PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jvirolPermissionsJournals.ASM.orgJournalJV ArticleJournal InfoAuthorsReviewers
 
J Virol. 2013 June; 87(12): 7046–7053.
PMCID: PMC3676127

The Mature Virion of Ectromelia Virus, a Pathogenic Poxvirus, Is Capable of Intrahepatic Spread and Can Serve as a Target for Delayed Therapy

Abstract

Orthopoxviruses (OPVs), which include the agent of smallpox (variola virus), the zoonotic monkeypox virus, the vaccine and zoonotic species vaccinia virus, and the mouse pathogen ectromelia virus (ECTV), form two types of infectious viral particles: the mature virus (MV), which is cytosolic, and the enveloped virus (EV), which is extracellular. It is believed that MVs are required for viral entry into the host, while EVs are responsible for spread within the host. Following footpad infection of susceptible mice, ECTV spreads lymphohematogenously, entering the liver at 3 to 4 days postinfection (dpi). Afterwards, ECTV spreads intrahepatically, killing the host. We found that antibodies to an MV protein were highly effective at curing mice from ECTV infection when administered after the virus reached the liver. Moreover, a mutant ECTV that does not make EV was able to spread intrahepatically and kill immunodeficient mice. Together, these findings indicate that MVs are sufficient for the spread of ECTV within the liver and could have implications regarding the pathogenesis of other OPVs, the treatment of emerging OPV infections, as well as strategies for preparedness in case of accidental or intentional release of pathogenic OPVs.

INTRODUCTION

Orthopoxviruses (OPVs) penetrate their natural hosts through epithelial surfaces and disseminate stepwise to distant organs through the regional draining lymph node (D-LN) and then the blood to cause systemic disease (1, 2). For instance, the human pathogen variola virus (VARV) penetrated through the respiratory epithelium to spread lymphohematogenously through the mediastinal lymph nodes. Thus, smallpox was chiefly a systemic and not a respiratory disease (3, 4). Similarly, some of the gravest complications of the smallpox vaccine, which is made with live vaccinia virus (VACV), are due to lymphohematogenous (LH) dissemination (57). The OPV ectromelia virus (ECTV), the agent of mousepox, is a mouse pathogen that serves as an excellent model for OPV pathogenesis and as the textbook paradigm for LH spread (1, 2). ECTV penetrates through the skin of the footpad and spreads lymphohematogenously through the popliteal D-LN to seed the liver and spleen. Susceptible strains of mice such as BALB/c usually die at 7 to 12 days postinfection (dpi) with extensive liver and splenic necrosis due to massive viral replication. In resistant strains of mice such as C57BL/6 (B6), LH dissemination and viral replication are considerably controlled by the action of the innate and adaptive immune responses and mousepox does not occur (810).

During the replication of VACV and likely all other OPVs, the first infectious particle formed is the intracellular mature virus (MV), which consists of a core surrounded by a single membrane bilayer. While most MVs remain within the cytosol and are released to the extracellular milieu only by cell lysis, some MVs become wrapped by a double membrane and are transported to the plasma membrane through microtubules and exocytosed, losing the outer membrane in the process. Most of the resulting enveloped virus (EV) remains attached to the plasma membrane as cell-associated enveloped virus (CEV), while some is released as extracellular enveloped virus (EEV). CEVs are important for cell-to-cell spread, and EEVs are important for the long-range spread of VACV and probably other OPVs in tissue culture. In addition, EVs are thought to be essential for OPV spread within the host (1115). The MV and EV membranes each have a characteristic set of proteins that play various roles in the virus life cycle, and some of them have been shown to be effective targets for vaccination in several OPV infection models (1525). However, it remains to be determined which of these proteins can serve as targets for late therapy in a systemic model of OPV infection.

While prophylactic immunization with VACV is highly effective, treatment of individuals exposed to pathogenic OPVs or with vaccination complications is less advanced. In the United States, vaccinia immunoglobulin (VIG) obtained from vaccinees is the only anti-OPV treatment approved by the Food and Drug Administration (26, 27). However, VIG has limited efficacy and, due to its nature, is scarce. Still, it is not yet possible to supplant it with or improve it with a cocktail of monoclonal antibodies (MAbs) because it is unknown which specificities can protect and/or cure OPV infections (27). Of note, VIG can cure ECTV infection when given to immunocompetent mice at 3 dpi but cannot cure severe combined immunodeficient (SCID) mice from VACV infection (28). Here we demonstrate that IgG1 mouse MAbs recognizing the MV protein L1R/EVM072 (VACV/ECTV) and the EV protein A33R/EVM135 but not the EV protein B5R/EVM155 are effective at preventing mousepox when administered immediately after infection. Of interest, the L1R/EVM072 MAb and L1R/EVM072 polyclonal rabbit antiserum were also very effective at preventing spread within the liver and curing ECTV infection when administered after the virus reached the liver. Moreover, we show that an ECTV mutant lacking a gene essential for EV formation (F13L/EVM036) can efficiently spread intrahepatically.

MATERIALS AND METHODS

Ethics statement.

All animal work was conducted according to relevant national and international guidelines and with protocols approved by the Fox Chase Cancer Center (FCCC) Institutional Animal Care and Use Committee.

Cells, viruses, and recombinant proteins.

Media and cells were as previously described (2931). Stocks of the ECTV Moscow strain (ATCC VR-1374) were propagated in tissue culture as previously described (31). ECTV deficient in EVM036 has been described previously (32). Production of recombinant A33R, EVM135, B5R, and EVM155 was as previously described (18, 33). Production of polyclonal rabbit antibodies (Abs) was also as previously described (34). MAbs VMC-2, VMC-14, and VMC-78 (all IgG1) have been described previously (33, 35) and were either obtained from BEI Resources (Manassas, VA) or produced and purified as described previously (33, 35).

Mice and infections.

BALB/c and C57BL/6 mice were purchased from Taconic Farms. SCID mice in a BALB/c background were bred at FCCC. B6.129P2-Fcer1gtm1Rav N12 mice (Taconic Farms) were bred at FCCC with mousepox-susceptible B6.D2-(D6Mit149-D6Mit15)/LusJ (B6.D2-D6) mice (Jackson) to generate B6.D2-D6-Fcer1gtm1Rav mice. Unless indicated otherwise, mice were infected with ECTV in the left footpad with 30 μl phosphate-buffered saline (PBS) containing 300 PFU. For the determination of survival, the mice were monitored daily. To avoid unnecessary suffering, mice were euthanized and counted as dead if imminent death was certain. For virus titers and histopathology, mice were infected with 300 PFU ECTV and euthanized when indicated, and whole LNs or 100 mg of liver was homogenized in PBS using a Tissue Lyser homogenizer (Qiagen). Virus titers were determined on BS-C-1 cells in 6-well plates as described before (2931).

Construction of recombinant baculovirus expressing soluble VACV and ECTV proteins.

The DNA sequences of the different proteins without transmembrane domains were amplified by PCR and cloned into the baculovirus transfer vector pVT-Bac downstream of and in frame with the mellitin signal sequence, as previously described for B5R (33). Two additional amino acid residues (DP) are present at the N terminus of the mature (signal-less) recombinant proteins. These are left over following cleavage of the melittin signal sequence. The proteins were constructed with 6 histidine residues at the C terminus to allow purification via nickel-nitrilotriacetic acid affinity chromatography.

Hybridoma selection and IgG purification.

Murine hybridomas secreting antibodies against A33R were generated as previously described (35).

ELISA for viral proteins.

High-binding 96-well enzyme-linked immunosorbent assay (ELISA) plates (Corning) were coated overnight at 4°C with 50 μl recombinant A33R, EVM135, B5R, or EVM155 protein (50 μg/ml) or, for L1R and EVM072, with cell lysates from VACV- or ECTV-infected cells, respectively (2 ×107 PFU/ml), in PBS, pH 7.0. Plates were washed twice with PBS and then blocked for 2 h at 37°C with PBS containing 0.05% Tween 20 (PBST) and 3% bovine serum albumin (BSA). Antibodies were serially diluted in PBST, 1% BSA, and 0.1 ml was added to each well. The plates were then incubated for 1 h at 37°C and washed four times with PBST, and 0.1 ml of horseradish peroxidase (HRP)-conjugated affinity-purified goat anti-mouse IgG γ heavy chain (KPL) was added to each well at a dilution of 1:3,000 in PBST. The plates were incubated for 1 h at 37°C and washed six times with PBST, and 100 μl Sure Blue tetramethylbenzidine (KPL) was added to each well. The plates were incubated at room temperature for 5 to 20 min. The reactions were stopped by addition of 20 μl 3 M HCl. The optical density at 450 nm (OD450) was determined using a microplate spectrophotometer (μQuant; Bio-Tek).

Plaque reduction assay.

ECTV stocks were incubated for 1 h at room temperature with 100 μg/ml of the indicated Abs. The virus-antibody mixture (100 PFU/well) was added to confluent BS-C-1 cells (ATCC CL-26) in 24-well plates with 0.25 ml, and the plates were incubated for 2 h at 37°C. Viral inocula were removed after incubation, and cells were overlaid with 1 ml fresh Dulbecco modified Eagle medium (DMEM) containing 2.5% fetal bovine serum (FBS) and 1% carboxymethyl cellulose. Cells were incubated for 5 to 7 days at 37°C in a 5% CO2 incubator. The cells were fixed with formaldehyde and stained with crystal violet.

Comet inhibition assay.

Monolayers of BS-C-1 cells in 6-well plates were infected with 60 PFU ECTV in 0.5 ml DMEM containing 2.5% FBS. After 2 h of incubation at 37°C, the medium containing virus was aspirated and 2 ml fresh DMEM containing 2.5% FBS and 50 μg/ml of the corresponding antibody was added. Cells were incubated for 5 to 7 days at 37°C in a 5% CO2 incubator and stained with crystal violet.

Complement depletion.

BALB/c mice were inoculated intraperitoneally (i.p.) with 15 μg purified cobra venom factor (CVF) from Najia najia kaouthia (CompTech) at 4, 5, and 8 dpi. Ten micrograms CVF has been shown to fully inhibit complement activity in mouse serum (36). Mice were bled at 5, 6, and 9 dpi, and C3 depletion was assessed in serum by Western blotting and using a commercial ELISA kit for C3 (Immunology Consultants Lab) according to the manufacturer's instructions.

RNA isolation.

D-LNs were collected from infected or naive mice and immediately placed in RNase-free tubes containing RNAlater (Ambion). RNA was extracted using an RNeasy kit (Qiagen), as described by the manufacturer, and the DNA was digested during the process with DNase (Qiagen). One microliter of the RNA was analyzed in a NanoDrop 2000C apparatus (Thermo Scientific).

Reverse transcription.

One microgram of RNA was retrotranscribed to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's instructions.

Quantitative PCR (qPCR).

We used the Roche Universal library probe 7 and EVM166-specific oligonucleotides GTGCAAAGTGTCCGCCTATT and TCTATTAAGAGGTCGTCTAGTCTTTCC, as indicated by the manufacturer. Briefly, 1 μl of the cDNA from the reverse transcription reactions was used as the template. The PCRs were performed in an MX3005P (Agilent Technologies) or a Mastercycler ep realplex2 (Eppendorf) PCR cycler. The expression was normalized by GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expression and quantified using a standard curve generated with a plasmid containing the EVM166 gene.

Immunohistochemistry.

Viral foci were detected using EVM135 rabbit antiserum as described previously (34).

Statistics.

We used Prism software to determine the significance of the differences between groups. For survival experiments, each group consisted of five mice. We determined significant differences using the log-rank test. For dot plots, each point represents an individual mouse, and differences were determined using the Mann-Whitney test or a two-tailed unpaired t test, as applicable. All experiments were repeated a minimum of two times but in most cases were repeated three times.

RESULTS

L1R, A33R, and B5R MAbs recognize the ECTV ortholog proteins and block their biological function.

Previous work in several laboratories, including ours, has shown that immunization against the EV proteins A33R/EVM135 and/or B5R as well as the MV protein L1R alone or in combination can protect mice against intranasal VACV and/or ECTV infection and primates against MPXV infection (1625). Additional work showed that polyclonal Abs (pAbs) or MAbs to these proteins alone or in combination can protect from intranasal VACV infection before or soon after infection (3638). However, whether Ab treatment can cure natural OPV infections after becoming systemic has not been explored. Given that OPVs are antigenically similar, we tested a panel of VACV L1R, A33R, and B5R MAbs for reactivity to their respective ECTV orthologs, EVM072, EVM135, and EVM155. The L1R MAb VMC-2 reacted similarly in ELISAs with plate-bound VACV and ECTV particles, suggesting identical binding to L1R and EVM072 (Fig. 1a). Plate-bound recombinant A33R and EVM135 were similarly recognized by the A33R MAb VMC-78 (Fig. 1b), and plate-bound recombinant B5R and EVM072 were also similarly recognized by the B5R MAb VMC-14 (Fig. 1c).

Fig 1
L1R A33R and B5R MAbs recognize the ECTV ortholog proteins and block their biological function. (a) The reactivity of L1R MAb VMC-2 with plated VACV and ECTV particles was compared. The dissociation constant (Kd) calculated with Prism software using nonlinear ...

We have previously shown that VMC-2 (anti-L1R/EVM072) neutralized VACV stocks which contain mostly MV (33). We have now found that, compared with no Ab, VMC-2 also neutralized ECTV stocks in plaque reduction assays, while the anti-A33R/EVM135 VMC-78 MAb or the anti-B5R/EVM155 VMC-14 MAb did not. Control polyclonal rabbit anti-L1R (rL1R) also neutralized ECTV, while rabbit EVM155 antiserum (rEVM155) did not (Fig. 1d). As expected, the A33R/EVM135 VMC-78 MAb and the B5R/EVM155 VMC14 MAb inhibited comet formation in liquid medium (Fig. 1e, top), a sign of distant EEV-dependent spread. Notably, not only control rEVM155 but also VMC-2 and rL1R inhibited comet formation (Fig. 1e, bottom). In addition, VMC-14 partially neutralized EV, but VMC-78 or VMC-2 did not (reported as text). The finding that anti-L1R Abs can inhibit ECTV comet formation is somewhat surprising, as they do not inhibit VACV comets. This suggests differences in the spread of VACV and ECTV in tissue culture. The reasons for this difference are unknown and grant future comparative studies. Nevertheless, from these experiments we concluded that in addition to recognizing their respective VACV targets, VMC-2, VMC-78, and VMC-14 also recognize and inhibit the biological function of the respective ECTV orthologs, EVM072, EVM135, and EVM155.

Prophylactic treatment with MAbs to L1R/EVM072 and A33R/EVM135 but not B5R/EVM155 protects mice from mousepox.

We tested whether VMC-2, VMC-78, and VMC-14 could be used to prevent mousepox. BALB/c mice were infected with 300 PFU ECTV in the footpad, its natural route (9), and a few minutes later inoculated them with 200 μg of the different MAbs i.p. We found that 200 μg VMC-2 and VMC-78 but not VMC-14 significantly protected BALB/c mice from lethal mousepox (P ≤ 0.01; Fig. 2a). Protection with VMC-2 was more effective because the mice treated with this MAb did not lose weight, while those inoculated with VMC-78 did (Fig. 2b).

Fig 2
Prophylactic and postexposure treatment with L1R/EVM72 MAb protects from mousepox. (a) BALB/c mice were infected with ECTV and immediately treated with 200 μg of the indicated MAbs. Survival was monitored. (b) The mice used in the experiment whose ...

Treatment with anti-L1R cures mice from mousepox when administered after ECTV dissemination to the liver.

We next determined when after infection ECTV becomes clearly established in the liver of BALB/c mice infected with 300 PFU in the footpad. Immunohistochemical analysis of liver sections showed few infection foci in the liver at 4 dpi, and most were comprised of a single cell. At 5 dpi, most foci were multicellular. During the following days, the size of the individual foci gradually increased and finally coalesced to cover most of the liver at 8 to 10 dpi. The increase in focus size was reminiscent of the growth of viral plaques in semisolid medium and suggested that ECTV spread centrifugally to nearby cells (Fig. 2c). From these results we concluded that, following infection with 300 PFU in the footpad, ECTV is well established in the liver at 4 to 5 dpi. Thus, we tested whether the different MAbs could cure mousepox when administered at these days postinfection. BALB/c mice were treated with VMC-2, VMC-78, or mouse IgG1 at 4 or 5 dpi with 300 PFU in the footpad. All the mice treated with 200 μg VMC-2 at 4 or 5 dpi survived, while all those treated with 500 μg IgG1 succumbed. Mice treated with either 200 or 500 μg VMC-78 at 4 or 5 dpi were also significantly protected, but some mice in each group succumbed. Thus, together, VMC-78 was significantly less protective than VMC-2 (P ≤ 0.05; Fig. 2d). When organs from groups of mice treated with 200 μg MAbs at 5 dpi were analyzed at 7 dpi (2 days after treatment), virus loads in the liver and spleen were significantly lower in VMC-2-treated than VMC-78- or IgG1-treated mice (Fig. 2e). Thus, treatment with anti-L1R/EVM072 MAb was more effective at curing late mousepox than treatment with anti-A33R/EVM135 MAb. In addition, immunohistochemical analysis of the livers showed that the lesions in VMC-2-treated mice at 7 dpi (2 days posttreatment) were fewer in number and smaller than those in VMC-78- or IgG1-treated mice (Fig. 2f), suggesting less efficient intrahepatic ECTV spread in mice treated with VMC-2 than in mice treated with VMC-78 or IgG1.

To investigate whether the differential effects that we were seeing were due to the monoclonality of the Abs, we used rabbit antisera against VACV L1R (rL1R), ECTV EVM135 (rEVM135), and EVM155 (rEVM155). Each antiserum reacted with its respective target in ELISA. L1R antiserum was highly effective at reducing plaque and comet formation, while EVM135 and EVM155 antisera did not reduce plaques but inhibited comets (Fig. 1 and data not shown). When given at 0 dpi (Fig. 2g, left), L1R and EVM135 antisera but not EVM155 antiserum significantly protected BALB/c mice from death (P ≤ 0.01). The protection afforded by L1R and EVM135 antisera was not significantly different. EVM155 antiserum offered significant protection but mostly by delaying the time of death. At 2 dpi (Fig. 2g, center), L1R and EVM135 antisera but not EVM155 antiserum were protective. When given at 5 dpi, only the L1R antiserum was protective (P ≤ 0.05; Fig. 2g, right). In all cases, the positive-control antiserum to the type I IFN binding protein was protective (34), while naive serum was not. Hence, the data obtained with pAbs confirm that the MV protein EVM072 is a better target for late Ab therapy than the EV proteins EVM135 and EVM155. Moreover, because rabbit Abs can activate mouse complement in vivo to protect from VACV infection (36), these data suggest that the less effective protection of the anti-EV MAbs was not due only to the lack of effector functions of the IgG1 isotype.

Late control of ECTV by anti-L1R/EVM072 does not require antibody effector functions.

While it was possible that MAb VMC-2 protected mice through antibody effector functions such as Fc-mediated antibody-dependent cytotoxicity (ADCC) or Fc-dependent or -independent complement activation, this is unlikely because it is of the IgG1 isotype, an isotype with poor effector functions. To test whether VMC-2 controlled ECTV through a mechanism dependent on Fc receptors, B6.129P2-Fcer1gtm1Rav N12 (Fcer1γ−/−) mice, which are deficient in Fc receptor expression and signaling (39), were backcrossed to the B6.D2-(D6Mit149-D6Mit15)/LusJ (B6.D2-D6) mouse strain, which is a C57BL/6 congenic strain susceptible to mousepox (40). For unknown reasons, not all B6.D2-D6-Fcer1γ−/− mice succumbed to mousepox, suggesting that they are not as susceptible as the B6.D2-D6 parental strain (reported as text). Still, B6.D2-D6-Fcer1γ−/− mice treated with VMC-2 at 5 dpi had significantly lower ECTV loads in the liver and spleen (Fig. 3a) than those treated with IgG1, indicating that VMC-2 reduced virus loads late in infection independently of Fc receptors. To test whether complement activation was required, ECTV-infected BALB/c mice were depleted of the C3 fraction of complement with cobra venom factor (CVF), administered three times (36, 41). This treatment eliminated most C3, as determined by ELISA (Fig. 3b), and a similar schedule with a 33% lower dose has been shown to fully inhibit complement activity in mouse serum (36). All C3-depleted mice treated with VMC-2 survived mousepox, while all control mice depleted of C3 but treated with IgG1 succumbed (Fig. 3c).

Fig 3
Late control of ECTV by anti-L1R/EVM072 does not require antibody effector functions. (a) Virus titers at 7 dpi in the indicated organs of B6.D2-D6-Fcer1γ0/0 mice treated with the indicated MAbs at 5 dpi. (b) C3 determined by ELISA at the indicated ...

ECTV deficient in EV spreads in the liver and is lethal to SCID mice.

The data presented above suggested that following LH spread, ECTV dissemination within the liver is more dependent on MV than on EV. It has previously been shown that VACV deficient in F13L is unable to make EV, becoming manifest by its formation of small plaques in tissue culture. It has also been demonstrated that VACV deficient in F13L is highly attenuated (42). Very recently, we reported the generation of ECTV deficient in EVM036 (ECTV-Δ036), the ortholog of VACV F13L. Similar to its VACV counterpart, ECTV-Δ036 has a very small plaque phenotype in tissue culture, indicating that EVs are very important for ECTV spread in cultured cells. Furthermore, ECTV-Δ036 is nonpathogenic in immunocompetent BALB/c mice even at high doses (32). However, ECTV-Δ036 was lethal to SCID mice infected in the footpad (P ≤ 0.01; Fig. 4a), but the time of death was highly variable. This suggested that in the absence of adaptive immunity, an OPV deficient in EV can still disseminate lymphohematogenously, albeit inefficiently. To determine whether ECTV-Δ036 kills immunodeficient mice by replicating in the liver, we infected SCID mice i.p. with a high dose of ECTV-Δ036, which permitted the rapid and synchronized seeding of the liver. Under these conditions, ECTV-Δ036 was rapidly lethal (P ≤ 0.01; Fig. 4b), and transcripts of an ECTV gene (EVM166) in the liver and spleen increased 104-fold from day 2 to day 6, suggesting rapid replication in these organs (Fig. 4c). Furthermore, immunohistochemical staining of the liver with Abs to EVM135 showed few infected cells at 2 dpi but massive infection at 8 dpi (Fig. 4d), demonstrating efficient EV-independent intrahepatic ECTV spread.

Fig 4
ECTV unable to make enveloped virus spreads in the liver and is lethal to SCID mice. (a) SCID mice were infected with the indicated doses of ECTV wild type (WT) or ECTV-Δ036 in the footpad. Survival was monitored. (b) As for panel a, but the mice ...

DISCUSSION

Given the threat of intentional release of variola virus, the zoonotic potential of other OPVs, and the possible complications of the live smallpox vaccine, OPVs still constitute a risk to human health. Hence, development of a cocktail of MAbs with the potential of curing disseminated OPV disease and replacing VIG is of interest (27). Our work described here demonstrates that as measured by survival, viral loads, and liver damage, neutralizing Abs to the MV protein L1R/EVM072 are more effective than comet-inhibiting Abs to the EV proteins A33R/EVM135 and B5R/EVM155 at controlling an otherwise lethal ECTV infection when given after viral dissemination to susceptible but otherwise immunocompetent mice. We have recently shown that blocking IgG1 MAbs to B18R/EVM166, which encode a secreted, nonstructural type I interferon decoy receptor, also cures mousepox when administered after viral dissemination (34). While MAb VMC-78 to the EV protein A33R/EVM135 promoted survival when given at 5 dpi, it did not significantly decrease virus loads or liver pathology 2 days after treatment. Furthermore, MAb VMC-14 to the EV protein B5R/EVM155 was not protective even when given at the time of infection. These results were surprising, because both proteins have been shown to be good targets for vaccines in various ECTV and/or VACV models (1625, 36, 38). With the cautionary note that our experiment with ECTV does not necessarily extend to every OPV, our results suggest that MAbs to L1R/EVM072 and to B18R/EVM166 are both excellent candidates to be included in MAb cocktails for the late treatment of OPV diseases because the former controls virus spread within tissues and the latter restores type I interferon signaling. The results also suggest that neutralizing Abs to other MV proteins and blocking Abs to other secreted virulence factors should be explored as additional components for VIG replacement.

It has recently been shown that a major mechanism whereby Abs to EV protect from VACV is through the activation of complement (36, 37, 41), and all our MAbs are of the IgG1 isotype, which is known to lack effector functions. Thus, it is possible that the deficient protection offered by VMC-14 and VMC-78 that we observed is due to their isotype, and this could be explored using IgG2 MAbs. However, this does not seem to be the only reason, because rabbit anti-L1R was also more potent and rabbit Abs have been shown to be capable of using complement to help protect from VACV (36). It would also be of interest to test these Abs for their ability to cure OPV infections other than ECTV and VACV. In addition, it is possible that combinations of specific EV, MV, and virulence factor MAbs of various isotypes will be even more effective at curing late mousepox than single Ab therapy or VIG, and this could be tested.

It is also important to note that we do not think that the L1R Abs can clear ECTV single-handedly. Rather, we think that passive immunization temporarily reduces virus loads, allowing the development of active immunity. This is supported by our previous reports that passive transfer of Abs or memory T cells protects only immunocompetent hosts from mousepox (34, 43) and a report by Lustig et al. showing that VIG does not permanently protect SCID mice from VACV challenge (28).

Work with the prototypic OPV VACV established the current model that MVs are important for initial OPV infection, while EVs are essential for their spread within the host (14, 15). Our results indicate that, at least for ECTV, this model must be revised. While the possibility that some EVs are produced in the absence of EVM036 cannot be discarded, our finding that ECTV-Δ036 eventually kills SCID mice when inoculated into the footpad strongly suggests that EVs are very important, albeit not absolutely essential, for LH spread. Unexpectedly, we also showed that the L1R/EVM072 MAb protects mice from lethal mousepox by curtailing intrahepatic spread and that ECTV deficient in EVM036 rapidly disseminates within the liver of immunodeficient mice. Thus, our experiments suggest a model where EVs are important in the initial LH spread, while MVs are key for ECTV intrahepatic spread. While the liver is not thought to be a target for VARV or other human OPV infections, our work suggests the chance that other OPVs preferentially use MV to spread within their target organs. The development of effective and reliable anti-OPV therapies for late exposure requires testing for this previously unsuspected possibility.

ACKNOWLEDGMENTS

We thank the Fox Chase Cancer Center Laboratory Animal and Tissue Culture Facilities for their services and Holly Gillin for assistance in the preparation of the manuscript.

This work was supported by NIAID grant U19AI083008 to L.J.S., NCI grant P30CA006927 to FCCC, and a generous gift from the Kirby Foundation to the FCCC Inflammation Group.

Footnotes

Published ahead of print 17 April 2013

REFERENCES

1. Flint SJ, Enquist LW, Racaniello VR, Skalka AM. 2009. Principles of virology, 3rd ed ASM Press, Washington, DC.
2. Virgin HW. 2007. Pathogenesis of viral infection, p 335–336 In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE, editors. (ed), Fields virology, 5th ed, vol 1 Lippincott Williams & Wilkins, Philadelphia, PA.
3. Chapman JL, Nichols DK, Martinez MJ, Raymond JW. 2010. Animal models of orthopoxvirus infection. Vet. Pathol. 47:852–870. [PubMed]
4. Fenner F, Henderson DA, Arita I, Jezek Z, Ladnyi D., World Health Organization 1988. Smallpox and its eradication. World Health Organization, Geneva, Switzerland.
5. Bray M. 2003. Pathogenesis and potential antiviral therapy of complications of smallpox vaccination. Antiviral Res. 58:101–114. [PubMed]
6. Bray M, Wright ME. 2003. Progressive vaccinia. Clin. Infect. Dis. 36:766–774. [PubMed]
7. Cono J, Casey CG, Bell DM., Centers for Disease and Prevention 2003. Smallpox vaccination and adverse reactions. Guidance for clinicians. MMWR Recomm. Rep. 52(RR-4):1–28. [PubMed]
8. Esteban DJ, Buller RM. 2005. Ectromelia virus: the causative agent of mousepox. J. Gen. Virol. 86:2645–2659. [PubMed]
9. Fenner F. 1994. Mousepox (ectromelia), p 412 In Osterhaus A, editor. (ed), Virus infections of rodents and lagomorphs, vol 5 Elsevier Science, Amsterdam, Netherlands.
10. Wallace GD, Buller RM. 1985. Kinetics of ectromelia virus (mousepox) transmission and clinical response in C57BL/6j, BALB/cByj and AKR/J inbred mice. Lab. Anim. Sci. 35:41–46. [PubMed]
11. Blasco R, Moss B. 1991. Extracellular vaccinia virus formation and cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37,000-dalton outer envelope protein. J. Virol. 65:5910–5920. [PMC free article] [PubMed]
12. Blasco R, Moss B. 1992. Role of cell-associated enveloped vaccinia virus in cell-to-cell spread. J. Virol. 66:4170–4179. [PMC free article] [PubMed]
13. Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE, editors. (ed). 2007. Fields virology, 5th ed Lippincott Williams & Wilkins, Philadelphia, PA.
14. Payne LG. 1980. Significance of extracellular enveloped virus in the in vitro and in vivo dissemination of vaccinia. J. Gen. Virol. 50:89–100. [PubMed]
15. Smith GL, Vanderplasschen A, Law M. 2002. The formation and function of extracellular enveloped vaccinia virus. J. Gen. Virol. 83:2915–2931. [PubMed]
16. Buchman GW, Cohen ME, Xiao Y, Richardson-Harman N, Silvera P, DeTolla LJ, Davis HL, Eisenberg RJ, Cohen GH, Isaacs SN. 2010. A protein-based smallpox vaccine protects non-human primates from a lethal monkeypox virus challenge. Vaccine 28:6627–6636. [PMC free article] [PubMed]
17. Fang M, Cheng H, Dai Z, Bu Z, Sigal LJ. 2006. Immunization with a single extracellular enveloped virus protein produced in bacteria provides partial protection from a lethal orthopoxvirus infection in a natural host. Virology 345:231–243. [PubMed]
18. Fogg C, Lustig S, Whitbeck JC, Eisenberg RJ, Cohen GH, Moss B. 2004. Protective immunity to vaccinia virus induced by vaccination with multiple recombinant outer membrane proteins of intracellular and extracellular virions. J. Virol. 78:10230–10237. [PMC free article] [PubMed]
19. Golden JW, Hooper JW. 2011. The strategic use of novel smallpox vaccines in the post-eradication world. Expert Rev. Vaccines 10:1021–1035. [PubMed]
20. Heraud JM, Edghill-Smith Y, Ayala V, Kalisz I, Parrino J, Kalyanaraman VS, Manischewitz J, King LR, Hryniewicz A, Trindade CJ, Hassett M, Tsai WP, Venzon D, Nalca A, Vaccari M, Silvera P, Bray M, Graham BS, Golding H, Hooper JW, Franchini G. 2006. Subunit recombinant vaccine protects against monkeypox. J. Immunol. 177:2552–2564. [PubMed]
21. Hooper JW, Custer DM, Schmaljohn CS, Schmaljohn AL. 2000. DNA vaccination with vaccinia virus L1R and A33R genes protects mice against a lethal poxvirus challenge. Virology 266:329–339. [PubMed]
22. Hooper JW, Custer DM, Thompson E. 2003. Four-gene-combination DNA vaccine protects mice against a lethal vaccinia virus challenge and elicits appropriate antibody responses in nonhuman primates. Virology 306:181–195. [PubMed]
23. Hooper JW, Golden JW, Ferro AM, King AD. 2007. Smallpox DNA vaccine delivered by novel skin electroporation device protects mice against intranasal poxvirus challenge. Vaccine 25:1814–1823. [PubMed]
24. Hooper JW, Thompson E, Wilhelmsen C, Zimmerman M, Ichou MA, Steffen SE, Schmaljohn CS, Schmaljohn AL, Jahrling PB. 2004. Smallpox DNA vaccine protects nonhuman primates against lethal monkeypox. J. Virol. 78:4433–4443. [PMC free article] [PubMed]
25. Xiao Y, Aldaz-Carroll L, Ortiz AM, Whitbeck JC, Alexander E, Lou H, Davis HL, Braciale TJ, Eisenberg RJ, Cohen GH, Isaacs SN. 2007. A protein-based smallpox vaccine protects mice from vaccinia and ectromelia virus challenges when given as a prime and single boost. Vaccine 25:1214–1224. [PMC free article] [PubMed]
26. Wittek R. 2006. Vaccinia immune globulin: current policies, preparedness, and product safety and efficacy. Int. J. Infect. Dis. 10:193–201. [PubMed]
27. Xiao Y, Isaacs SN. 2010. Therapeutic vaccines and antibodies for treatment of orthopoxvirus infections. Viruses 2:2381–2403. [PMC free article] [PubMed]
28. Lustig S, Maik-Rachline G, Paran N, Melamed S, Israely T, Erez N, Orr N, Reuveny S, Ordentlich A, Laub O, Shafferman A, Velan B. 2009. Effective post-exposure protection against lethal orthopoxviruses infection by vaccinia immune globulin involves induction of adaptive immune response. Vaccine 27:1691–1699. [PubMed]
29. Fang M, Sigal LJ. 2005. Antibodies and CD8+ T cells are complementary and essential for natural resistance to a highly lethal cytopathic virus. J. Immunol. 175:6829–6836. [PubMed]
30. Fang M, Sigal LJ. 2006. Direct CD28 costimulation Is required for CD8+ T cell-mediated resistance to an acute viral disease in a natural host. J. Immunol. 177:8027–8036. [PubMed]
31. Xu RH, Cohen M, Tang Y, Lazear E, Whitbeck JC, Eisenberg RJ, Cohen GH, Sigal LJ. 2008. The orthopoxvirus type I IFN binding protein is essential for virulence and an effective target for vaccination. J. Exp. Med. 205:981–992. [PMC free article] [PubMed]
32. Roscoe F, Xu RH, Sigal LJ. 2012. Characterization of ectromelia virus deficient in EVM036, the homolog of vaccinia virus F13L, and its application for the rapid generation of recombinant viruses. J. Virol. 86:13501–13507. [PMC free article] [PubMed]
33. Aldaz-Carroll L, Whitbeck JC, Ponce de Leon M, Lou H, Pannell LK, Lebowitz J, Fogg C, White CL, Moss B, Cohen GH, Eisenberg RJ. 2005. Physical and immunological characterization of a recombinant secreted form of the membrane protein encoded by the vaccinia virus L1R gene. Virology 341:59–71. [PubMed]
34. Xu RH, Rubio D, Roscoe F, Krouse TE, Truckenmiller ME, Norbury CC, Hudson PN, Damon IK, Alcami A, Sigal LJ. 2012. Antibody inhibition of a viral type 1 interferon decoy receptor cures a viral disease by restoring interferon signaling in the liver. PLoS Pathog. 8:e1002475doi: doi: 10.1371/journal.ppat.1002475. [PMC free article] [PubMed] [Cross Ref]
35. Aldaz-Carroll L, Whitbeck JC, Ponce de Leon M, Lou H, Hirao L, Isaacs SN, Moss B, Eisenberg RJ, Cohen GH. 2005. Epitope-mapping studies define two major neutralization sites on the vaccinia virus extracellular enveloped virus glycoprotein B5R. J. Virol. 79:6260–6271. [PMC free article] [PubMed]
36. Cohen ME, Xiao Y, Eisenberg RJ, Cohen GH, Isaacs SN. 2011. Antibody against extracellular vaccinia virus (EV) protects mice through complement and Fc receptors. PLoS One 6:e20597doi: doi: 10.1371/journal.pone.0020597. [PMC free article] [PubMed] [Cross Ref]
37. Benhnia MR, McCausland MM, Laudenslager J, Granger SW, Rickert S, Koriazova L, Tahara T, Kubo RT, Kato S, Crotty S. 2009. Heavily isotype-dependent protective activities of human antibodies against vaccinia virus extracellular virion antigen B5. J. Virol. 83:12355–12367. [PMC free article] [PubMed]
38. Lustig S, Fogg C, Whitbeck JC, Eisenberg RJ, Cohen GH, Moss B. 2005. Combinations of polyclonal or monoclonal antibodies to proteins of the outer membranes of the two infectious forms of vaccinia virus protect mice against a lethal respiratory challenge. J. Virol. 79:13454–13462. [PMC free article] [PubMed]
39. Takai T, Li M, Sylvestre D, Clynes R, Ravetch JV. 1994. FcR gamma chain deletion results in pleiotrophic effector cell defects. Cell 76:519–529. [PubMed]
40. Fang M, Orr MT, Spee P, Egebjerg T, Lanier LL, Sigal LJ. 2011. CD94 is essential for NK cell-mediated resistance to a lethal viral disease. Immunity 34:579–589. [PMC free article] [PubMed]
41. Benhnia MR, McCausland MM, Moyron J, Laudenslager J, Granger S, Rickert S, Koriazova L, Kubo R, Kato S, Crotty S. 2009. Vaccinia virus extracellular enveloped virion neutralization in vitro and protection in vivo depend on complement. J. Virol. 83:1201–1215. [PMC free article] [PubMed]
42. Vliegen I, Yang G, Hruby D, Jordan R, Neyts J. 2012. Deletion of the vaccinia virus F13L gene results in a highly attenuated virus that mounts a protective immune response against subsequent vaccinia virus challenge. Antiviral Res. 93:160–166. [PubMed]
43. Xu RH, Fang M, Klein-Szanto A, Sigal LJ. 2007. Memory CD8+ T cells are gatekeepers of the lymph node draining the site of viral infection. Proc. Natl. Acad. Sci. U. S. A. 104:10992–10997. [PubMed]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)