniPure donkey anti-rabbit IgG (catalog no. 711-165-152, diluted 1:200, Jackson ImmunoResearch) and Alexa Fluor® 488-AffiniPure donkey anti-mouse IgG (diluted 1:50, catalog no. 715-545-151, Jackson ImmunoResearch) were used. The cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). Pictures of double stainings were taken with a digital camera connected to a confocal microscope (Leica DM 2500, Leica Microsystems, Wetzlar, Germany) utilizing LAS AF Lite software (Leica Microsystems). For pictures of single stainings, an epifluorescence microscope (Axiovert100, Carl Zeiss, Berlin, Germany) connected to a digital camera (Spot RT Slider, Diagnostic Instruments, Sterling Heights, MI) with the Spot software (Universal Imaging Corp., Marlow Buckinghamshire, UK) was used.

In Situ mRNA Hybridization

In situ hybridization for Adamts16 mRNA was performed according to the protocol of Stricker et al. (32). Briefly, tissues were cryosectioned and fixed in freshly prepared paraformaldehyde (4% in PBS). Following acetylation with acetanhydride, the sections were prehybridized for 4 h at room temperature in hybridization buffer (5× SSC, 50% formamide). Hybridization was carried out overnight at 68 °C with digoxigenin-labeled murine Adamts16 sense and antisense riboprobes, respectively. After washing with formamide (1× SSC, 50% formamide), the slides were treated with RNase for 30 min at 37 °C, and additional washing steps with SSC buffers (2× SSC, 0.2× SSC) were performed. The tissue sections were blocked for 1.5 h at room temperature (1% blocking solution in maleic acid buffer) and then incubated overnight at 4 °C with an alkaline phosphatase-conjugated anti-digoxigenin antibody. Bound antibody was visualized with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate reagent.

Statistics

Student's paired t test and ANOVA with Tukey's post hoc test were performed as indicated to reveal statistical significances. p values less than 0.05 were considered significant.

RESULTS

Adamts16 and Wt1 Proteins Are Expressed in Gonads and Kidneys

Although Adamts16 mRNA has been detected by RT-PCR in several organs, including kidneys and gonads (1), very little is known about the protein localization in these tissues. We used specific polyclonal rabbit antibodies (ab45048 (Abcam) and sc-50490 (Santa Cruz Biotechnology, Inc.)) to visualize Adamts16-expressing cells in the genitourinary system of mice and rats. Adamts16 and Wt1 proteins were readily visible in XY and XX embryonic gonads (Fig. 1, A (a–c) and B (a–c)) although more distinct in embryonic testes (Fig. 1A, a–c). According to previous reports (33, 34), Wt1 protein was present in developing and mature Sertoli cells (Fig. 1A, a and d–f), whereas immunhistochemistry (Fig. 1A, b–f) and in situ hybridization (Fig. 1C, a, c, and d) detected Adamts16 mainly in germ cells of embryonic and adult testes. Expression of Adamts16 was predominant in elongated spermatids of adult testes (Fig. 1A, d–f), which was confirmed by in situ hybridization (Fig. 1C, c and d). Both proteins were also detected in differentiated follicular granulosa cells and in mesothelial cells covering the surface of mature ovaries (Fig. 1B, d–f). In situ hybridization confirmed Adamts16 transcripts in follicular granulosa cells of the ovaries (Fig. 1C, e and f). Adamts16 was demonstrated by immunostaining also in the developing glomeruli of embryonic kidneys (Fig. 2a), which are known sites of Wt1 expression (33, 34) (Fig. 2b). Co-expression of both proteins in glomerular progenitors was revealed by double immunolabeling with two different Adamts16 antibodies (Fig. 2, c and d, with corresponding single stainings in e–h). No fluorescence signal was obtained when normal sera instead of primary antibodies were used (Fig. 2, i and k). Adamts16 in murine embryonic kidneys (14 d.p.c.) was confirmed by in situ mRNA hybridization with a specific antisense riboprobe (Fig. 2l). No hybridization signal was obtained with the use of an Adamts16 sense probe (Fig. 2m).

FIGURE 1.
Expression of Adamts16 and Wt1 in embryonic and adult gonads. A, specific antibodies against Wt1 (green) and Adamts16 (red) were used to detect both proteins in the XY gonads of embryonic (14 d.p.c.) mice (a–c) and adult rats (d–f). Note ...
FIGURE 2.
Expression of Adamts16 and Wt1 in embryonic kidneys. Specific antibodies against Wt1 (green) and Adamts16 (red) were used to detect both proteins in the kidneys of embryonic (16 d.p.c.) rats. Double immunofluorescent labeling indicates co-expression of ...

Expression of Adamts16 in Developing Gonads and Kidneys Is Wt1-dependent

Co-expression of Adamts16 and Wt1 suggests a regulatory link between both proteins in different cell types of the genitourinary system. We therefore addressed the question of whether Wt1 is indeed necessary for normal expression of Adamts16 in embryonic gonads and kidneys. To this end, Adamts16 transcripts were measured in isolated gonadal ridges of wild-type (Wt1+/+), heterozygous (Wt1+/−), and Wt1-deficient (Wt1−/−) murine embryos at 13 d.p.c. Compared with the gonads of normal (Wt1+/+) embryos, Adamts16 mRNA levels were significantly lower (p < 0.05, ANOVA) in the developing gonadal ridges of Wt1−/− mice (Fig. 3A). Later developmental stages could not be studied due to the embryonic lethality of Wt1-deficient mice (35). These observations suggest that Adamts16 mRNA levels in the developing gonads depend, at least to some extent, on Wt1. However, it is also conceivable that reduced Adamts16 transcripts were simply due to an arrest of gonad formation with subsequent apoptosis of the undifferentiated tissue in the absence of Wt1.

FIGURE 3.
Adamts16 mRNA in embryonic gonads. A, Adamts16 transcripts in freshly isolated gonadal ridges of wild-type (Wt1+/+), heterozygous (Wt1+/−), and Wt1-deficient (Wt1−/−) murine embryos at 13 d.p.c. Adamts16 mRNA levels were measured ...

To distinguish between these possibilities, we established in vitro cultures of embryonic gonads. For this purpose, the gonads were excised from normal murine embryos at 11.5, 12.5, and 13.5 d.p.c., respectively, and grown in a culture medium supplemented with either Wt1 antisense or mismatch vivo-morpholinos. After 72 h, total RNA was isolated from the explants, and Adamts16 transcripts were measured by quantitative RT-PCR (Fig. 3, B–D). Down-regulation of Wt1 in response to Wt1 antisense morpholino treatment, which was assessed by immunoblot analysis, had differential effects on Adamts16 mRNA levels in female and male gonads (Fig. 3, C and D). Thus, Adamts16 transcripts were significantly (p < 0.05, Student's paired t test) increased by knockdown of Wt1 in XY gonads obtained from mouse embryos at 11.5 and 12.5 d.p.c. but not at 13.5 d.p.c. (Fig. 3C). In contrast, Wt1 silencing significantly (p < 0.05, Student's paired t test) reduced Adamts16 mRNA levels in XX gonads at 12.5 and 13.5 d.p.c. but had no significant effect on embryonic day 11.5 (Fig. 3D). These findings suggest that Wt1 inhibits Adamts16 expression in XY gonads at early developmental stages (11.5 and 12.5 d.p.c.) and activates Adamts16 expression in XX gonads at later points in time (12.5 and 13.5 d.p.c.). Consistently, Adamts16 mRNA levels were increased in both XX and XY gonads treated with mismatch morpholinos, at 13.5 d.p.c. compared with earlier developmental stages (p < 0.05, ANOVA) (Fig. 3B). Based on differences in Ct values, Adamts16 mRNA levels were at least 10-fold higher in male and female gonads from 13.5 d.p.c. versus 11.5 d.p.c. embryos (Fig. 3B). At all developmental stages analyzed, Adamts16 transcripts were 2–3-fold higher in XX compared with XY gonads (p < 0.05, Student's paired t test) (Fig. 3B). Similar results were obtained when β-actin mRNA was used as a housekeeping gene for normalization (data not shown).

Because Wt1−/− mouse embryos lack kidneys (35), they are not useful for analyzing Wt1 downstream signaling pathways during nephrogenesis. To overcome this problem, we established in vitro organ cultures of normal embryonic kidneys, in which we knocked down Wt1 expression by antisense treatment (24). Densitometric analysis of the immunoblots using ImageJ software (National Institutes of Health) revealed a reduction of band intensities in response to Wt1 antisense treatment by 57 ± 10% (p < 0.05, Student's paired t test, n = 6). Embryonic kidney explants treated with Wt1 antisense vivo-morpholinos had significantly (p < 0.05, Student's paired t test) lower Adamts16 mRNA levels than the corresponding mismatch controls (Fig. 4A). These findings indicate that normal expression of Adamts16 in embryonic kidneys and gonads requires Wt1.

FIGURE 4.
Regulation and function of Adamt16 in embryonic murine kidneys. A, Adamts16 mRNA is reduced in kidney organ culture upon antisense inhibition of Wt1. Kidneys were removed from 13 d.p.c. murine embryos and incubated in vitro for 72 h with mismatch and ...

Knockdown of Adamts16 Inhibits Branching Morphogenesis in Kidney Organ Culture

To explore the potential role of Adamts16 in kidney development, we transfected embryonic renal organ cultures (Fig. 4B) with either Adamts16 antisense or mismatch vivo-morpholinos. Knockdown efficiency was determined by immunoblot analysis of Adamts16 using the same antibody (ab45048, Abcam) as for the immunostainings. This antibody produced a signal of the predicted molecular mass (~135 kDa) of the Adamts16 protein (Fig. 4C). Importantly, the protein band was clearly diminished in kidney organ cultures that had been treated with antisense vivo-morpholinos against Adamts16, indicating specificity of the antibody used (Fig. 4C). In vitro knockdown of Adamts16 resulted in an abnormal kidney morphology that was assessed by phase-contrast microscopy (Fig. 4B, a and b) and by immunostaining of the ureteric bud and the metanephric mesenchyme, respectively (Fig. 4B, c–f). Microscopic analysis of the immunolabeled whole-mount preparations revealed a significant (p < 0.05, Student's paired t test) reduction in the number of ureteric bud branching points upon Adamts16 knockdown (Fig. 4, B (g and h) and C). These observations suggest a functional role of Adamts16 in branching morphogenesis of murine kidneys.

Wt1 and Adamts16 Expression Levels Are Correlated in Permanent Cell Lines and Primary Epicardial Cells

Next we examined whether Wt1 and Adamts16 levels are associated in permanent cells derived from embryonic kidneys. M15 cells were originally established from the mesonephros of mice transgenically expressing the large T protein of polyoma virus under control of the early viral enhancer (21). The cells were transfected with a pool of four different siRNAs to inhibit Wt1 expression. Control experiments were performed by treatment with pooled non-targeting siRNAs. Silencing of Wt1 significantly (p < 0.001, Student's paired t test) reduced Adamts16 mRNA levels in M15 cells, indicating that Adamts16 expression in these cells depends on Wt1 (Fig. 5A). To analyze the expression of Adamts16 and Wt1 in primary cells, we established cultures from epicardial progenitor cells. The epicardium is a mesothelial tissue on the outer heart surface, which expresses Wt1 from the early developmental stages on throughout adulthood (34). We also detected Adamts16 protein by immunohistochemistry in the developing epicardium of murine embryos (data not shown). Transfection of primary epicardial cells with Wt1 antisense vivo-morpholinos strongly reduced Wt1 protein levels, and this effect was associated with a significant (p < 0.05, Student's paired t test) reduction of Adamts16 mRNA (Fig. 5B).

FIGURE 5.
Adamts16 transcripts and Wt1 protein in cell lines and primary epicardial cells. A, Adamts16 mRNA levels in murine mesonephros-derived M15 cells transfected with a pool of four different siRNAs targeting the Wt1 gene. Control experiments were performed ...

Importantly, the Wt1 mRNA is subject to alternative splicing. The usage of an alternative splice donor site at the end of exon 9 leads to the insertion of an additional 3 amino acids, lysine, threonine, and serine (KTS), between zinc fingers 3 and 4 of the Wt1 protein (36). Structural and functional data demonstrate that Wt1(−KTS) proteins, which lack the 3 amino acids, act as transcription factors (37, 38). Compared with the Wt1(−KTS) isoforms, Wt1 proteins with the KTS insertion exhibit increased RNA binding affinity and play a presumed role in mRNA processing (39, 40). The human osteosarcoma-derived cell lines UB27 and UD28 express the Wt1(−KTS) and Wt1(+KTS) proteins, respectively, under control of a tetracycline-dependent promoter (23). A consistent rise of Wt1 proteins in UB27 and UD28 cells was achieved by removal of tetracycline from the tissue culture medium (Fig. 5, C and D). Induction of Wt1(−KTS) protein in UB27 cells resulted in a time-dependent increase of ADAMTS16 mRNA levels (Fig. 5C), whereas accumulation of Wt1(+KTS) protein in UD28 cells had no significant effect on ADAMTS16 transcripts (Fig. 5D). These results indicate that Adamts16 is co-regulated with Wt1 in primary epicardial cells and permanent cell lines. Restriction of the stimulatory effect on Adamts16 expression to the Wt1(−KTS) protein suggests that the underlying regulatory mechanism acts on the level of gene transcription.

Wt1 Protein Binds to the Promoter of the Adamts16 Gene in Vivo

ChIP was performed to examine whether Wt1 interacts with the promoter of the Adamts16 gene in M15 cells. The PCR primers for amplification of immunoprecipitated DNA bound to the proximal promoter and the 5′-flanking region of the Adamts16 gene, respectively (Fig. 6A). Compared with the use of normal rabbit serum, Adamts16 promoter DNA was enriched more than 2.5-fold with anti-Wt1 antibody (p < 0.01, Student's t test) (Fig. 6B). An ~2-fold enrichment of amplicons within the promoter of the Amhr2 gene (p < 0.05, Student's t test), a known downstream target of Wt1 (41), was obtained by immunoprecipitation with anti-Wt1 antibody (Fig. 6B). In contrast, amplified DNA fragments containing an actin promoter sequence were not enriched by immunoprecipitation of Wt1 protein (Fig. 6B). These results could be validated using UB27 cells with inducible expression of the Wt1(−KTS) protein. Thus, Adamts16 promoter DNA accumulated ~3-fold in UB27 cells with Wt1(−KTS) expression compared with uninduced cells (p < 0.05, Student's t test). No differences in Wt1-bound actin promoter DNA were observed between unstimulated and Wt1(−KTS) expressing UB27 cells (Fig. 6C). Immunoprecipitation with anti-Wt1 antibody failed to enrich Adamts16 promoter DNA and actin DNA in UD28 cells that had been stimulated to express the Wt1(+KTS) protein (Fig. 6D).

FIGURE 6.
Binding of Wt1 protein to the 5′-flanking region of the Adamts16 gene. ChIP was performed to detect Wt1 protein bound to the 5′-flanking region of the Adamts16 gene in its native chromosomal configuration. The drawing (A) delineates the ...

The Wt1(−KTS) Isoform Stimulates the Adamts16 Promoter

To study the molecular interaction of Wt1 protein with the Adamts16 promoter in detail, we co-transfected a firefly luciferase reporter construct, carrying ~3 kb of the upstream sequence of the murine Adamts16 gene, and in addition a Wt1(−KTS) expression plasmid into human granulosa cells (COV434). A nearly 8-fold stimulation of the Adamts16 promoter was measured in response to Wt1(−KTS) expression compared with co-transfection of the empty vector (p < 0.01, Student's t test) (Fig. 7A). Sequence analysis revealed the presence of three putative high affinity Wt1 binding sites in the promoter and 5′-flanking region of the murine Adamts16 gene. All three elements were necessary for maximal activation of the Adamts16 promoter by the Wt1(−KTS) protein (Fig. 7A). Truncated constructs with gradual deletion of the predicted binding motifs were successively less activated by co-transfection of the Wt1(−KTS) expression vector. Stimulation by the Wt1(−KTS) protein was completely lost in the absence of all three binding motifs (Fig. 7A). EMSAs verified that the Wt1(−KTS) protein indeed bound to each of these elements (Fig. 7, B–D). Interaction of recombinant Wt1(−KTS) protein could be competed with excess amounts of unlabeled oligonucleotide carrying the previously identified Wt1 binding site of the Ntrk2 gene promoter (Fig. 7, B–D) (31). Likewise, binding of Wt1 protein was abrogated by introducing single base pair mutations into the three oligonucleotides (Fig. 7, B–D). These results demonstrate that Wt1(−KTS) protein interacts with several cis-elements in the 5′-upstream sequence and stimulates the promoter of the Adamts16 gene. In contrast, recombinant Wt1(+KTS) protein did not interact with any of the identified binding sites (Fig. 7E).

FIGURE 7.
Functional interaction of Wt1(−KTS) protein with the promoter of the Adamts16 gene. A, COV434 ovarian granulosa cells were transiently co-transfected with the indicated Adamts16 promoter luciferase reporter plasmids and a Wt1(−KTS) expression ...

DISCUSSION

ADAMTS16 is a mammalian metalloproteinase whose function is largely unknown. Our initial microarray gene expression analysis showed that Adamts16 transcripts were strongly reduced upon RNAi silencing of the Wilms tumor protein Wt1 in mesonephros-derived M15 cells. The following chain of evidence suggests that Adamts16 is indeed a molecular downstream target gene of the Wt1 transcription factor. First, Wt1 and Adamts16 mRNA levels were closely correlated in various tissues and cells (Figs. 335). Second, a reporter construct containing the murine 5′-upstream sequence of the Adamts16 gene was stimulated ~8-fold by co-transfection of ovarian granulosa cells with a Wt1 expression vector (Fig. 7A). Moreover, Wt1(−KTS) protein bound to three presumed cis-elements in the promoter and the 5′-flanking region of the murine Adamts16 gene (Figs. 6 and and7,7, B-E). Importantly, knockdown of Wt1 in cultured embryonic murine kidneys and XX gonads (12.5 and 13.5 d.p.c.) by treatment with Wt1 antisense morpholinos significantly reduced Adamts16 transcripts, suggesting that Wt1 stimulates Adamts16 expression in these tissues (Figs. 3 and and44A).

Transcriptional regulation of Adamts16 by Wt1 may become relevant during various biological processes in the embryonic and adult organism. Thus, mammalian kidney formation depends on the reciprocal interaction between the metanephric mesenchyme and the invading ureteric bud (reviewed in Ref. 42). Signals emanating from the branching ureteric bud tips induce the surrounding mesenchymal cells to condensate and differentiate into comma- and s-shaped bodies, which eventually give rise to the glomeruli and build up parts of the tubular system of the kidneys (42). Epithelial transition of the metanephric mesenchyme in turn is a prerequisite for sustained branching of the ureteric bud tips during nephrogenesis (42). Metalloproteinases are considered as major candidates for the modulation of mesenchymal-epithelial interactions in embryonic kidneys and other tissues. Several matrix metalloproteinases and their inhibitors (i.e. MMP-2, MT1-MMP, and TIMP-2) are spatially and temporally regulated in the developing kidney (43). Moreover, targeted inactivation of the gene encoding ADAMTS1, which cleaves the major cartilage proteoglycan aggrecan, produced kidney abnormalities in mice (i.e. shrinkage of the renal parenchyma and enlargement of the caliceal space) (44). Our observation that vivo-morpholino knockdown of Adamts16 impaired branching morphogenesis in cultured murine embryonic kidneys suggests an involvement of this metalloproteinase in nephrogenesis (Fig. 4, B and C). Consistently, silencing of the nephrogenic Wt1 protein significantly reduced Adamts16 expression in kidney rudiments (Fig. 4A). Wt1 belongs to the Cys2-His2 class of zinc finger proteins and promotes mesenchymal-to-epithelial transition during the early stages of kidney development (35, 45). Kidney formation in Wt1-deficient mouse embryos, which are commonly lethal by 13.5 d.p.c., was disrupted due to apoptosis of the metanephric mesenchyme and a failure of ureteric bud branching (35). Subsequent in vitro organ culture experiments and transgenic animal studies proved a requirement of Wt1 not only for the early inductive events but also during the later phases of kidney formation (i.e. the differentiation and maturation of the glomeruli) (46) and for the integrity of mature kidneys (4749). Interestingly, recent disruption of the Adamts16 gene in Dahl Salt-sensitive rats caused splitting and thickening of glomerular capillaries in addition to a significant reduction of arterial blood pressure (50). Renal damage was associated with increased proteinuria, suggesting that Adamts16 is indeed necessary for the structural and functional preservation of the kidneys in this model of genetic hypertension (50).

Interaction of the Wt1 transcription factor with the Adamts16 gene may also play a role in the development and function of the gonads. The mammalian gonads are formed by tissue that is derived from the intermediate mesoderm on either side of the embryonic midline axis (51). Establishment of the bipotential gonadal ridge occurs in a non-sex-specific manner in XX and XY individuals and is completed by ~12 d.p.c. in rats and mice (51). Wt1 acts on multiple steps during gonad development. Gonadal ridge formation in Wt1 null mice is initiated in both males and females but then degenerates due to apoptosis, leading to gonadal agenesis (35). The sex-determining factor Sry and the anti-Müllerian hormone receptor (Amhr) 2, which is critical for the regression of the female urogenital ducts, are among the genes that are regulated by Wt1 (41, 52, 53). Consistently, male-to-female sex reversal or genital tract abnormalities were observed in XY patients with heterozygous Wt1 germ line mutations (54), underscoring the role of Wt1 in testis determination. Our results indicate that Wt1 controls Adamts16 expression in the developing gonads in a time-dependent and sex-specific fashion. Thus, silencing of Wt1 significantly increased Adamts16 transcripts in in vitro cultured XY gonads of 11.5 and 12.5 d.p.c. embryos (Fig. 3C). In contrast, Adamts16 mRNA levels in female but not in male gonads (12.5 and 13.5 d.p.c.) were significantly reduced by Wt1 antisense inhibition (Fig. 3, C and D). These results suggest that Wt1 inhibits Adamts16 expression in XY gonads during the early developmental stages and stimulates Adamts16 expression in XX gonads at later points in time. Repression of Adamts16 by Wt1 in developing XY gonads is in line with our failure to clearly co-localize both proteins in the same cells in this tissue (Fig. 1, A and B). Further on, Wt1 may directly contribute to the developmental increase of Adamts16 mRNA levels in female gonads (Fig. 3B). Reporter gene assays and protein-DNA binding studies confirmed that Wt1(−KTS) protein indeed stimulates transcription of the Adamts16 gene in ovarian granulosa cells (Figs. 6 and and7).7). The molecular mechanisms underlying the variable stage-specific effects of Wt1 on Adamts16 expression in male and female gonads are currently unknown but may involve the physical interaction of Wt1 with other proteins in the control of gene transcription (55). Detection of Adamts16 in spermatids of mature testes (Fig. 1, A and C) points to a role in male germ cell maturation and/or function throughout adulthood. Generation of mouse mutants with conditional inactivation of the Adamts16 gene in the gonads will be helpful in clarifying this issue.

It has been shown previously that FSH induced the expression of ADAMTS16 in parietal granulosa cells of preovulatory human follicles (16). In contrast, FSH attenuated basal and nerve growth factor-stimulated Wt1 protein expression in isolated granulosa cells of 21-day-old mice (56). Recently, Wt1 has been reported to inhibit expression of the FSH receptor in immature rat granulosa cells through repression of the FSH receptor promoter (57). These combined observations suggest that Wt1 is an important element in the hormonally regulated transcriptional network in preovulatory follicles. Stimulation of Adamts16 expression by Wt1 in parietal granulosa cells may have a role in extracellular matrix (ECM) remodeling, which is a prerequisite for oocyte liberation during ovulation. Notably, various members of the ADAMTS protease family, in particular ADAMTS1, have been implicated in ECM transformation in the ovary (44, 5860). The involvement of other proteases and substrates in this process adds some functional redundancy, which may facilitate ovulation even in the absence of one or more constituents (61).

Another interesting aspect of our study pertains to the presumed origin of the follicular granulosa cells, which is still a matter of controversy. Indeed, three major sources for pregranulosa cells have been under discussion for many decades: 1) mesothelial cells on the surface of the developing ovary (62), 2) cells originating from a centrally located blastema (63), and 3) mesonephric cells derived from the rete ovarii system (64). The results of a more recent histological study in sheep favored the idea that >95% of the granulosa cells in newly formed primordial follicles arise from the ovarian surface epithelium (65). During this process, mesothelial cells on the outside of the ovary are expected to undergo epithelial-to-mesenchymal transition and migrate into the ovarian cortex, where they differentiate to follicular granulosa cells. Remarkably, Wt1 protein has been identified to act as a key molecule for epithelial-to-mesenchymal transition by down-regulating E-cadherin expression in the epicardium of mouse embryos and other mesothelial tissues (66). Thus, co-localization with Wt1 protein in the ovarian surface epithelium suggests that Adamts16 promotes a mesenchymal commitment of these cells, possibly through ECM remodeling.

In summary, our findings demonstrate that transcription of the gene encoding the Adamts16 metalloproteinase is regulated by the Wilms tumor protein Wt1 in a sex- and tissue-specific fashion. This regulatory link has a presumed role in the development of murine kidneys and gonads.

Acknowledgment

We thank Ulrike Neumann for expert technical assistance.

*This work was supported in part by Deutsche Forschungsgemeinschaft Grant Scho634/8-1.

3The abbreviations used are:

ADAM
a disintegrin and metalloproteinase
ADAMTS
a disintegrin and metalloproteinase with thrombospondin motifs
DIG
3′-digoxigenin
ANOVA
analysis of variance
d.p.c.
days postconception.

REFERENCES

1. Cal S., Obaya A. J., Llamazares M., Garabaya C., Quesada V., López-Otin C. (2002) Cloning, expression analysis, and structural characterization of seven novel human ADAMTSs, a family of metalloproteinases with disintegrin and thrombospondin-1 domains. Gene 283, 49–62 [PubMed]
2. Apte S. S. (2009) A disintegrin-like and metalloprotease (reprolysin-type) with thrombospondin type 1 motif (ADAMTS) superfamily. Functions and mechanisms. J. Biol. Chem. 284, 31493–31497 [PMC free article] [PubMed]
3. Kuno K., Matsushima K. (1998) ADAMTS-1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region. J. Biol. Chem. 273, 13912–13917 [PubMed]
4. Kuno K., Kanada N., Nakashima E., Fujiki F., Ichimura F., Matsushima K. (1997) Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J. Biol. Chem. 272, 556–562 [PubMed]
5. Colige A., Beschin A., Samyn B., Goebels Y., Van Beeumen J., Nusgens B. V., Lapière C. M. (1995) Characterization and partial amino acid sequencing of a 107-kDa procollagen I N-proteinase purified by affinity chromatography on immobilized type XIV collagen. J. Biol. Chem. 270, 16724–16730 [PubMed]
6. Fernandes R. J., Hirohata S., Engle J. M., Colige A., Cohn D. H., Eyre D. R., Apte S. S. (2001) Procollagen II amino propeptide processing by ADAMTS-3. Insights on dermatosparaxis. J. Biol. Chem. 276, 31502–31509 [PubMed]
7. Tortorella M. D., Burn T. C., Pratta M. A., Abbaszade I., Hollis J. M., Liu R., Rosenfeld S. A., Copeland R. A., Decicco C. P., Wynn R., Rockwell A., Yang F., Duke J. L., Solomon K., George H., Bruckner R., Nagase H., Itoh Y., Ellis D. M., Ross H., Wiswall B. H., Murphy K., Hillman M. C., Jr., Hollis G. F., Newton R. C., Magolda R. L., Trzaskos J. M., Arner E. C. (1999) Purification and cloning of aggrecanase-1. A member of the ADAMTS family of proteins. Science 284, 1664–1666 [PubMed]
8. Vázquez F., Hastings G., Ortega M. A., Lane T. F., Oikemus S., Lombardo M., Iruela-Arispe M. L. (1999) METH-1, a human ortholog of ADAMTS-1, and METH-2 are members of a new family of proteins with angio-inhibitory activity. J. Biol. Chem. 274, 23349–23357 [PubMed]
9. Clark M. E., Kelner G. S., Turbeville L. A., Boyer A., Arden K. C., Maki R. A. (2000) ADAMTS9, a novel member of the ADAM-TS/metallospondin gene family. Genomics 67, 343–350 [PubMed]
10. Hurskainen T. L., Hirohata S., Seldin M. F., Apte S. S. (1999) ADAM-TS5, ADAM-TS6, and ADAM-TS7, novel members of a new family of zinc metalloproteinases. General features and genomic distribution of the ADAM-TS family. J. Biol. Chem. 274, 25555–25563 [PubMed]
11. Kim J., Kim H., Lee S. J., Choi Y. M., Lee S. J., Lee J. Y. (2005) Abundance of ADAM-8, -9, -10, -12, -15 and -17 and ADAMTS-1 in mouse uterus during the oestrous cycle. Reprod. Fertil. Dev. 17, 543–555 [PubMed]
12. Sylvester J., Liacini A., Li W. Q., Zafarullah M. (2004) Interleukin-17 signal transduction pathway implicated in inducing matrix metalloproteinase-3, -13 and aggrecanase-1 genes in articular chondrocytes. Cell. Signal. 16, 469–476 [PubMed]
13. Worley J. R., Baugh M. D., Hughes D. A., Edwards D. R., Hogan A., Sampson M. J., Gavrilovic J. (2003) Metalloproteinase expression in PMA-stimulated THP-1 cells. Effects of peroxisome proliferator-activated receptor-γ (PPR γ) agonists and 9-cis-retinoic acid. J. Biol. Chem. 278, 51340–51346 [PubMed]
14. Colige A., Nuytinck L., Hausser I., van Essen A. J., Thiry M., Herens C., Adès L. C., Malfait F., Paepe A. D., Franck P., Wolff G., Oosterwijk J. C., Smitt J. H., Lapière C. M., Nusgens B. V. (2004) Novel types of mutation responsible for the dermatosparactic type of Ehlers-Danlos syndrome (Type VIIC) and common polymorphisms in the ADAMTS2 gene. J. Invest. Dermatol. 123, 656–663 [PubMed]
15. Levy G. G., Nichols W. C., Lian E. C., Foroud T., McClintick J. N., McGee B. M., Yang A. Y., Siemieniak D. R., Stark K. R., Gruppo R., Sarode R., Shurin S. B., Chandrasekaran V., Stabler S. P., Sabio H., Bouhassira E. E., Upshaw J. D., Jr., Ginsburg D., Tsai H. M. (2001) Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura. Nature 413, 488–494 [PubMed]
16. Gao S., De Geyter C., Kossowska K., Zhang H. (2007) FSH stimulates the expression of the ADAMTS-16 protease in mature human ovarian follicles. Mol. Hum. Reprod. 13, 465–471 [PubMed]
17. Kevorkian L., Young D. A., Darrah C., Donell S. T., Shepstone L., Porter S., Brockbank S. M., Edwards D. R., Parker A. E., Clark I. M. (2004) Expression profiling of metalloproteinases and their inhibitors in cartilage. Arthritis Rheum. 50, 131–141 [PubMed]
18. Joe B., Saad Y., Dhindaw S., Lee N. H., Frank B. C., Achinike O. H., Luu T. V., Gopalakrishnan K., Toland E. J., Farms P., Yerga-Woolwine S., Manickavasagam E., Rapp J. P., Garrett M. R., Coe D., Apte S. S., Rankinen T., Pérusse L., Ehret G. B., Ganesh S. K., Cooper R. S., O'Connor A., Rice T., Weder A. B., Chakravarti A., Rao D. C., Bouchard C. (2009) Positional identification of variants of Adamts16 linked to inherited hypertension. Hum. Mol. Genet. 18, 2825–2838 [PMC free article] [PubMed]
19. Sakamoto N., Oue N., Noguchi T., Sentani K., Anami K., Sanada Y., Yoshida K., Yasui W. (2010) Serial analysis of gene expression of esophageal squamous cell carcinoma. ADAMTS16 is upregulated in esophageal squamous cell carcinoma. Cancer Sci. 101, 1038–1044 [PubMed]
20. Surridge A. K., Rodgers U. R., Swingler T. E., Davidson R. K., Kevorkian L., Norton R., Waters J. G., Goldring M. B., Parker A. E., Clark I. M. (2009) Characterization and regulation of ADAMTS-16. Matrix Biol. 28, 416–424 [PMC free article] [PubMed]
21. Larsson S. H., Charlieu J. P., Miyagawa K., Engelkamp D., Rassoulzadegan M., Ross A., Cuzin F., van Heyningen V., Hastie N. D. (1995) Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell 81, 391–401 [PubMed]
22. Sciesielski L. K., Kirschner K. M., Scholz H., Persson A. B. (2010) Wilms' tumor protein Wt1 regulates the interleukin-10 (IL-10) gene. FEBS Lett. 584, 4665–4671 [PubMed]
23. Englert C., Hou X., Maheswaran S., Bennett P., Ngwu C., Re G. G., Garvin A. J., Rosner M. R., Haber D. A. (1995) WT1 suppresses synthesis of the epidermal growth factor receptor and induces apoptosis. EMBO J. 14, 4662–4675 [PubMed]
24. Hartwig S., Ho J., Pandey P., Macisaac K., Taglienti M., Xiang M., Alterovitz G., Ramoni M., Fraenkel E., Kreidberg J. A. (2010) Genomic characterization of Wilms' tumor suppressor 1 targets in nephron progenitor cells during kidney development. Development 137, 1189–1203 [PubMed]
25. Clapcote S. J., Roder J. C. (2005) Simplex PCR assay for sex determination in mice. BioTechniques 38, 702. [PubMed]
26. Dame C., Kirschner K. M., Bartz K. V., Wallach T., Hussels C. S., Scholz H. (2006) Wilms' tumor suppressor, Wt1, is a transcriptional activator of the erythropoietin gene. Blood 107, 4282–4290 [PubMed]
27. Kirschner K. M., Hagen P., Hussels C. S., Ballmaier M., Scholz H., Dame C. (2008) The Wilms' tumor suppressor Wt1 activates transcription of the erythropoietin receptor in hematopoietic progenitor cells. FASEB J. 22, 2690–2701 [PubMed]
28. Martens L. K., Kirschner K. M., Warnecke C., Scholz H. (2007) Hypoxia-inducible factor-1 (HIF-1) is a transcriptional activator of the TrkB neurotrophin receptor gene. J. Biol. Chem. 282, 14379–14388 [PubMed]
29. Warburg O., Christian W. (1942) Isolation and crystallization of enolase. Biochem. Z. 310, 384–421
30. Wagner K. D., Wagner N., Sukhatme V. P., Scholz H. (2001) Activation of vitamin D receptor by the Wilms' tumor gene product mediates apopotsis of renal cells. J. Am. Soc. Nephrol. 12, 1188–1196 [PubMed]
31. Wagner N., Wagner K. D., Theres H., Englert C., Schedl A., Scholz H. (2005) Coronary vessel development requires activation of the TrkB neurotrophin receptor by the Wilms' tumor transcription factor Wt1. Genes Dev. 19, 2631–2642 [PubMed]
32. Stricker S., Verhey van Wijk N., Witte F., Brieske N., Seidel K., Mundlos S. (2006) Cloning and expression pattern of chicken Ror2 and functional characterization of truncating mutations in Brachydactyly type B and Robinow syndrome. Dev. Dyn. 235, 3456–3465 [PubMed]
33. Pritchard-Jones K., Fleming S., Davidson D., Bickmore W., Porteous D., Gosden C., Bard J., Buckler A., Pelletier J., Housman D. (1990) The candidate Wilms' tumour gene is involved in genitourinary development. Nature 346, 194–197 [PubMed]
34. Armstrong J. F., Pritchard-Jones K., Bickmore W. A., Hastie N. D., Bard J. B. (1993) The expression of the Wilms' tumour gene, WT1, in the developing mammalian embryo. Mech. Dev. 40, 85–97 [PubMed]
35. Kreidberg J. A., Sariola H., Loring J. M., Maeda M., Pelletier J., Housman D., Jaenisch R. (1993) WT-1 is required for early kidney development. Cell 74, 679–691 [PubMed]
36. Haber D. A., Sohn R. L., Buckler A. J., Pelletier J., Call K. M., Housman D. E. (1991) Alternative splicing and genomic structure of the Wilms' tumor gene WT1. Proc. Natl. Acad. Sci. U.S.A. 88, 9618–9622 [PubMed]
37. Madden S. L., Cook D. M., Morris J. F., Gashler A., Sukhatme V. P., Rauscher F. J., 3rd (1991) Transcriptional repression mediated by the WT1 Wilms tumor gene product. Science 253, 1550–1553 [PubMed]
38. Hamilton T. B., Barilla K. C., Romaniuk P. J. (1995) High affinity binding sites for the Wilms' tumour suppressor protein WT1. Nucleic Acids Res. 23, 277–284 [PMC free article] [PubMed]
39. Laity J. H., Dyson H. J., Wright P. E. (2000) Molecular basis for modulation of biological function by alternate splicing of the Wilms' tumor suppressor protein. Proc. Natl. Acad. Sci. U.S.A. 97, 11932–11935 [PubMed]
40. Bor Y. C., Swartz J., Morrison A., Rekosh D., Ladomery M., Hammarskjöld M. L. (2006) The Wilms' tumor 1 (WT1) gene (+KTS isoform) functions with a CTE to enhance translation from an unspliced RNA with a retained intron. Genes Dev. 20, 1597–1608 [PubMed]
41. Klattig J., Sierig R., Kruspe D., Besenbeck B., Englert C. (2007) The Wilms' tumor protein Wt1 is an activator of the anti-Müllerian hormone receptor gene Amhr2. Mol. Cell. Biol. 27, 4355–4364 [PMC free article] [PubMed]
42. Michos O. (2009) Kidney development. From ureteric bud formation to branching morphogenesis. Curr. Opin. Genet. Dev. 19, 484–490 [PMC free article] [PubMed]
43. Pohl M., Sakurai H., Bush K. T., Nigam S. K. (2000) Matrix metalloproteinases and their inhibitors regulate in vitro ureteric bud branching morphogenesis. Am. J. Physiol. Renal Physiol. 279, F891–F900 [PubMed]
44. Mittaz L., Russell D. L., Wilson T., Brasted M., Tkalcevic J., Salamonsen L. A., Hertzog P. J., Pritchard M. A. (2004) Adamts-1 is essential for the development and function of the urogenital system. Biol. Reprod. 70, 1096–1105 [PubMed]
45. Miller-Hodges E., Hohenstein P. (2012) WT1 in disease. Shifting the epithelial-mesenchymal balance. J. Pathol. 226, 229–240 [PubMed]
46. Davies J. A., Ladomery M., Hohenstein P., Michael L., Shafe A., Spraggon L., Hastie N. (2004) Development of an siRNA-based method for repressing specific genes in renal organ culture and its use to show that the Wt1 tumour suppressor is required for nephron differentiation. Hum. Mol. Genet. 13, 235–246 [PubMed]
47. Guo J. K., Menke A. L., Gubler M. C., Clarke A. R., Harrison D., Hammes A., Hastie N. D., Schedl A. (2002) WT1 is a key regulator of podocyte function. Reduced expression levels cause crescentic glomerulonephritis and mesangial sclerosis. Hum. Mol. Genet. 11, 651–659 [PubMed]
48. Schumacher V., Schärer K., Wühl E., Altrogge H., Bonzel K. E., Guschmann M., Neuhaus T. J., Pollastro R. M., Kuwertz-Bröking E., Bulla M., Tondera A. M., Mundel P., Helmchen U., Waldherr R., Weirich A., Royer-Pokora B. (1998) Spectrum of early onset nephrotic syndrome associated with WT1 missense mutations. Kidney Int. 53, 1594–1600 [PubMed]
49. Niaudet P., Gubler M. C. (2006) WT1 and glomerular diseases. Pediatr. Nephrol. 21, 1653–1660 [PubMed]
50. Gopalakrishnan K., Kumarasamy S., Abdul-Majeed S., Kalinoski A. L., Morgan E. E., Gohara A. F., Nauli S. M., Filipiak W. E., Saunders T. L., Joe B. (2012) Targeted disruption of Adamts16 gene in a rat genetic model of hypertension. Proc. Natl. Acad. Sci. U.S.A. 109, 20555–20559 [PubMed]
51. Swain A., Lovell-Badge R. (1999) Mammalian sex differentiation: a molecular drama. Genes Dev. 13, 755–767 [PubMed]
52. Shimamura R., Fraizer G. C., Trapman J., Lau Y.-f. C., Saunders G. F. (1997) The Wilms' tumor gene WT1 can regulate genes involved in sex determination and differentiation SRY, Müllerian-inhibiting substance, and the androgen receptor. Clin. Cancer Res. 3, 2571–2580 [PubMed]
53. Hossain A., Saunders G. F. (2001) The human sex-determining gene SRY is a direct target of WT1. J. Biol. Chem. 276, 16817–16823 [PubMed]
54. Pelletier J., Bruening W., Kashtan C. E., Mauer S. M., Manivel J. C., Striegel J. E., Houghton D. C., Junien C., Habib R., Fouser L. (1991) Germline mutation in the Wilms' tumor suppressor gene are associated with abnormal urogenital development and Denys-Drash syndrome. Cell 67, 437–447 [PubMed]
55. Roberts S. G. (2006) The modulation of WT1 transcription function by cofactors. Biochem. Soc. Symp. 73, 191–201 [PubMed]
56. Roh J., Bae J., Lee K., Mayo K., Shea L., Woodruff T. K. (2009) Regulation of Wilms' tumor gene expression by nerve growth factor and follicle-stimulating hormone in the immature mouse ovary. Fertil. Steril. 91, 1451–1454 [PMC free article] [PubMed]
57. Yoon O., Roh J. (2012) Regulation of FSH receptor expression by the Wilms' tumor 1 gene product (WT1) in immature rat granulosa cells. Mol. Reprod. Dev. 79, 368. [PubMed]
58. Espey L. L., Yoshioka S., Russell D. L., Robker R. L., Fujii S., Richards J. S. (2000) Ovarian expression of a disintegrin and metalloproteinase with thrombospondin motifs during ovulation in the gonadotropin-primed immature rat. Biol. Reprod. 62, 1090–1095 [PubMed]
59. Madan P., Bridges P. J., Komar C. M., Beristain A. G., Rajamahendran R., Fortune J. E., MacCalman C. D. (2003) Expression of messenger RNA for ADAMTS subtypes changes in the periovulatory follicle after the gonadotropin surge and during luteal development and regression in cattle. Biol. Reprod. 69, 1506–1514 [PubMed]
60. Robker R. L., Russell D. L., Espey L. L., Lydon J. P., O'Malley B. W., Richards J. S. (2000) Progesteron-regulated genes in the ovulation process. ADAMTS-1 and cathepsin L proteases. Proc. Natl. Acad. Sci. U.S.A. 97, 4689–4694 [PubMed]
61. Richards J. S., Hernandez-Gonzalez I., Gonzalez-Robayna I., Teuling E., Lo Y., Boerboom D., Falender A. E., Doyle K. H., LeBaron R. G., Thompson V., Sandy J. D. (2005) Regulated expression of ADAMTS family members in follicles and cumulus oocyte complexes. Evidence for specific and redundant patterns during ovulation. Biol. Reprod. 72, 1241–1255 [PubMed]
62. Gondos B. (1975) Surface epithelium of the developing ovary. Possible correlation with ovarian neoplasia. Am. J. Pathol. 81, 303–321 [PubMed]
63. Peters H., Pedersen T. (1967) Origin of follicle cells in the infant mouse ovary. Fertil. Steril. 18, 309–313 [PubMed]
64. Byskov A. G. (1978) The anatomy and ultrastructure of the rete system in the fetal mouse ovary. Biol. Reprod. 19, 720–735 [PubMed]
65. Sawyer H. R., Smith P., Heath D. A., Juengel J. L., Wakefield S. J., McNatty K. P. (2002) formation of ovarian follicles during fetal development in sheep. Biol. Reprod. 66, 1134–1150 [PubMed]
66. Martínez-Estrada O. M., Lettice L. A., Essafi A., Guadix J. A., Slight J., Velecela V., Hall E., Reichmann J., Devenney P. S., Hohenstein P., Hosen N., Hill R. E., Muñoz-Chapuli R., Hastie N. D. (2010) Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat. Genet. 42, 89–93 [PMC free article] [PubMed]
67. Morris J. F., Madden S. L., Tournay O. E., Cook D. M., Sukhatme V. P., Rauscher F. J. (1991) Characterization of the zinc finger protein encoded by the WT1 Wilms' tumor locus. Oncogene 6, 2339–2348 [PubMed]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology