PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jcoHomeThis ArticleSearchSubmitASCO JCO Homepage
 
J Clin Oncol. 2011 July 1; 29(19): 2660–2666.
Published online 2011 May 23. doi:  10.1200/JCO.2010.32.4145
PMCID: PMC3646303

Activity of XL184 (Cabozantinib), an Oral Tyrosine Kinase Inhibitor, in Patients With Medullary Thyroid Cancer

Abstract

Purpose

XL184 (cabozantinib) is a potent inhibitor of MET, vascular endothelial growth factor receptor 2 (VEGFR2), and RET, with robust antiangiogenic, antitumor, and anti-invasive effects in preclinical models. Early observations of clinical benefit in a phase I study of cabozantinib, which included patients with medullary thyroid cancer (MTC), led to expansion of an MTC-enriched cohort, which is the focus of this article.

Patients and Methods

A phase I dose-escalation study of oral cabozantinib was conducted in patients with advanced solid tumors. Primary end points included evaluation of safety, pharmacokinetics, and maximum-tolerated dose (MTD) determination. Additional end points included RECIST (Response Evaluation Criteria in Solid Tumors) response, pharmacodynamics, RET mutational status, and biomarker analyses.

Results

Eighty-five patients were enrolled, including 37 with MTC. The MTD was 175 mg daily. Dose-limiting toxicities were grade 3 palmar plantar erythrodysesthesia (PPE), mucositis, and AST, ALT, and lipase elevations and grade 2 mucositis that resulted in dose interruption and reduction. Ten (29%) of 35 patients with MTC with measurable disease had a confirmed partial response. Overall, 18 patients experienced tumor shrinkage of 30% or more, including 17 (49%) of 35 patients with MTC with measurable disease. Additionally, 15 (41%) of 37 patients with MTC had stable disease (SD) for at least 6 months, resulting in SD for 6 months or longer or confirmed partial response in 68% of patients with MTC.

Conclusion

Cabozantinib has an acceptable safety profile and is active in MTC. Cabozantinib may provide clinical benefit by simultaneously targeting multiple pathways of importance in MTC, including MET, VEGFR2, and RET. A global phase III pivotal study in MTC is ongoing (ClinicalTrials.gov number NCT00215605).

INTRODUCTION

The development of antiangiogenic agents targeting the vascular endothelial growth factor (VEGF)/VEGF receptor (VEGFR) signaling pathway has led to key advances in the treatment of cancer. For example, the monoclonal antibody bevacizumab and small-molecule multitargeted VEGFR tyrosine kinase inhibitors (TKIs) sorafenib and sunitinib have produced statistically significant survival improvements in some cancers.13 However, these survival improvements have been modest, and attempts to demonstrate single-agent therapeutic utility across a wide range of cancers have been unsuccessful. A potential explanation for these results may come from recent preclinical and clinical studies indicating that despite providing some short-term clinical benefit, agents targeting the VEGF signaling pathway can ultimately promote tumor aggressiveness, with invasion into neighboring tissues and metastasis to distant sites.47 A mechanism for these untoward effects of anti-VEGF therapy may be the upregulation of MET, a proinvasive receptor tyrosine kinase (RTK) implicated in tumor growth, metastasis, and angiogenesis.8,9

Cabozantinib is a potent inhibitor of RTKs, including MET, VEGFR2, and RET.10,11 In preclinical studies, cabozantinib exhibited significant antiangiogenic and antitumor activity in a broad range of tumor models, including a model of medullary thyroid cancer (MTC) with an activating RET mutation. Importantly, it has also been shown in preclinical studies that treatment with cabozantinib results in decreased tumor invasiveness and decreased metastasis compared with either vehicle control or agents targeting VEGF signaling without MET inhibition.11 This report focuses on results from a phase I open-label dose-escalation study of cabozantinib in patients with a wide range of advanced malignancies, including an expanded cohort of patients with advanced MTC.

Activating mutations in RET play a central role in tumorigenesis in both inherited and sporadic forms of MTC. As a component of multiple endocrine neoplasia type 2 syndromes, hereditary MTC comprises 25% to 30% of all MTC cases and is caused by germline gain-of-function mutations in the gene encoding RET.12 In the sporadic form of the disease, somatic mutations in RET occur in 30% to 50% of patients. In addition to RET, MET and its ligand, hepatocyte growth factor, also seem to play significant roles in the pathogenesis of MTC, in which both proteins are frequently coexpressed.13 Notably, it has been shown that overexpression of MET can be driven by activation of the RET signaling pathway, albeit in a cell type different from that giving rise to MTC.14 In addition to MET and RET, the VEGF signaling pathway has also been implicated in MTC and is likely involved in disease progression.15,16

Patients with metastatic MTC have a poor prognosis, with approximately 25% and 10% alive at 5 and 10 years, respectively.17 Furthermore, MTC is largely unresponsive to conventional cytotoxic chemotherapy and radiotherapy.18 Doxorubicin, the only US Food and Drug Administration–approved treatment for patients with advanced thyroid cancer, has resulted in transient tumor response rates in 0% to 20% of patients with MTC and is associated with significant toxicity.19,20 Although the results of a phase III trial of vandetanib have recently been presented showing improved progression-free survival,21 there remains an unmet medical need in MTC; no randomized trials have yet been associated with increased overall survival in this patient population.

PATIENTS AND METHODS

Patients

The study enrolled adult patients with histologically confirmed solid tumors or lymphomas that were metastatic or unresectable who were no longer responding to conventional therapies or who had disease for which no standard therapy exists. All patients had an Eastern Cooperative Oncology Group performance status score of 0 to 2 and life expectancy longer than 3 months. Additional parameters for study entry included adequate neutrophil counts (≥ 1,500/μL), platelets (≥ 100,000/μL), hemoglobin (≥ 9g/dL), bilirubin (≥ 1.5 mg/dL), serum creatinine (< 1.5 mg/dL), and ALT and AST (≤ 2.5 × upper limit of normal with no liver involvement or ≤ 5 × upper limit of normal with liver involvement). Patients were ineligible if they had received chemotherapy or immunotherapy within 4 weeks, nitrosourea therapy within 6 weeks, or radiotherapy or investigational agents within 30 days of the first dose of cabozantinib. Patients with brain metastases, uncontrolled intercurrent illness, or known HIV infection were ineligible. This study was conducted in accordance with the Declaration of Helsinki. Patients provided written informed consent according to institutional guidelines. The study was approved by the institutional review board at each study center.

Study Design and Treatment

Using a three-plus-three study design, patients were assigned to 13 dose levels exploring two different schedules of administration and formulations of cabozantinib. Dose levels one to nine (0.08, 0.16, 0.32, 0.64, 1.28, 2.56, 5.12, 7.68, and 11.52 mg/kg) explored an intermittent schedule (once daily for 5 days followed by 9 days rest) with a suspension formulation, dose levels 10 to 11 (175 and 265 mg) used continuous fixed daily dosing with a suspension formulation, and dose levels 12 to 13 (175 and 250 mg) and the MTD (175 mg) cohort used continuous fixed daily dosing with capsules. All patients were instructed to take cabozantinib in a fasting state (2 hours before and 1 hour after administration of cabozantinib). Patients continued to take cabozantinib until disease progression or unacceptable adverse events. Intrapatient dose escalation was allowed once the MTD was established with the capsule formulation, and dose holds and reductions were allowed for management of adverse events (AEs). Additionally, an expanded MTD cohort that included patients with metastatic and/or locally advanced or locally recurrent MTC not appropriate for surgical resection was initiated.

Assessment of Safety and Efficacy

AEs were assessed at each visit and graded according to the Common Terminology Criteria for Adverse Events, version 3.0. Safety assessments included an evaluation of the AEs, physical examination, and evaluations of performance status, body weight, complete blood count, serum chemistries, urinalysis, and electrocardiography at regularly scheduled intervals. Dose-limiting toxicity (DLT) was defined as either the occurrence of a treatment-related AE of potential clinical significance such that additional dose escalation would expose patients in higher dose cohorts to risk of irreversible medical harm or require medical treatment to avoid irreversible medical harm or any cabozantinib-related grade 3 or 4 nonhematologic toxicity, including grade 3 nausea and/or vomiting and grade 3 diarrhea despite prophylaxis and/or treatment or the following grade 4 hematologic toxicities: thrombocytopenia, neutropenia of more than 5 days duration, and neutropenia of any duration with fever or documented infection.

Tumor response was assessed by investigators using RECIST (Response Evaluation Criteria in Solid Tumors) at baseline, at 28 days after the first dose of cabozantinib, and every 8 weeks thereafter.22 Tumor response was confirmed by repeat imaging at least 28 days after the initial response assessment. Pharmacokinetic, calcitonin, carcinoembryonic antigen (CEA), and genotyping analyses were done. A detailed description of the methods is included in the Appendix (online only).

RESULTS

Patients

This study began in September 2005, the last patient was enrolled in August 2008, and a total of 85 patients were enrolled. The results presented here reflect a data cutoff of April 2010. Table 1 shows baseline characteristics of the patient population, including primary tumor sites. Median age was 56 years. Sixty-six of the patients (78%) were male, and 64 of the patients (75%) had prior chemotherapy. The most common tumor diagnosis was MTC (n = 37; 44%). The study population was enrolled across five study centers. Seventy-seven patients with measurable disease according to RECIST were evaluable for response, including 35 patients with MTC. Two patients with MTC had bone metastases or lesions too small to measure by RECIST but were assessable by computed tomography, magnetic resonance imaging, or bone scan. In the MTC subset, a majority of the cases were sporadic (22 [71%] of 31 patients), with three (10%) of 31 patients presenting with inherited MTC (Table 1).

Table 1.
Baseline Patient Demographics and Clinical Characteristics

Safety Results

DLTs were observed in three dose levels. In dose level 9 (11.52-mg/kg suspension intermittent dosing cohort), two of three patients experienced DLTs, with one experiencing grade 3 PPE and grade 3 AST/ALT elevations and one experiencing grade 3 lipase elevation. In dose level 11 (265-mg suspension daily dosing cohort), two of 10 patients experienced a DLT of mucositis (one with grade 2 and one with grade 3). In dose level 13 (250-mg capsule dosing cohort), two of six patients experienced DLTs, with one experiencing grade 3 AST elevation and one experiencing grade 3 PPE, thus establishing the next-lowest well-tolerated dose level of 175 mg daily as the maximum-tolerated capsule dose and the dose for the ongoing phase III trial XL184-301.

A total of 77 patients (90%) reported at least one treatment-related AE (Table 2). Of these, 43% reported grade 1 or 2 AEs. The most frequent treatment-related AEs (> 20% of patients) were diarrhea, fatigue, decreased appetite, nausea, PPE, rash, increased AST level, vomiting, and mucosal inflammation. One grade 4 event (pulmonary embolism, dose level 10, 175-mg suspension daily dosing) was assessed as related to cabozantinib. Treatment-related hypertension of grade 3 severity occurred in two patients (2%) and of grade 1 to 2 severity occurred in 12 patients (14%), most of whom had a history of hypertension. There were no treatment-related grade 5 events, and the nature of AEs was similar between patients with MTC and those with other solid tumor diagnoses.

Table 2.
Treatment-Related Adverse Events

Response

Of the 35 patients with MTC with measurable disease, confirmed objective response was achieved in 10 (29%; 95% CI, 15% to 45%), each of whom had a partial response (Table 3). Five of the 10 responders had a partial response at the first radiologic assessment, and responses occurred most commonly at the 175-mg dose level. Overall, 17 patients (49%) experienced a 30% or greater decrease in the sum of tumor measurements compared with baseline measurements (Fig 1A), including seven patients without confirmed response resulting either from lack of response based on the subsequent confirmatory scan or from study discontinuation before the subsequent scan. Stable disease of at least 6 months duration (range, 6.4 to 31.1 months) was observed in 15 (41%) of the 37 patients with MTC.

Table 3.
Tumor Response in Patients With MTC According to RECIST
Fig 1.
(A) Best radiologic response in patients with medullary thyroid cancer (MTC) with one or more postbaseline scans (n = 34). Scan data available for 34 patients with MTC with measurable disease and at least one postbaseline scan. Two patients had nonmeasurable ...

Stable disease of at least 6 months or confirmed partial response was observed in 25 (68%) of 37 patients with MTC. Onset of tumor response in the MTC population was reported as early as day 21 and as late as day 365. Median time to response was 49.5 days, whereas the median duration of response has not yet been reached (range, 3.9 to > 35 months) with a minimum of 17 months of follow-up. Of the 20 (54%) of 37 patients with MTC who had received prior therapy, 16 (43%) of 37 were treated with TKIs (Table 1). Three of the 10 responses occurred in patients with MTC in whom prior TKI therapies had failed, including those known to inhibit RET (eg, vandetanib and sorafenib),2327 as well as in patients who had previously received treatment with cytotoxic chemotherapy.

For the non-MTC subset, stable disease of at least 3 months was reported in 38% of patients (Fig 1B). This included the following tumors: colorectal (three patients), melanoma (two patients), and carcinoid (two patients) tumors and adenoid cystic, follicular thyroid, papillary thyroid, hepatocellular, renal cell carcinoma, cutaneous T-cell lymphoma, salivary gland, alveolar sarcoma, clear-cell sarcoma, mesothelioma, and neuroendocrine tumor originating in the thyroid (one patient each). The patient with a neuroendocrine tumor originating in the thyroid also experienced tumor shrinkage of more than 30% (Fig 1B).

Genotyping Analyses

Germline and somatic RET genotyping for the patients with MTC was performed using DNA isolated from whole blood (n = 30) and tumor (n = 31), respectively. Activating RET mutations were detected in tumors from 25 (81%) of 31 patients with MTC (Table 1; Fig 1). Notably, the tumor of one patient with rapid clinical progression exhibited no detectable RET mutation in the analyzed clinically relevant mutational hotspots; however, a BRAF activating mutation (G469A) and a 2.2-fold amplification of the gene encoding MET were detected (Appendix Table A1, online only). Of the four remaining patients without detectable RET hotspot mutations, one was found to have a 1.7-fold amplification of MET in the tumor. In addition, sequence analysis of MET in tumor DNA from a subset of patients with MTC (n = 15) did not reveal any mutations (Appendix Table A1). A strict correlation was not observed between RET mutational status and either clinical response or time on study.

Pharmacokinetics

The peak plasma concentration and area under the plasma concentration-time curve up to the last quantifiable time point for cabozantinib increased in proportion to dose in the individual dosing cohorts. After repeat daily dosing, terminal half-life values (mean ± standard deviation) for cabozantinib were 91.3 ± 33.3 hours (n = 23), and apparent steady-state plasma levels were reached by day 15. Steady-state clearance for the 175-mg capsule dose derived from repeat dose data was 4.2 ± 1.5 L/h. Patients receiving 175-mg cabozantinib capsules had four- to five-fold higher steady-state exposure (area under the curve) compared with day 1 (7.68 ± 2.85 μg * h/mL; n = 23 v 41.6 ± 15.5 μg * h/mL; n = 23), indicating that cabozantinib accumulated with repeat daily dosing (Appendix Table A2, online only). There was no significant difference in exposure between patients with MTC and those without MTC.

Other Biomarker Analyses

Reductions in serum calcitonin ranging from 3% to 99% below baseline were observed in 28 of 30 patients with any measurable tumor shrinkage (Fig 2). Of the 28 patients with CEA data and measurable disease, 24 had a reduction in CEA ranging from 13% to 94% below baseline.

Fig 2.
Relationship between maximal tumor shrinkage and maximal decrease in calcitonin and/or carcinoembryonic antigen (CEA) in patients with medullary thyroid cancer (MTC; n = 30). Lack of correlation between maximal tumor shrinkage and maximal change in calcitonin ...

Changes were observed in the levels of circulating biomarkers related to the mechanism of action of cabozantinib, including placental growth factor, VEGF-A, soluble VEGFR2, erythropoietin, and soluble MET (Appendix Fig A1, online only). In addition, decreased phosphorylation of MET and RET was observed in skin biopsies obtained from one patient with MTC (Appendix Fig A2, online only).

DISCUSSION

This phase I study of cabozantinib demonstrated that the drug is active in MTC, with an acceptable spectrum of toxicity. MTC is a neuroendocrine malignancy arising from parafollicular calcitonin-producing C cells, a neural crest-derived tissue that normally expresses the RET RTK.26,28 A detailed understanding of the molecular lesions associated with MTC has spurred development of new therapeutic approaches for patients with metastatic disease. RTK inhibitors targeting RET and/or VEGFR2 have been reported to result in partial response rates as high as 20% in this disease.2325,2931 Cabozantinib is among the first molecules in the class of dual RET/VEGFR2 inhibitors to also inhibit MET, an RTK that is overexpressed in many human tumors, including those of the thyroid epithelium.13 On the basis of preclinical data, this attribute of cabozantinib may result in decreased tumor invasiveness and metastatic spread compared to VEGF pathway inhibition without MET inhibition.11

Frequently reported AEs of cabozantinib are largely consistent with those of other agents that target RTKs, including VEGFR2, KIT, and RET.24,25,31 The incidence of hypertension (16% all grades, including 2% grade 3) reported in this study (Table 2) is lower than expected, compared with the incidence of treatment-related hypertension in recent studies with other TKIs, including motesanib29 and axitinib.32

The confirmed partial response rate of 29%, rapidity of response, and prolonged duration of response observed in a largely heavily pretreated population of patients with MTC that included prior TKI/RET-inhibitor therapy, including vandetanib, compares favorably with efficacy reported in other trials of TKIs in MTC.23,25,31,33 However, the clinical significance of the reported prolonged stable disease in this patient group is uncertain because of the lack of evidence of disease progression before study entry. Fifty-four percent of patients with MTC had received prior therapy (Table 1), including 16 patients (43%) who were treated with TKIs. One patient with MTC harbored an activating BRAF mutation, a rare finding in this disease group.33 BRAF is known to signal downstream of the RTKs targeted by cabozantinib, which may account for the lack of response in this patient (Figs 1A and B).

Evidence of tumor regression was observed in patients with and without identified RET mutations in the analyzed clinically relevant mutational hotspots, suggestive of anticancer effects potentially attributable to inhibition of targets other than RET, such as MET and/or VEGFR2, or to as yet unknown aberrations in the RET pathway. Notably, evidence of durable tumor shrinkage or stable disease was observed in 12 of 15 patients with MTC with a somatic M918T mutation in RET (treatment duration range, 6 to 38 months), which has been shown to be a strong negative prognostic indicator for metastasis-free and overall survival.34 This degree of durable response in patients with the M918T mutation contrasts with the limited clinical benefit of motesanib, a RET and VEGFR inhibitor, in similar patients.29

Exposure to cabozantinib resulted in significant changes in levels of the circulating biomarkers placental growth factor, VEGF-A, soluble VEGFR2, and erythropoietin, consistent with changes observed with other antiangiogenic agents.35 Levels of soluble MET in plasma increased during treatment, a finding consistent with preclinical observations made with a MET-targeted monoclonal antibody,36 and an analysis of skin samples from a patient with MTC revealed decreased phosphorylation of MET and RET after administration of cabozantinib. In addition, although calcitonin and CEA generally decreased from baseline in patients with any measurable tumor shrinkage (Fig 2), a significant correlation between the magnitude of tumor reduction and magnitude of reduction of calcitonin was not observed. The lack of correlation between calcitonin changes and tumor reduction may be the result of a pharmacodynamic effect of cabozantinib on RET, in that RET is known to mediate calcitonin secretion via modulation of calcitonin gene transcription.37

In summary, these phase I results indicate that cabozantinib is active in patients with MTC, including those who harbor somatic RET mutations and are potentially at high risk for progression and death.34 Cabozantinib has an acceptable safety profile and dose-dependent exposure and half-life supporting once daily dosing, with only moderate inter-individual variability. Future studies will evaluate the need for administration of the drug in a fasting state. Furthermore, cabozantinib is active in patients who have progressed while receiving prior therapies, including other inhibitors of RET and VEGFR2. An international phase III study of cabozantinib is ongoing in patients with progressive MTC.

Acknowledgment

We thank Charlotte Cione, RN (Fox Chase Cancer Center, Philadelphia, PA), for protocol support and Geetha Shankar, PhD (Exelixis, South San Francisco, CA), for preparation of the manuscript.

Appendix

Additional Methods

Study design and treatment.

The size of the expanded maximum-tolerated dose (MTD) cohort was determined to ensure a total of 31 to 34 patients treated at the MTD to identify common toxicities of cabozantinib. With 31 to 34 patients enrolled at the MTD, common toxicities (ie, those with an incidence of 10%) are observed with a probability of at least 96%, and very common toxicities (ie, those with an incidence of at least 20%) are observed with a probability of at least 99.9%.

Pharmacokinetics, calcitonin, and carcinoembryonic antigen analyses.

Plasma samples for pharmacokinetic (PK) analysis were collected from patients at various time points on days 1, 5, 8, 15, and 19. Timing and extent of sample collection allowed profiling of single-dose and steady-state PKs (Appendix Table A2). Cabozantinib concentrations were measured using liquid chromatography and mass spectrometry, and PKs were determined by noncompartmental analysis using WinNonlin (Scientific Consultant, Apex, NC). Additionally, for patients with medullary thyroid cancer (MTC), serum calcitonin and carcinoembryonic antigen (CEA) levels were determined using immunometric assays at each participating institution.

Genotyping analyses.

DNA was extracted from whole blood samples from patients with MTC, and exons 10 through 20 of the gene encoding RET were sequenced to determine germline mutational status. In addition, in those individuals without a germline mutation, DNA was extracted from archival tumor slides, and exons 10, 11, 13, 15, and 16 were sequenced. Archival tumor material from some patients was also analyzed for mutations in BRAF and amplification as well as mutation of the gene encoding MET.

Biomarker analysis.

Plasma samples for pharmacodynamic analysis were collected on days 1, 2 and 8 in dose levels one to five and on days 1, 5, 15, 18, and 29 in subsequent dose levels (six to 13, expanded MTD cohort). Specific pharmacodynamic plasma biomarkers were determined by ELISA at Pathway Diagnostics (Malibu, CA). Plasma soluble MET was determined by ELISA at Exelixis (South San Francisco, CA). For plasma biomarker levels below the limit of quantification, the value of the lower limit of quantification was used. Changes in plasma levels during treatment with cabozantinib were normalized to baseline level at day 1 (D1). Usually, normalization of data by dividing day X (DX) by D1 leads to compression of any downregulated biomarkers to values between 1 and 0, thus reducing the dynamic range. To better represent the dynamic range of downregulated plasma biomarkers, fold-change was calculated using the following conditional formula:

  • If the post-treatment biomarker value (DX) is greater than baseline (D1), then fold-change equals (DX/D1 − 1).
  • If the baseline value is greater, meaning the marker is downregulated, then fold-change equals −(D1/DX − 1).
  • If the level of a marker is unchanged, the fold-change equals zero. The used equation is: IF (value DX > D1, DX/D1 − 1, − [D1/DX − 1]).

Statistical analyses were performed using a paired t-test relative to baseline. Resultant P values are shown without adjustment for multiplicity.

Optional serial skin samples (day 1 predose and day 29 postdose in cycle one) were collected from a patient dosed at the MTD of 175 mg once daily and frozen in optimal cutting temperature embedding medium. Samples were processed and analyzed at Exelixis using fluorescence-based immunohistochemistry. Skin samples were sectioned at 10 μm and immunostained. Fluorescence-based immunohistochemistry images were captured using a Zeiss AxioImager microscope (Carl Zeiss, Oberkochen, Germany) and Axiovision software (Carl Zeiss) followed by quantification using MetaMorph software (Molecular Devices, Sunnyvale, CA). The normalized intensity score was calculated according to the equation below, and statistical analysis was performed using t-test.

  • Σ IntensityRed Pixel × (AreaRed Pixel/AreaBlue Pixel)

DNA extraction.

DNA was isolated from archival tumor samples and analyzed for alterations in genes relevant to the target profile of cabozantinib. Quantitative polymerase chain reaction (PCR) was used to evaluate relevant gene amplification in the same samples.

Genomic DNA was isolated from formalin-fixed paraffin-embedded biopsies (Sjøholm M et al: Cancer Epidemiol Biomarkers Prev 14:251-255, 2005). For the separation of tumor and adjacent normal tissue, manual microdissection guided by an hematoxylin and eosin–stained serial section was performed. DNA extraction from blood was done using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany).

Mutational analysis of RET, MET, and BRAF.

Genomic DNA was amplified by PCR using primers flanking known mutational hotspots (Appendix Table 3). PCR reactions were performed in 25 μL and consisted of: 1× PCR buffer, 1 to 5 ng of genomic DNA, 0.3 μmol/L each primer, 0.1 mmol/L each deoxynucleoside triphosphates, 0.75 unit of TaKaRa LA Taq DNA Polymerase (TaKaRa Bio USA, Madison, WI). For amplification of MET sequences, dimethyl sulfoxide was added to a final concentration of 5%. After an initial cycle of denaturation at 94°C for 2 minutes, amplifications were performed as follows: 14 cycles of denaturation at 94°C for 20 seconds, annealing at 63°C (−0.5°C each cycle) for 45 seconds, and extension at 72°C for 30 seconds; 25 cycles of denaturation at 94°C for 20 seconds, annealing at 56°C for 45 seconds, and extension at 72°C for 30 seconds; and final extension at 72°C for 10 minutes. The PCR products were cleaned up with ExoSAP-IT (USB, Cleveland, OH) according to manufacturer instructions and sequenced bidirectionally using the same PCR primers as the sequencing primers. Sequencing reaction products were analyzed on automated ABI 3730XL sequencers (Applied Biosystems, Foster City, CA), and traces were analyzed using the Mutation Surveyor software package (SoftGenetics, State College, PA).

Quantitative real-time PCR of MET amplification.

The sequences of the PCR primer pairs and fluorogenic minor groove binding probes (all listed from 5′ to 3′) used for MET copy number analyses are as follows:

  • MET_F, TGTTGCCAAGCTGTATTCTGTTTAC
  • MET_R, TCTCTGAATTAGAGCGATGTTGACA
  • MET_probe, 6FAM-TGGATAATTGTGTCTTTCTCTAG-MGBNFQ
  • ALB_F, TGAAACATACGTTCCCAAAGAGTTT
  • ALB_R, CTCTCCTTCTCAGAAAGTGTGCATAT
  • ALB_probe, TET-ACATTCACCTTCCATGCAGA-MGBNFQ
  • COG5_F, TGGAAGATGATGCACAAGATATATTCA
  • COG5_R, CCAACTAACAGGTCAAATTAAACAAACA
  • COG5_probe, TET-CCAAAAAAG CCAGATTATGA-MGBNFQ

RNase P forward and reverse primers and probes were purchased as a part of the TaqMan RNase P Control Reagents Kit (Applied Biosystems). PCR reactions were carried out on the ABI PRISM 7900 HT system using TaqMan Universal PCR Master Mix (Applied Biosystems). All samples were analyzed in triplicate, and the relative MET copy number was derived by standardizing the input DNA to three reference genes distributed throughout the genome (ALB, chromosome 4; RNase P, chromosome 14; and COG5, chromosome 7).

Table A1.

Summary of RET and MET Genotyping in Tumor and/or Blood

PatientTumor Change From Baseline (%)RET Status in Blood (germline)RET Status in Tumor (somatic and/or germline)MET Mutational Status (tumor)MET Copy-Number Status (tumor)Other Mutational Status (tumor)
1−30No mutations detected*M918TNot determinedNot determined
2−50C620RC620R, K808E, K821ENot determinedNot determined
3−48No mutations detectedL629_D631>HNot determinedNot determined
4−17C634YC634YNot determinedNo copy-number gain
5−14R982C (uncharacterized)*M918T, R982C*No mutations detectedNot determinedTP53 P72R
6NonmeasurableC611RC611RNo mutations detectedNo copy number gain
7−31No mutations detected*No mutations detectedNot determinedNo copy-number gain
8−23No mutations detectedC634RNot determinedNot determinedTP53 P72R
935No mutations detectedNo mutations detectedNo mutations detected1.4-2.2× copy-number gainBRAF G469A
10−54No mutations detected*No mutations detected*Not determined1.6-1.7× copy-number gain
11−40No mutations detectedC620WNot determinedNot determined
12−30No mutations detectedM918TNo mutations detectedNo copy-number gain
13−41No mutations detectedNo mutations detectedNot determinedNot determined
14−24Not determinedD898-E901 delNo mutations detectedNot determined
15−50No mutations detected*C634R*No mutations detectedNo copy-number gain
16−46No mutations detectedM918TNo mutations detectedNo copy-number gain
17N/ANot determinedNo mutations detectedNot determinedNot determined
18−38No mutations detectedM918TNot determinedNot determined
19−14No mutations detected*E632-T636 del*§Not determinedNot determined
200No mutations detected*M918T*Not determinedNo copy-number gain
21−33No mutations detectedM918TNo mutations detectedNo copy-number gain
22−3No mutations detectedM918TNo mutations detectedNo copy-number gain
23−24No mutations detectedM918TNo mutations detectedNo copy-number gain
24−25No mutations detected*M918T*No mutations detectedNo copy-number gain
25−21No mutations detectedA883FNot determinedNot determined
26−48No mutations detectedM918TNo mutations detectedNo copy-number gain
27−23No mutations detectedM918TNo mutations detectedNo copy-number gain
28−44No mutations detectedM918TNo mutations detected1.4-1.8× copy-number gainTP53 P72R
29−30No mutations detectedM918TNo mutations detectedNot determined
30−44No mutations detectedM918TNo mutations detectedNo copy-number gain
31NonmeasurableNo mutations detected*No mutations detected||Not determinedNot determined

Abbreviation: N/A, not applicable.

*G691S polymorphism.
Known activating mutations.
Patient discontinued prior to postbaseline scan.
§Del (E632-T636) mutation has not yet been functionally characterized, but mutants in this region (eg, delE632-L633 or C634R) have been shown to be activating, presumably by inducing ligand-independent dimerization.
||CTT769CTG polymorphism.

Table A2.

Summary of Pharmacokinetics (mean ± SD) for Cabozantinib After Single or Repeat Dose

Dose Level (mg/kg or mg)Cmax (ng/mL)
AUC0-last (μg * h/mL)
Single DoseRepeat DoseSingle DoseRepeat Dose
0.088.28 ± 2.5834.2 ± 20.70.324 ± 0.1211.89 ± 1.09
0.1611.9 ± 3.6270.0 ± 51.60.445 ± 0.2053.02 ± 2.89
0.3245.7 ± 21.1198 ± 43.91.670 ± 0.87211.4 ± 4.81
0.6478.3 ± 34.6322 ± 1101.820 ± 1.05013.1 ± 3
1.28247 ± 66.3603 ± 96.88.910 ± 4.21031.5 ± 10.3
2.561,040 ± 67881.9 ± 34.1
5.122,590 ± 1030148 ± 57.2
7.683,030 ± 1,140212 ± 73.8
11.523,540 ± 560320 ± 30.9
175306 ± 1831,410 ± 6993.680 ± 0.95321.2 ± 13.1
265351 ± 96.81,560 ± 6025.330 ± 0.19724.3 ± 10.2
175544 ± 2582,310 ± 8847.680 ± 2.85041.6 ± 15.5
250570 ± 2082,040 ± 4889.590 ± 3.16038.3 ± 12.8

NOTE. Dose levels 0.08-1.28 mg/kg, three to four patients/cohort, 5 + 9 regimen, PIB formulation: Samples were collected over 72 hours after day 1 dosing or 96 hours after day 8 dosing. Dose levels 2.56-11.52 mg/kg, three to four patients/cohort, 5 + 9 regimen, PIB formulation: Samples were collected over 168 hours after day 5 dosing. Dose levels 175-mg cohort (three patients) and 265-mg cohort (nine patients), daily regimen, PIB formulation: Samples were collected over 24 hours on days 1 and 19. Dose levels 175-mg cohort (12 patients) and 250-mg cohort (four to five patients), daily regimen, capsule formulation: Samples were collected over 24 hours on days 1 and 19.

Abbreviations: SD, standard deviation; Cmax, maximum plasma concentration; AUC0-last, area under the plasma concentration-time curve up to the last quantifiable time point.

Table A3.

Polymerase Chain Reaction Primer Sequences for Mutational Analysis

GeneExonForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
BRAF11TCCCTCTCAGGCATAAGGTAACGAACAGTGAATATTTCCTTTGAT
    15TCTAAGAGGAAAGATGAAGTACTATGAGACCTTCAATGACTTTCTAGTAA
RET10ACACTGCCCTGGAAATATGGGGACCTCAGATGTGCTGTTGA
    11ATGAGGCAGAGCATACGCAGCTCGTCTGCCCAGCGTTGG
    12GGCCTCCTTTAAGGGTCTTGTGGCACAGCAACACCTCTAG
    13CTGGTATGGTCATGGAAGGGAGGCTTCCAGAAAGAGGGAG
    14CCCCTTACTCATTGGGTGGGGGTCAGAAAGATTTGGGGT
    15ACAGGGGATGCAGTATCTGGAATAGCACGAGTCGTCAGGC
    16GCCCCTTCAAAGATGTGTGTTGTAACCTCCACCCCAAGAG
    17AGACCCAGGCTGACATCTGTATCTACTGCCACACCCAAGG
    18TTGGAGACAGAGCACACTGGTGGGAACTCTGAGGGCTAAA
    19GTCCTGGGAGCTCTATGCAGCCTAAGTTGCTGGGCAATGT
    20GGCACAGAAACCACGAGTTTCTCAGAGCTCTTACCCGGTG
MET2TCTTCATTTCTGACAACTGAACTGTTATCTTTCCAAACACCTCC
    2TTCCTTGGTGCCACTAACTACACTATCTGTGGGGAGAATATGCA
    2ATTTATCAGGAGGTGTTTGGATCTTTCGTTTCCTTTAGCC
    2CTTTCATCTGTAAAGGACCGTATTTGTCTAGCAAGCTGGG
    2AAGTGTTTAATATACTTCAGGCTGCCAAAAGAAGCCCTGGATATTCT
    14AGTTCTGGGCACTGGGTCAGTCACAACCCACTGAGGTATATG
    15GTTTCAGTCCCCATTAAATGAGGTGTCAGTTGCTTTCACCATTG
    16TGAAGCTCATAAAGGGTTTGATTTTTCCACAAGGGGA
    17CCATTTCATTGCTCTTCCTATCTTTGAAGGGATGGCTGG
    18TGAGCCATTAAGACCAAACTAGGGCTTACACATCGATTTA
    19CAAATACTGAAGCCACTTGTTTAATCTGGAAAGTAAAAGAGGAGAAACTCAGAGAT

Fig A1.

An external file that holds a picture, illustration, etc.
Object name is zlj9991010390003.jpg

Analysis of selected exploratory biomarkers ([A] vascular endothelial growth factor A [VEGF-A], [B] erythropoietin [EPO], [C] soluble VEGF receptor 2 [sVEGFR2], [D] soluble MET [sMET], [E] placental growth factor [PlGF]) in plasma samples from patients enrolled at the maximum-tolerated dose of 175 mg per day (cohorts 12 and 99; n = 34). Changes in plasma levels during treatment with cabozantinib were normalized to baseline level at day 1. Blue lines indicate patients with medullary thyroid cancer (n = 28); gray lines indicate patients with other solid tumors (n = 6; colon, follicular thyroid, hepatocellular, pancreatic, papillary thyroid, and rectal cancers). D1, day 1; D29, day 29.

Fig A2.

An external file that holds a picture, illustration, etc.
Object name is zlj9991010390004.jpg

Immunohistochemistry analysis of cabozantinib targets MET and RET in serial skin biopsies from a patient dosed at the maximum-tolerated dose of 175 mg once daily. Representative images of each sample with 4',6-diamidino-2-phenylindole counterstain are shown at 200× magnification (zoom). Significant changes in total (nonphosphorylated) MET and RET were not observed (data not shown).

Footnotes

See accompanying editorial on page 2616

Presented at the 14th International Thyroid Congress, September 11-16, 2010, Paris, France; 46th Annual Meeting of the American Society of Clinical Oncology (ASCO), June 4-8, 2010, Chicago, IL; 80th Annual Meeting of the American Thyroid Association (ATA), September 23-27, 2009, Palm Beach, FL; 9th European Thyroid Association–Cancer Research Network, September 5, 2009, Lisbon, Portugal; World Congress on Thyroid Cancer, August 6-10, 2009, Toronto, Ontario, Canada; European Organisation for Research and Treatment of Cancer (EORTC) –National Cancer Institute (NCI) –American Association for Cancer Research (AACR) Conference, October 21-24, 2008, Geneva, Switzerland; 79th Annual Meeting of the ATA, October 1-5, 2008, Chicago, IL; 44th Annual Meeting of ASCO, May 30-June 3, 2008, Chicago, IL; EORTC-NCI-AACR Conference, October 22-26, 2007, San Francisco, CA; 43rd Annual Meeting of ASCO, June 1-5, 2007, Chicago, IL; and EORTC-NCI-AACR Conference, November 7-10, 2006, Prague, Czech Republic.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.

Clinical trial information can be found for the following: NCT00215605.

AUTHORS' DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

Although all authors completed the disclosure declaration, the following author(s) indicated a financial or other interest that is relevant to the subject matter under consideration in this article. Certain relationships marked with a “U” are those for which no compensation was received; those relationships marked with a “C” were compensated. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.

Employment or Leadership Position: John Frye, Exelixis (C); Thomas Müller, Exelixis (C) Consultant or Advisory Role: Steven I. Sherman, Exelexis (C), Bayer (C), Eisai (C), Plexxikon (C), Celgene (C), Oxigene (C), AstraZeneca (C), Semaphore (C), Pfizer (C), Novo Nordisk (C), Roche (C), Veracyte (C); Douglas W. Ball, Exelixis (U); Robert F. Gagel, Exelixis (C), AstraZeneca (C), Eisai (U); Mark J. Ratain, Abbott (C), Genentech (C) Stock Ownership: John Frye, Exelixis; Thomas Müller, Exelixis Honoraria: Razelle Kurzrock, Exelixis; Steven I. Sherman, Exelixis; Robert F. Gagel, Exelixis, AstraZeneca Research Funding: Razelle Kurzrock, Exelixis; Steven I. Sherman, Amgen, AstraZeneca, Genzyme; Douglas W. Ball, Exelixis; Roger B. Cohen, Exelixis; David G. Pfister, Exelixis; David S. Hong, Exelixis; Robert F. Gagel, AstraZeneca; Mark J. Ratain, Bristol-Myers Squibb Expert Testimony: None Other Remuneration: Razelle Kurzrock, Exelixis

AUTHOR CONTRIBUTIONS

Conception and design: Razelle Kurzrock, Steven I. Sherman, John Frye, Thomas Müller, Ravi Salgia

Administrative support: Mark J. Ratain

Provision of study materials or patients: Razelle Kurzrock, Steven I. Sherman, Arlene A. Forastiere, Roger B. Cohen, Ranee Mehra, David G. Pfister, Ezra E.W. Cohen, Forlisa Nauling, David S. Hong, Robert F. Gagel, John Frye, Thomas Müller, Mark J. Ratain

Collection and assembly of data: Douglas W. Ball, Ranee Mehra, David G. Pfister, Linda Janisch, Forlisa Nauling, David S. Hong, Chaan S. Ng, Lei Ye, Robert F. Gagel, John Frye, Thomas Müller, Ravi Salgia

Data analysis and interpretation: Steven I. Sherman, Douglas W. Ball, Arlene A. Forastiere, Roger B. Cohen, David G. Pfister, Ezra E.W. Cohen, Robert F. Gagel, John Frye, Thomas Müller, Mark J. Ratain, Ravi Salgia

Manuscript writing: All authors

Final approval of manuscript: All authors

REFERENCES

1. Garcia JA, Rini BI. Recent progress in the management of advanced renal cell carcinoma. CA Cancer J Clin. 2007;57:112–125. [PubMed]
2. Iyer R, Fetterly G, Lugade A, et al. Sorafenib: A clinical and pharmacologic review. Expert Opin Pharmacother. 2010;11:1943–1955. [PubMed]
3. Judson I, Demetri G. Advances in the treatment of gastrointestinal stromal tumours. Ann Oncol. 2007;18(suppl 10):20–24. [PubMed]
4. de Groot JF, Fuller G, Kumar AJ, et al. Tumor invasion after treatment of glioblastoma with bevacizumab: Radiographic and pathologic correlation in humans and mice. Neuro Oncol. 2010;12:233–242. [PMC free article] [PubMed]
5. Verhoeff JJ, van Tellingen O, Claes A, et al. Concerns about anti-angiogenic treatment in patients with glioblastoma multiforme. BMC Cancer. 2009;9:444. [PMC free article] [PubMed]
6. Bergers G, Hanahan D. Modes of resistance to anti-angiogenic therapy. Nat Rev Cancer. 2008;8:592–603. [PMC free article] [PubMed]
7. Loges S, Mazzone M, Hohensinner P, et al. Silencing or fueling metastasis with VEGF inhibitors: Antiangiogenesis revisited. Cancer Cell. 2009;15:167–170. [PubMed]
8. Stellrecht CM, Gandhi V. MET receptor tyrosine kinase as a therapeutic anticancer target. Cancer Lett. 2009;280:1–14. [PubMed]
9. You WK, McDonald DM. The hepatocyte growth factor/c-Met signaling pathway as a therapeutic target to inhibit angiogenesis. BMB Rep. 2008;41:833–839. [PubMed]
10. Joly A. Simultaneous blockade of VEGF and HGF receptors results in potent anti-angiogenic and anti-tumor effects. Eur J Cancer Supplements. 2006;4:35–35.
11. Sennino B, Naylor RM, Tabruyn SP, et al. Reduction of tumor invasiveness and metastasis and prolongation of survival of RIP-Tag2 mice after inhibition of VEGFR plus c-Met by XL184. Mol Cancer Ther. 2009;8(suppl 12):A13.
12. Blaugrund JE, Johns MM, Jr, Eby YJ, et al. RET proto-oncogene mutations in inherited and sporadic medullary thyroid cancer. Hum Mol Genet. 1994;3:1895–1897. [PubMed]
13. Papotti M, Olivero M, Volante M, et al. Expression of hepatocyte growth factor (HGF) and its receptor (MET) in medullary carcinoma of the thyroid. Endocr Pathol. 2000;11:19–30. [PubMed]
14. Ivan M, Bond JA, Prat M, et al. Activated ras and ret oncogenes induce over-expression of c-met (hepatocyte growth factor receptor) in human thyroid epithelial cells. Oncogene. 1997;14:2417–2423. [PubMed]
15. Soh EY, Duh QY, Sobhi SA, et al. Vascular endothelial growth factor expression is higher in differentiated thyroid cancer than in normal or benign thyroid. J Clin Endocrinol Metab. 1997;82:3741–3747. [PubMed]
16. Tuttle RM, Fleisher M, Francis GL, et al. Serum vascular endothelial growth factor levels are elevated in metastatic differentiated thyroid cancer but not increased by short-term TSH stimulation. J Clin Endocrinol Metab. 2002;87:1737–1742. [PubMed]
17. Schlumberger M, Carlomagno F, Baudin E, et al. New therapeutic approaches to treat medullary thyroid carcinoma. Nat Clin Pract Endocrinol Metab. 2008;4:22–32. [PubMed]
18. Sherman SI. Advances in chemotherapy of differentiated epithelial and medullary thyroid cancers. J Clin Endocrinol Metab. 2009;94:1493–1499. [PubMed]
19. Droz JP, Schlumberger M, Rougier P, et al. Chemotherapy in metastatic nonanaplastic thyroid cancer: Experience at the Institut Gustave-Roussy. Tumori. 1990;76:480–483. [PubMed]
20. Shimaoka K, Schoenfeld DA, DeWys WD, et al. A randomized trial of doxorubicin versus doxorubicin plus cisplatin in patients with advanced thyroid carcinoma. Cancer. 1985;56:2155–2160. [PubMed]
21. Wells SA, Robinson BG, Gagel RF, et al. Vandetanib in locally advanced or metastatic medullary thyroid cancer: A randomized, double-blind phase III trial (ZETA). Presented at the 46th Annual Meeting of the American Society of Clinical Oncology; June 4-8, 2010; Chicago, IL.
22. Therasse P, Arbuck SG, Eisenhauer EA, et al. New guidelines to evaluate the response to treatment in solid tumors: European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J Natl Cancer Inst. 2000;92:205–216. [PubMed]
23. Cohen EE, Rosen LS, Vokes EE, et al. Axitinib is an active treatment for all histologic subtypes of advanced thyroid cancer: Results from a phase II study. J Clin Oncol. 2008;26:4708–4713. [PubMed]
24. Gupta-Abramson V, Troxel AB, Nellore A, et al. Phase II trial of sorafenib in advanced thyroid cancer. J Clin Oncol. 2008;26:4714–4719. [PMC free article] [PubMed]
25. Robinson BG, Paz-Ares L, Krebs A, et al. Vandetanib (100mg) in patients with locally advanced or metastatic hereditary medullary thyroid cancer. J Clin Endocrinol Metab. 2010;95:2664–2671. [PubMed]
26. Knowles PP, Murray-Rust J, Kjaer S, et al. Structure and chemical inhibition of the RET tyrosine kinase domain. J Biol Chem. 2006;281:33577–33587. [PubMed]
27. Lam ET, Ringel MD, Kloos RT, et al. Phase II clinical trial of sorafenib in metastatic medullary thyroid cancer. J Clin Oncol. 2010;28:2323–2330. [PMC free article] [PubMed]
28. Johanson V, Ahlman H, Bernhardt P, et al. A transplantable human medullary thyroid carcinoma as a model for RET tyrosine kinase-driven tumorigenesis. Endocr Relat Cancer. 2007;14:433–444. [PubMed]
29. Schlumberger MJ, Elisei R, Bastholt L, et al. Phase II study of safety and efficacy of motesanib in patients with progressive or symptomatic, advanced or metastatic medullary thyroid cancer. J Clin Oncol. 2009;27:3794–3801. [PubMed]
30. Sherman SI, Wirth LJ, Droz JP, et al. Motesanib diphosphate in progressive differentiated thyroid cancer. N Engl J Med. 2008;359:31–42. [PubMed]
31. Wells SA, Jr, Gosnell JE, Gagel RF, et al. Vandetanib in metastatic hereditary medullary thyroid cancer: Follow-up results of an open-label phase II trial. J Clin Oncol. 2007;25(suppl):303S. abstr 6018.
32. Rini BI, Wilding G, Hudes G, et al. Phase II study of axitinib in sorafenib-refractory metastatic renal cell carcinoma. J Clin Oncol. 2009;27:4462–4468. [PubMed]
33. Goutas N, Vlachodimitropoulos D, Bouka M, et al. BRAF and K-RAS mutation in a Greek papillary and medullary thyroid carcinoma cohort. Anticancer Res. 2008;28:305–308. [PubMed]
34. Schilling T, Bürck J, Sinn HP, et al. Prognostic value of codon 918 (ATG→ACG) RET proto-oncogene mutations in sporadic medullary thyroid carcinoma. Int J Cancer. 2001;95:62–66. [PubMed]
35. Tam BY, Wei K, Rudge JS, et al. VEGF modulates erythropoiesis through regulation of adult hepatic erythropoietin synthesis. Nat Med. 2006;12:793–800. [PubMed]
36. Petrelli A, Circosta P, Granziero L, et al. Ab-induced ectodomain shedding mediates hepatocyte growth factor receptor down-regulation and hampers biological activity. Proc Natl Acad Sci U S A. 2006;103:5090–5095. [PubMed]
37. Akeno-Stuart N, Croyle M, Knauf JA, et al. The RET kinase inhibitor NVP-AST487 blocks growth and calcitonin gene expression through distinct mechanisms in medullary thyroid cancer cells. Cancer Res. 2007;67:6956–6964. [PubMed]

Articles from Journal of Clinical Oncology are provided here courtesy of American Society of Clinical Oncology