PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
Clin Cancer Res. Author manuscript; available in PMC 2014 May 1.
Published in final edited form as:
PMCID: PMC3644028
NIHMSID: NIHMS448132

Tumor-specific isoform switch of the fibroblast growth factor receptor 2 underlies the mesenchymal and malignant phenotypes of clear cell renal cell carcinomas

Abstract

Purpose

We aim to identify tumor-specific alternative splicing events having potential applications in the early detection, diagnosis, prognosis, and therapy of cancers.

Experimental Design

We analyzed RNA-seq data on 470 clear cell renal cell carcinomas (ccRCC) and 68 kidney tissues to identify tumor-specific alternative splicing events. We further focused on the FGFR2 isoform switch and characterized ccRCCs expressing different FGFR2 isoforms by integrated analyses using genomic data from multiple platforms and tumor types.

Results

We identified 113 top candidate alternatively spliced genes in ccRCC. Prominently, the FGFR2 gene transcript switched from the normal IIIb isoform (“epithelial”) to IIIc isoform (“mesenchymal”) in nearly 90% of ccRCCs. This switch is kidney-specific since it was rarely observed in other cancers. The FGFR2-IIIb ccRCCs show a transcriptome and methylome resembling those from normal kidney, whereas FGFR2-IIIc ccRCCs possess elevated hypoxic and mesenchymal expression signatures. Clinically, FGFR2-IIIb ccRCCs are smaller in size, of lower tumor grade, and associated with longer patient survival. Gene set enrichment and DNA copy number analyses indicated that FGFR2-IIIb ccRCCs are closely associated with renal oncocytomas and chromophobe RCCs. A re-examination of tumor histology by pathologists identified FGFR2-IIIb tumors as chromophobe RCCs and clear cell papillary RCCs.

Conclusions

FGFR2 IIIb RCCs represent mis-diagnosed ccRCC cases, suggesting FGFR2 isoform testing can be used in the diagnosis of RCC subtypes. The finding of a prevalent isoform switch of FGFR2 in a tissue-specific manner holds promise for the future development of FGFR2-IIIc as a distinct early detection biomarker and therapeutic target for ccRCC.

Keywords: alternative splicing, renal cell carcinoma, RNA-seq, FGFR2, TCGA

Introduction

Alternative splicing is a key mechanism that provides functional diversity for the eukaryotic genome. Aberrant splicing has been implicated in many human diseases including cancer (1). In breast cancer, an epithelial to mesenchymal transition (EMT) – driven alternative splicing program is thought to induce phenotypic changes during malignant transformation (2). In glioma and other cancers, the glycolysis enzyme pyruvate kinase is shifted from isoform PKM1 to an alternatively spliced isoform PKM2 to enhance aerobic glycolysis and facilitate tumor growth (3, 4). In colorectal cancer, unique expression of an alternative spliced SLC39A14 isoform is considered a specific marker for colon cancer and a surrogate for activation of the WNT-signaling pathway (5). In myelodysplastic syndromes (MDS) and leukemia, mutations were found to strike multiple components of the RNA splicing machinery, with mutations in the splicing factor SF3B1 found in more than 80% of a subtype of MDS named refractory anemia with ring sideroblasts (6), although the molecular targets of these mutations remain unclear. A large body of evidence suggests that cancer-specific splicing events not only can serve as diagnostic markers but also as potential targets for therapeutic intervention. Hence, it is of great interest to detect cancer-specific alternative splicing events in the context of complex cancer genomes and understand their mechanisms in tumorigenesis and tumor progression.

Fibroblast growth factor receptor 2 (FGFR2) belongs to a family of transmembrane receptor tyrosine kinases (designated FGFR1-4) which are involved in regulation of cell proliferation, differentiation, migration, wound healing, and angiogenesis during development and adult life (7). At least 18 FGF ligands (FGFs 1-10 and 16-23) were identified to bind and activate FGFRs with different binding specificities (8). The extracellular domain of FGFR2, which is composed of three immunoglobulin (Ig) -like domains, mediates ligand binding as well as interaction with heparin sulphate proteoglycans. An amino acid segment within the third Ig-like domain is determined by an alternative splicing event at the mRNA level to produce either the FGFR2 IIIb or IIIc isoform. This is regulated in a tissue specific manner with the IIIb isoform expressed in epithelial cells and IIIc in mesenchymal cells, and results in a change in ligand binding specificity. FGFR2 IIIb binds specifically to FGF-1, 3, 7, 10, whereas IIIc binds to FGF-1, 2, and 9 (9, 10). Similar splicing events occur in FGFR1 and FGFR3, but not in FGFR4. Two DNA sequences (ISE-2 and ISAR) located in the intron between IIIb and IIIc exons are required for cell-type specific splicing of exon IIIb (11, 12). The RNA binding proteins ESRP1, 2 are splicing factors known to modulate FGFR2 IIIb splicing through these cis-elements (11). Ectopic expression of ESRP1 or 2 is sufficient to induce the isoform switch from mesenchymal IIIc to epithelial IIIb (12).

Functional studies using mouse models suggest that FGFR2 IIIb plays a critical role in mesenchymal-epithelial signaling during early organogenesis. Studies based on expression of a soluble dominant negative FGFR2 IIIb mutant in mice have implicated FGFR2 in the development of many organs including the limb, lung, skin, kidney and several glandular tissues (1315). Results from studies on knock-out mice corroborate these findings. FGFR2 IIIb null mice are viable until birth, with severe defects of limbs, lung, anterior pituitary gland, and dysgenesis of many organs including the kidney, thymus, and pancreas (1618).

Developmentally, the mammalian kidney is derived from intermediate mesoderm. For kidney formation, both epithelial to mesenchymal transformation (EMT) and the reciprocal mesenchymal-epithelial induction between the epithelial ureteric bud (UB) and the metanephric mesenchyme (MM) occur during embryogenesis (19). Hence, unlike other types of cancers, such as breast and colon cancer, where putative tumor initiating cells originate from epithelial cells, the stem cell origin of renal cell carcinomas (RCC) is less clear due to the presence of both epithelial and mesenchymal cells during kidney development. Histologically, RCCs are divided into several major subtypes, including clear cell RCC (ccRCC), papillary RCC (pRCC), chromophobe RCC (chRCC), and renal oncocytoma (RO). While ccRCC and pRCC have high expression of the mesenchymal marker vimentin, chRCC and RO express the epithelial marker E-cadherin. This suggests different subtypes of RCC may develop from cells of different origins and/or experience EMT during tumor progression.

Alterations of the FGFR2 gene, especially FGFR2 IIIb, have been reported in many cancers, with evidence for both tumor promoting and suppressing roles within specific cancer contexts (20). For example, consistent with a tumor promoting role, FGFR2 IIIb is amplified in a subset of gastric cancers, which are poorly differentiated and do not have ERBB2 amplification (21, 22). Genome wide association studies have identified FGFR2 as a breast cancer susceptibility gene, with SNPs located inside FGFR2 exon 2 correlated with increased risk of breast cancer (23, 24). Transfection of FGFR2 IIIb cDNA into NIH/3T3 fibroblasts induced foci formation (25). In addition, missense activating mutations of FGFR2 were found in endometrial, breast, lung, and ovarian cancer (26, 27). However, FGFR2 IIIb also exhibits cancer-specific properties suggestive of tumor suppressor functions. FGFR2 IIIb expression is down-regulated in solid tumors such as in bladder, prostate, and salivary cancer when compared to adjacent normal epithelial counterparts (2830). High expression of FGFR2 IIIb is associated with a more differentiated phenotype and better prognosis in many cancers, such as liver, colon, and breast cancer (3134). Forced expression of FGFR2 IIIb in prostate, bladder, and salivary adenocarcinoma cells reduces tumor growth through induction of differentiation and apoptosis (30, 31, 35). Thus, the role of FGFR2 in tumorigenesis seems to be largely tumor-specific.

In vitro studies have shown that isoform switch from FGFR2 IIIb to FGFR2 IIIc occurs in prostate cancer cell lines and xenografts, and is accompanied by increased malignancy (36, 37). However, such isoform switch has not been documented in patient samples from any type of tumors. In one study using 19 local and metastatic prostate tumors with normal controls, one single case of tumor was found to have increased FGFR2 IIIc expression while the majority of tumors including the metastatic ones showed prominent expression of FGFR2 IIIb (38). In this study, through mining RNA-seq data on the exon expression level and exon junction reads, we identified specific expression of FGFR2 IIIc in nearly 90% of ccRCCs, as compared to predominant FGFR2 IIIb expression in normal kidneys. This isoform switch of FGFR2 is tissue-specific as it is rarely observed in paired normal and tumor tissues in breast, lung, colon, bladder, and head and neck cancer. Compared to FGFR2 IIIb ccRCCs, FGFR2 IIIc ccRCCs have higher expression of mesenchymal and hypoxic genes, are more malignant, and have worse clinical outcome.

Materials and Methods

Molecular profiling datasets and data preprocessing

Level 3 RNA-seq data (containing data on gene, exon, and junction levels), level 3 SNP array data, and level 2 DNA methylation data (Infinium Human Methylation 450), mutation data, and clinical data for multiple cancers were downloaded from The Cancer Genome Atlas (TCGA) data portal (https://tcga-data.nci.nih.gov/tcga/dataAccessMatrix.htm) by January 2012. For DNA methylation data, M values were calculated as log2 ratio of methylated intensity over unmethylated intensity (39). Normalized gene expression datasets of mouse kidney development and RCC subtypes (GSE1983 and GSE15641) were downloaded from NCBI GEO website (http://www.ncbi.nlm.nih.gov/geo). Probesets with matching human orthologs were kept by referencing UCSC blast tables (http://genome.ucsc.edu/cgi-bin/hgTables).

Identification of recurrent tumor specific alternative splicing events

For each exon, its RPKM (Reads Per Kilobase per Million mapped reads, a measure of expression level by RNAseq) is normalized by dividing the sum RPKM of all exons from a gene. To identify recurrent ccRCC-specific alternative splicing events, we first limited exons to have a >1.25 fold difference of median normalized RPKM between normal kidney and ccRCCs. To exclude low-expressing exons, which might represent background or low frequency events, we also excluded exons having a median normal and tumor exon RPKM below 0.5. 6820 exons remain after this filtering step. The “limma” package in R was used to identify differentially expressed exons, which is essentially performing t tests on normalized exon RPKMs between normal and tumor samples with adjusted output p values. We selected exons having >3-fold difference in expression and adjusted p value <1e-5. Candidate exons from the above screen were further validated by junction reads using a similar strategy. For each junction read associated with a candidate exon, we determined if there was a >3-fold difference in median normalized junction reads between normal and tumor. Multiple junctions may be associated with one single exon. We selected candidate exons with > 50% junctions that passed this test. The frequency of altered splicing events in ccRCC were calculated as percent of tumors having exon RPKM values below or above 1.5x standard deviation of normal exon RPKM reads. We selected exons with an altered frequency of >50%. Candidate exons were annotated using UCSC gene tables (http://genome.ucsc.edu/cgi-bin/hgTables) to designate exons as first (representing alternative transcriptional start), last (representing alternative transcriptional end), or internal within any known transcripts. R scripts for this study are available upon request.

Computational prediction of FGFR2 IIIb/c isoforms using RNA-seq data

To assign samples into FGFR2 IIIb/c groups, we calculated expression ratio of FGFR2 exon 8 (hg19:chr10:123,278,343-196) over exon 9 (hg19:chr10:123,276,986-728). Samples with >2-fold expression of exon 8, supported by 2-fold more reads from either junction of exon 7-8 over 7-9 or exon 8-10 over 9-10 were assigned to the FGFR2 IIIb group. Samples with >2-fold expression of exon 9, and supported by 2-fold more reads from either junction of exon 7-9 or 9-10 were assigned into the FGFR2 IIIc group. To deal with low expressers, for each sample, at least one junction raw reads involved must be equal or more than 3. Samples that met these criteria were called as either ‘IIIb’ or ‘IIIc’. Otherwise, the sample was marked as no call.

Experimental validation of FGFR2 isoform switch in ccRCCs

A total RNA of 18 primary ccRCC tumor samples, comprised of stage T1 to T3 tumors, were obtained by Dr. Ian Davis from the Victorian Cancer Biobank, which is supported by the Victorian Government, Australia, with appropriate ethics approval. Two ccRCC tumor cell lines (Caki-1 and 786-O) were purchased from American Type Culture Collection (ATCC) and grown according to ATCC’s recommendations. Total cellular RNA was harvested and subjected to RT-PCR using primers specific for the exons upstream and downstream of the alternative exons IIIb and IIIc as shown in Supplemental Figure S2. cDNA was amplified with the OmniScript RT kit using 1 μg of total RNA. Primer sequences flanking exon8/9 are: forward-GGATCAAGCACGTGGAAAAG in exon7 and reverse- TCGGCACAGGATGACTGTTA in exon10. JumpStart REDTaq ReadyMix PCR Reaction Mix (Sigma, St. Louis, MO) was used for PCR amplifications after the addition of 5 pmoles of each primer and one μl of the cDNA solution in 25 μl. The PCR conditions were 95°C for 3 minutes followed by 42 cycles at 95°C for 15 seconds and 60°C for 30 seconds and 72°C for 30 seconds, followed by a final 7-min extension. PCR products were gel-purified and submitted to Sanger sequencing with the PCR primers to confirm the identity of the amplicon.

Clustering analysis and statistical testing

Exon level data were log transformed and clustered using the ‘hclust’ function from R software (http://www.r-project.org). The options used were ‘canberra’ for distance calculation, and ‘median’ for clustering. We chose to use these conditions in order to better separate samples on both differential exon expression and overall FGFR2 expression. All other clustering analyses were done using the Cluster and TreeView software (http://rana.lbl.gov/EisenSoftware.htm). Fisher’s exact test, Wilcoxon test, Cox proportional hazard regression, and Kaplan-Meier log rank test were done using the R software.

GSEA analysis to identify RCC subtypes most related to FGFR2 IIIb RCCs

Differentially expressed genes between oncocytoma, chRCC, normal kidney, and ccRCC were identified by SAM analysis (http://www-stat.stanford.edu/~tibs/SAM) of published microarray data GSE15641. Genes with more than 3-fold differences in expression with a FDR <0.01 were selected and were limited to top 250 genes with highest folds of difference. These RCC subtype-specific up- and down-regulated gene signatures were combined with the MSigDB c4 computational gene sets (cancer-orient expression sets, available at http://www.broadinstitute.org/gsea/index.jsp) and subjected to GSEA analysis (40) using default conditions on 22 FGFR2-IIIb tumors versus 55 randomly picked FGFR2-IIIc tumors.

Results

Identification of tumor-specific alternative splicing of FGFR2 mRNA in ccRCC

To search for recurrent tumor specific alternative splicing events in ccRCC, which may play a critical role in tumorigenesis and tumor progression, we examined the RNA-seq data from the TCGA datasets on 470 ccRCCs and 68 normal kidney tissues (see materials and methods for algorithm details). This yielded a top candidate list of 234 exons from 113 genes (Supplemental Table S1). About 1/3 of these cases involved 5′ alternative transcriptional start, and in 64% of cases we observed differential exon usage (examples are shown in Supplemental Figure S1).

We focused our study on the FGFR2 gene, because this is the only gene where we observed mutually exclusive exon usage, and because the known important role of FGFR2 in tumor growth, invasion, and stem cell maintenance. As shown in Figure 1A, the median normalized expression of FGFR2 exon 8 (encoding FGFR2 IIIb) is statistically significantly higher in normal kidney than in ccRCC, and this situation is reversed in exon 9 (encoding FGFR2 IIIc). The finding is confirmed by the unsupervised clustering of exon expression reads of both normal kidney and ccRCCs (Figure 1B middle), where exon 8 expression is clearly associated to normal tissues and exon 9 to ccRCCs. Notably, a small fraction of ccRCCs cluster with normal kidney and also express exon 8. These results are further corroborated by the exon junction sequence reads (Figure 1B bottom), where normal tissues have more reads of exon 7-8 and exon 8-10, while the majority of ccRCCs predominantly have reads of exon 7-9 and exon 9-10. Clearly, most ccRCCs express FGFR2 having exons 7-9-10 (FGFR2 IIIc) and normal kidney expresses FGFR2 with exons 7-8-10 (FGFR2 IIIb). Another tumor specific change in FGFR2 exon19 (Figure. 1A) could not be validated by the junction data. Using exon and junction sequencing reads, we were able to predict the major FGFR2 isoform present in both normal kidney and ccRCCs (see materials and methods). This predicted 47 (out of 68) normal tissues and 22 ccRCCs as IIIb type, and 398 ccRCCs as IIIc type (Supplemental Table S2). None of the normal tissues were predicted as major IIIc type, although there were 21 normal (31% of 68) and 50 ccRCCs (11% of 470) whose major FGFR2 isoform type could not be determined, presumably due to low gene expression or comparable expression of both FGFR2 IIIc and IIIb isoforms. To validate our findings of FGFR2 IIIc as the major isoform expressed in ccRCCs, we amplified the mRNA coding region spanning FGFR2 exon8 and exon9 in 18 primary ccRCC tumors and two ccRCC cell lines using RT-PCR followed by Sanger sequencing of the PCR products (See Materials and Methods). This showed that exon9 (IIIc) is the predominant form expressed in all 20 ccRCC samples tested (example result shown in Supplemental Figure S2).

Figure 1
Alternative splicing of the FGFR2 mRNA in normal kidney and clear cell renal cell carcinomas (ccRCC). (A). Comparison of median normalized RNA-seq RPKM on each FGFR2 exon between normal kidney (blue) and ccRCC (pink). Exons with statistically significant ...

Isoform IIIc switch of FGFR2 is tissue specific and correlates with reduced expression of ESRP1 and GRHL2

To examine whether the FGFR2 IIIc switch is a more general event occurring in additional cancer types besides ccRCC, we used TCGA RNA-seq exon and junction level data to predict major FGFR2 isoforms present in normal and tumor tissues from a panel of cancer types including breast, lung, colon, head and neck, uterus, kidney, and bladder. This revealed that FGFR2 mainly exists as the IIIb isoform in all cancer types examined except ccRCC (Supplemental Table S3). Closer examination of paired normal and ccRCC tumor samples obtained from the same patient showed prevalent FGFR2 isoform switching from normal IIIb to tumor IIIc. This occurs only in ccRCCs, except for a single case of breast cancer with a clear IIIc switch (Figure 2A). Thus, FGFR2 IIIc isoform switching in cancer has a strict tissue-specificity.

Figure 2
Tissue-specific FGFR2 IIIc isoform switch correlates with reduced expression of ESRP1 in ccRCC. (A) log2 values of FGFR2 exon 9/exon 8 ratios in paired normal (blue) and tumor (red) tissues from the same patient in multiple cancer types were drawn. Upward ...

To search for possible regulators controlling this isoform switch, we performed the Wilcoxon test to find association of gene expression to FGFR2 isoforms in ccRCC, endometrial, and bladder cancer. The top 100 genes with the least P values from all three cancer types were collected and intersected (data not shown). This identified two genes in common, ESRP1 and GRHL2, among which ESRP1 is a splicing factor previously reported to control alternative splicing of FGFR2 (12). As shown in Figure 2B, there is a good correlation of high ESRP1 or GRHL2 expression with the prediction of FGFR2 isoform being IIIb, where expression above the yellow lines correlated perfectly well with the presence of FGFR2 IIIb but not IIIc isoform. Since ESRP1 is a known FGFR2 splicing regulator, this result serves well as an indirect validation of our FGFR2 isoform prediction algorithm. When we looked at ESRP1 expression in all cancer types, we observed universally equivalent high level expression of ESRP1 in most tumor tissues, as contrasted by a substantial reduction of ESRP1 expression in ccRCCs. High levels of ESRP1 were correlated with FGFR2 IIIb expression (Figure 2C). Since FGFR1 and FGFR3 have exon structures similar to those of FGFR2, we also examined whether these receptors were undergoing similar isoform switches as in FGFR2. No isoform IIIc switch was found in FGFR1 and FGFR3 in ccRCCs (Supplemental Figure S3). Thus, despite similar organization of exons, alternative splicing of FGFR1 and FGFR3 in ccRCC is either not controlled by ESRP1 alone or requires additional regulators. Taken together, these results suggest that FGFR2 IIIc switch occurs in a tissue-specific manner as well as in a FGFR2-specific manner within the FGFR receptor family.

FGFR2 IIIb ccRCC has gene expression and FGFR2 promoter methylation patterns resembling that of normal kidney but not IIIc ccRCC

To study the difference at the molecular level between FGFR2 IIIb and IIIc ccRCC, we performed an unsupervised clustering of the top 3,600 variably expressed genes in 470 ccRCCs and 68 normal kidney tissues (Figure 3A, similar results can be obtained using 2,500–5,000 genes). All normal tissues were clustered together as expected. The majority of ccRCCs were clustered into two major groups with one cluster of tumors being more malignant when assessed by tumor grade, stage, and size, although VHL mutation was observed to occur at similar frequency among the two subtypes. Interestingly, all FGFR2 IIIb ccRCCs were outside of these two major ccRCC clusters, clustered next to normal tissues, and possessed a global gene expression pattern very similar to that of normal samples, indicating these tumors have a different transcription program from FGFR2 IIIc ccRCCs. Notably, with FGFR2-IIIb ccRCCs, tumors can further be clustered into two sub-groups based on their transcriptome differences (designated FGFR2-IIIb-1, and 2, Figure 3A). We further performed an unsupervised cluster analysis of promoter DNA methylation in 227 ccRCCs and 21 normal kidney tissues which have both RNA-seq and methylation data. This was done on 82 methylation probes within a region encompassing 20kbp of the FGFR2 gene. Again, normal tissues and most IIIb ccRCCs were clustered together (Figure 3B). These results argue that FGFR2 IIIb ccRCC represents a small subset of renal clear cell carcinomas (22 out of 470, ~5%) constituting a distinct molecular subtype. In addition to isoform switch, we also observed a significant reduction of FGFR2 gene expression in ccRCC compared to that in normal kidney. This downregulation can be at least partially attributed to the hypermethylation of exon1 and intron1 region of the FGFR2 gene (Supplemental Figure S4).

Figure 3
FGFR2 IIIb ccRCC exhibit gene expression and methylation patterns similar to those of normal kidney tissues. (A). Unsupervised clustering of top 3,600 variedly expressed genes in normal kidney and ccRCCs (red, high expression; green, low expression). ...

FGFR2 IIIb and IIIc ccRCCs show distinct gene expression signatures and signaling pathways

While EMT is thought to be a critical event implicated in cancer progression and metastasis, the prevalence of mesenchymal FGFR2 IIIc ccRCCs among all ccRCCs studied (~85%), together with results from recent studies on RCC stem cells, raises the possibility that FGFR2 IIIc RCCs may have a mesenchymal stem cell origin (41). To this end, we compared the gene expression differences between FGFR2 IIIb and IIIc ccRCCs to previously published data on mouse embryonic kidney development (42), in which gene expression of ureteric bud (UB) and metanephric mesenchyme (MM), two integral components for kidney development with epithelial and mesenchymal origins, respectively, were profiled. This confirmed that FGFR2 IIIb ccRCCs displayed an epithelial phenotype, with elevated expression of epithelial markers E-cadherin (CDH1), keratin 7 (KRT7), and claudins (CLDN4, 7, 8) and reduced expression of mesenchymal markers N-cadherin (CDH2), collagen 23 A1 (COL23A1), and vimentin (VIM) (Figure 4A).

Figure 4
FGFR2 IIIb and IIIc ccRCCs have distinct gene expression patterns and signaling pathways. (A) Samples are grouped into normal kidney, FGFR2 IIIb-1 and -2 RCCs, and IIIc ccRCCs. Gene expression data of EMT markers, FGF signaling components, HOX proteins, ...

In addition, we observed other gene expression changes in signaling pathways between FGFR2 IIIb and IIIc ccRCCs which are similar to those between mouse UB and MM tissues. For example, both FGFR2 IIIb RCCs and UB tips had elevated FGF9 gene expression. The HOXB genes are overexpressed and HOXA4 downregulated in FGFR IIIb RCCs as well as UB tips as compared to IIIc RCCs and MM. This is also true for a panel of cell surface markers (e.g. CD82). Since HOX gene expression perfectly matches the timing and route of development, combination of these results suggested that FGFR2 IIIc and IIIb ccRCC have originated from stem cells of mesenchymal and epithelial origins, respectively, during tumorigenesis.

Downregulation of VHL and hypoxia are hallmarks of renal cell carcinomas. When we examined the hypoxia response in FGFR2 IIIb and IIIc ccRCCs using a 15-gene hypoxic gene expression signature (43), we observed elevated expression of the hypoxic signature in IIIc ccRCCs (Figure 4B), and FGFR2-IIIb-1 tumors. There is no activation of the 15-gene signature in normal kidney tissues, as expected. However, activation of this hypoxic signature in FGFR2-IIIb-2 ccRCCs is much lower compared to IIIc ccRCCs, suggesting they are less hypoxic (Figure 4B). This result can be further confirmed using a different set of 36-gene HIF alpha target signature (data not shown). When VHL gene copy number was examined, we observed prevalent copy number loss in FGFR2-IIIc ccRCCs, as expected. However, VHL copy numbers are largely intact in IIIb-1 tumors despite they also exhibit elevated hypoxia activation, and VHL copy numbers are gained in FGFR2-IIIb-2 tumors. In contrast, FGFR2-IIIb-2 tumors exhibit loss of p53 and PTEN copy numbers, which is correlated with reduced expression of these tumor suppressors in these tumors (Figure 4B). Taken together, these findings argue that FGFR2 IIIb and IIIc ccRCCs are two or more distinct molecular subtypes, and might represent different disease entities.

FGFR2 IIIb ccRCCs are closely related to clear cell papillary RCC and chromophobe RCC and have better clinical outcomes

The fact that FGFR2 IIIb ccRCCs possess gene expression and methylation patterns resembling normal kidney tissues, express epithelial markers, and do not carry VHL LOH events, suggests that these tumors may be of a more differentiated state and less malignant in nature. We tested this hypothesis by examining the clinical parameters from 22 FGFR2 IIIb ccRCCs and 398 IIIc ccRCCs (available on the TCGA website). Remarkably, all 22 FGFR2 IIIb ccRCCs do not show distant metastasis (Table 1, Fisher exact test two-sided P value = 0.034) and for those tumors having lymph node status, none of the IIIb ccRCCs had spread of tumor into regional lymph nodes. Compared to FGFR2 IIIc ccRCCs, IIIb tumors are statistically significantly smaller in tumor size and of lower tumor grade and stage (Table 1). Specifically, 18 out of 22 FGFR IIIb tumors were diagnosed as stage T1 tumors. Only one out of 22 FGFR2 IIIb tumors was diagnosed as a stage T3 tumor (i.e. tumors extending into major veins or perinephric tissue and not beyond Gerota’s fascia). This frequency (~5%) is much lower than the overall T3/T4 frequency found in ccRCCs (42% for the TCGA dataset).

Table 1
Fisher exact tests of clinical parameters in FGFR2 IIIb and IIIc ccRCCs. Each row represents data for a 2×2 contingency table used for Fisher exact test.

Since microarray gene expression profiles of different RCC subtypes are available (44)(GSE15641), we further compared differential expression between FGFR2 IIIb and IIIc ccRCCs to known changes in gene expression between ccRCCs and other RCC subtypes, using GSEA analysis (see Material and Methods). This analysis indicated that FGFR2 IIIb ccRCC is most related to renal oncocytoma, which is benign in nature, and to chromophobe RCCs (chRCC) (Figure 5A). This result was further supported by examining the gene copy number alterations in FGFR2-IIIb and -IIIc tumors (Figure 5B). Based on SNP array derived copy number data, FGFR2-IIIb-1 tumors had minimum copy number alterations, whereas FGFR2-IIIb-2 tumors had copy number gains and losses on almost every autosome chromosome. Copy number changes in FGFR2-IIIb-2 tumors are recurrent at an extremely high frequency (~90%) and this differentiate them from FGFR2-IIIc tumors, which had consistent VHL LOH on chromosome 3 (Figure 5B, supplemental Figure S5). The cytogenetic abnormalities observed in FGFR2-IIIb-2 RCCs matched perfectly well with those reported for chromophobe RCCs (45), where LOH on chromosomes 1, 2, 6, 10, 13, 17 and 21 were reported. This strongly suggests FGFR2-IIIb-2 RCCs are in fact mis-diagnosed chRCC cases, which is confirmed by pathological re-examination of tumor histology. With respect to FGFR2-IIIb-1 tumors, although these tumors resemble renal oncocytomas on the transcriptome level, pathologically they were re-diagnosed as clear cell papillary RCCs (ccpRCCs), a unique RCC subtype known not to metastasize and which lacks known copy number alterations found in other RCC subtypes (46). Consistent with all these findings, Kaplan Meier analysis on patient survival showed a trend that patients with FGFR2 IIIb RCCs had a better clinical outcome (Figure 5C, Cox proportional hazard regression likelihood ratio test P = 0.047).

Figure 5
FGFR2 IIIb ccRCCs are related to renal oncocytoma and chromophobe RCCs. (A) GSEA enrichment score plots showing oncocytoma and chromophobe RCC specific genes are highly enriched in FGFR2-IIIb tumors whereas ccRCC specific genes are negatively correlated. ...

Discussion

In this study, we performed an in silico analysis of the ccRCC transcriptome to identify recurring tumor-specific alternative splicing events. Two major types of tumor-specific alternative splicing events identified were alternative transcriptional start sites and exon skipping. For one gene (FGFR2) we identified a mutually exclusive usage of exons. Although previous studies suggested that pyruvate kinase isoform switch from PKM1 to PKM2 in cancers is important for cancer metabolism and tumor growth (3), we did not observe such a switch in paired normal kidney and ccRCCs (data not shown). However, this is consistent with a recent study reporting that such isoform shift does not occur in kidney, lung, liver, and thyroid cancers (47). In another interesting case we observed disrupted expression of the AP1M2 gene at the 5′ end exons in ccRCC but not in normal kidney (Supplemental Figure S1). The basis of this phenomenon is unclear but suggests possible gene translocation, alternative transcription start, or deletion of part of the AP1M2 gene.

Through integrated analysis using data from three types of cancers (ccRCC, endometrial, and bladder cancer) we identified ESRP1 and GRHL2 as putative regulators of the FGFR2 IIIc isoform switch (Figure 2B and 2C). Identification of ESRP1 is proof of principle of our approach since previous in vitro studies have established a role for ESRP1 in controlling the fate of FGFR2 splicing in epithelial cells (12). Our analysis suggests that GRHL2 is also a likely regulator of FGFR2. This gene encodes a transcription factor with an emerging role as a master regulator in maintaining the epithelial phenotype and suppression of EMT (48, 49). In addition, our data revealed a good correlation between ESRP1/GRHL2 expression level with FGFR2 expression level in normal kidney (Pearson’s r of 0.78 and 0.80, respectively), which is lost in ccRCCs (Pearson’s r of −0.013 and 0.017, respectively) in both IIIc and IIIb tumors (Supplemental Figure S3). One possible explanation for this phenomenon is that in tumors an additional mechanism(s) such as promoter methylation contributes to FGFR2 transcriptional regulation. Indeed, ccRCCs are subjected to increased DNA methylation proximal to FGFR2 intron 1, which correlates with downregulation of FGFR2 expression (Supplemental Figure S6).

EMT is a process which potentiates cell migration and invasion, and is thought to be a critical step in tumor metastasis. Consistent with this notion, we found FGFR2 IIIb ccRCCs, which retain an epithelial phenotype, do not have distant metastasis and lymph node spread (Figure 4, Table 1). Surprisingly, while EMT is a known phenomenon in cancer, the FGFR2 IIIc switch, which is linked to the mesenchymal phenotype and EMT, was rarely detected in cancers except in ccRCC in our analysis of paired normal and tumor samples (Figure 2A). Possible explanations are either FGFR2 IIIc expression per se is not important for EMT, or EMT and FGFR2 IIIc switch occurs transiently or in a small percentage of tumor cells and thus cannot be detected by our analysis, which utilized bulk tumor tissues.

About 20% of FGFR2 IIIc ccRCCs from the TCGA dataset are recorded to have distant metastasis, a percentage much lower than IIIc isoform switch observed in these tumors, which is approximately 90% (Supplemental Table S3). In the context of embryonic kidney development during which both epithelial and mesenchymal stem cells are involved, we suggest that the prevalence of FGFR2 IIIc isoform switch points to a mesenchymal stem cell origin for this subtype of ccRCC. This is partially supported by data in Figure 4A, and provides a plausible explanation for why the FGFR2 IIIc isoform switch is kidney-specific. Studies on tumor-initiating population of renal carcinomas also support this idea (41). Three types of EMT had been described (50). Type 1 EMT occurs during embryonic development and is associated with processes such as implantation and gastrulation. Type 2 EMT is involved in response to inflammation, wound healing, and tissue regeneration. Type 3 EMT occurs in neoplastic cells and is attributed to tumor metastasis. While we could not exclude the possibility that Type 3 EMT occurs in ccRCC during tumor dissemination, we propose that FGFR2 IIIc expression in most ccRCCs may be linked to a type 1 EMT in the early developmental stage, when ccRCC first originated in cells having a mesenchymal phenotype.

This notion is further supported by our integrated GSEA and copy number analysis to suggest that FGFR2-IIIb RCCs are likely to be a mixture of clear cell papillary RCCs and chromophobe RCCs. Since the cancer genome of FGFR2-IIIb-2 RCCs possesses distinct marker LOH events on multiple chromosomes (1, 2, 6, 10, 13, 17, and 21) found in chRCCs, this suggests that conversion between chRCC and ccRCC tumors would not happen. This further indicates that FGFR2 isoform switch is an early event during RCC tumorigenesis, and may play an important role in regulation of tumor growth and invasion. Recently, TCGA has initiated construction of a chRCC dataset. We have checked the existing RNAseq data from this new dataset and confirmed that both normal and tumor tissues dominantly express the FGFR2 IIIb isoform (data not shown).

Although GSEA analysis suggested that FGFR2-IIIb-1 tumors possess a transcriptome resembling that of renal oncocytoma, a re-examination of the tumor histology revealed that these were actually clear cell papillary RCCs (ccpRCCs). This raises the possibility that ccpRCCs might develop from oncocytomas. Future study on gene expression profiling of ccpRCCs will answer the question as whether these tumors are similar to each other on the transcriptional level. Our current study is based on significant changes in tumors as a whole, and would likely miss some splicing alterations occurring in only a subset of tumors. For example, an examination of CD44 splicing in ccRCC revealed that loss of expression of CD44 variant exons was enriched in a subset of tumors with better prognosis (corresponding to the tumors clustered on the right side in Figure 3A, data not shown). Such tumor subtype specific alterations would be missed in our current study.

Our identification of FGFR2 isoform switching in ccRCC has several potential clinical implications. First, detection of FGFR2 IIIb in RCC not only suggests the presence of clear cell papillary RCC or chRCC but also predicts a better prognosis. Second, given the high specificity of FGFR2 IIIc isoform switch, it is important to explore its potential utility as an early detection biomarker for ccRCC in patient urine and serum samples. Third, FGFR2 IIIc and IIIb have different ligand specificity. While FGFR2 IIIb binds specifically to FGF-1, 3, 7, 10, FGFR2 IIIc binds to FGF-1, 2, and 9. Therefore, FGFR2 IIIc or its specific ligands (FGF-2 and -9) potentially represent specific targets for ccRCC intervention. Our results demonstrate the power of integrated analyses of cancer genomics data toward improved understanding of potential molecular drivers of specific cancers, and suggest new approaches for targeted intervention of human cancers.

Translational relevance

Aberration in alternative mRNA splicing is implicated in tumorigenesis and cancer progression. Through in silico analysis of the TCGA RNA-seq data, we identified FGFR2 isoform switch from the normal epithelial “IIIb” isoform to the mesenchymal “IIIc” isoform in ~90% of ccRCCs. This was experimentally validated by PCR sequencing using additional ccRCC cases. FGFR2-IIIb RCCs do not exhibit activated mesenchymal gene expression signature, are less hypoxic and associated with longer patient survival. Through integrated cancer genomics analyses we concluded that FGFR2-IIIb RCCs were mis-diagnosed clear cell papillary RCC and chromophobe RCC cases. The FGFR2 isoform switch is ccRCC-specific since it is not observed in other cancers examined including those of breast, lung, colon, head and neck, endometrium, and bladder. Our study demonstrates FGFR2-IIIc switch as a hallmark event in ccRCCs and suggests FGFR2-IIIc isoform a promising candidate biomarker for early detection, diagnosis, and targeted therapy of ccRCC.

Supplementary Material

10

Acknowledgments

Financial support: This study is supported in part by the TCGA grant U24CA143883 from NCI/NIH, and funds from Ludwig Institute for Cancer Research. IDD was supported by a Victorian Cancer Agency Clinician Researcher Fellowship and is a NHMRC Practitioner Fellow.

We thank Dr. Ralf Krahe and Dr. Hongwu Zheng for critical reading of the manuscript and insightful discussions.

Footnotes

The authors claim no potential conflict of interest.

References

1. Wang GS, Cooper TA. Splicing in disease: disruption of the splicing code and the decoding machinery. Nat Rev Genet. 2007;8:749–61. [PubMed]
2. Shapiro IM, Cheng AW, Flytzanis NC, Balsamo M, Condeelis JS, Oktay MH, et al. An EMT-driven alternative splicing program occurs in human breast cancer and modulates cellular phenotype. PLoS Genet. 2011;7:e1002218. [PMC free article] [PubMed]
3. Christofk HR, Vander Heiden MG, Harris MH, Ramanathan A, Gerszten RE, Wei R, et al. The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature. 2008;452:230–3. [PubMed]
4. David CJ, Chen M, Assanah M, Canoll P, Manley JL. HnRNP proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in cancer. Nature. 2010;463:364–8. [PMC free article] [PubMed]
5. Sveen A, Bakken AC, Agesen TH, Lind GE, Nesbakken A, Nordgard O, et al. The exon-level biomarker SLC39A14 has organ-confined cancer-specificity in colorectal cancer. Int J Cancer. 2012;131:1479–85. [PubMed]
6. Yoshida K, Sanada M, Shiraishi Y, Nowak D, Nagata Y, Yamamoto R, et al. Frequent pathway mutations of splicing machinery in myelodysplasia. Nature. 478:64–9. [PubMed]
7. Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol. 2001;2:REVIEWS3005. [PMC free article] [PubMed]
8. Beenken A, Mohammadi M. The FGF family: biology, pathophysiology and therapy. Nat Rev Drug Discov. 2009;8:235–53. [PMC free article] [PubMed]
9. Igarashi M, Finch PW, Aaronson SA. Characterization of recombinant human fibroblast growth factor (FGF)-10 reveals functional similarities with keratinocyte growth factor (FGF-7) J Biol Chem. 1998;273:13230–5. [PubMed]
10. Orr-Urtreger A, Givol D, Yayon A, Yarden Y, Lonai P. Developmental expression of two murine fibroblast growth factor receptors, flg and bek. Development. 1991;113:1419–34. [PubMed]
11. Muh SJ, Hovhannisyan RH, Carstens RP. A Non-sequence-specific double-stranded RNA structural element regulates splicing of two mutually exclusive exons of fibroblast growth factor receptor 2 (FGFR2) J Biol Chem. 2002;277:50143–54. [PubMed]
12. Warzecha CC, Sato TK, Nabet B, Hogenesch JB, Carstens RP. ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell. 2009;33:591–601. [PMC free article] [PubMed]
13. Celli G, LaRochelle WJ, Mackem S, Sharp R, Merlino G. Soluble dominant-negative receptor uncovers essential roles for fibroblast growth factors in multi-organ induction and patterning. EMBO J. 1998;17:1642–55. [PubMed]
14. Jackson D, Bresnick J, Rosewell I, Crafton T, Poulsom R, Stamp G, et al. Fibroblast growth factor receptor signalling has a role in lobuloalveolar development of the mammary gland. J Cell Sci. 1997;110 ( Pt 11):1261–8. [PubMed]
15. Dillon C, Spencer-Dene B, Dickson C. A crucial role for fibroblast growth factor signaling in embryonic mammary gland development. J Mammary Gland Biol Neoplasia. 2004;9:207–15. [PubMed]
16. De Moerlooze L, Spencer-Dene B, Revest JM, Hajihosseini M, Rosewell I, Dickson C. An important role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis. Development. 2000;127:483–92. [PubMed]
17. Revest JM, Suniara RK, Kerr K, Owen JJ, Dickson C. Development of the thymus requires signaling through the fibroblast growth factor receptor R2-IIIb. J Immunol. 2001;167:1954–61. [PubMed]
18. Lin Y, Liu G, Zhang Y, Hu YP, Yu K, Lin C, et al. Fibroblast growth factor receptor 2 tyrosine kinase is required for prostatic morphogenesis and the acquisition of strict androgen dependency for adult tissue homeostasis. Development. 2007;134:723–34. [PubMed]
19. Lipschutz JH. Molecular development of the kidney: a review of the results of gene disruption studies. Am J Kidney Dis. 1998;31:383–97. [PubMed]
20. Finch PW, Rubin JS. Keratinocyte growth factor expression and activity in cancer: implications for use in patients with solid tumors. J Natl Cancer Inst. 2006;98:812–24. [PubMed]
21. Terada M, Sakamoto H, Ohmura Y, Tsuruta H, Akiyama N, Sasaki H, et al. Biological significance of gene amplification in carcinogenesis. Princess Takamatsu Symp. 1991;22:371–80. [PubMed]
22. Kunii K, Davis L, Gorenstein J, Hatch H, Yashiro M, Di Bacco A, et al. FGFR2-amplified gastric cancer cell lines require FGFR2 and Erbb3 signaling for growth and survival. Cancer Res. 2008;68:2340–8. [PubMed]
23. Hunter DJ, Kraft P, Jacobs KB, Cox DG, Yeager M, Hankinson SE, et al. A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Nat Genet. 2007;39:870–4. [PMC free article] [PubMed]
24. Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, et al. Genome-wide association study identifies novel breast cancer susceptibility loci. Nature. 2007;447:1087–93. [PMC free article] [PubMed]
25. Miki T, Fleming TP, Bottaro DP, Rubin JS, Ron D, Aaronson SA. Expression cDNA cloning of the KGF receptor by creation of a transforming autocrine loop. Science. 1991;251:72–5. [PubMed]
26. Pollock PM, Gartside MG, Dejeza LC, Powell MA, Mallon MA, Davies H, et al. Frequent activating FGFR2 mutations in endometrial carcinomas parallel germline mutations associated with craniosynostosis and skeletal dysplasia syndromes. Oncogene. 2007;26:7158–62. [PMC free article] [PubMed]
27. Katoh M. Cancer genomics and genetics of FGFR2 (Review) Int J Oncol. 2008;33:233–7. [PubMed]
28. Diez de Medina SG, Chopin D, El Marjou A, Delouvee A, LaRochelle WJ, Hoznek A, et al. Decreased expression of keratinocyte growth factor receptor in a subset of human transitional cell bladder carcinomas. Oncogene. 1997;14:323–30. [PubMed]
29. Feng S, Wang F, Matsubara A, Kan M, McKeehan WL. Fibroblast growth factor receptor 2 limits and receptor 1 accelerates tumorigenicity of prostate epithelial cells. Cancer Res. 1997;57:5369–78. [PubMed]
30. Zhang Y, Wang H, Toratani S, Sato JD, Kan M, McKeehan WL, et al. Growth inhibition by keratinocyte growth factor receptor of human salivary adenocarcinoma cells through induction of differentiation and apoptosis. Proc Natl Acad Sci U S A. 2001;98:11336–40. [PubMed]
31. Matsubara A, Kan M, Feng S, McKeehan WL. Inhibition of growth of malignant rat prostate tumor cells by restoration of fibroblast growth factor receptor 2. Cancer Res. 1998;58:1509–14. [PubMed]
32. Yoshino M, Ishiwata T, Watanabe M, Komine O, Shibuya T, Tokunaga A, et al. Keratinocyte growth factor receptor expression in normal colorectal epithelial cells and differentiated type of colorectal cancer. Oncol Rep. 2005;13:247–52. [PubMed]
33. Zang XP, Pento JT. Keratinocyte growth factor-induced motility of breast cancer cells. Clin Exp Metastasis. 2000;18:573–80. [PubMed]
34. Blanckaert VD, Hebbar M, Louchez MM, Vilain MO, Schelling ME, Peyrat JP. Basic fibroblast growth factor receptors and their prognostic value in human breast cancer. Clin Cancer Res. 1998;4:2939–47. [PubMed]
35. Ricol D, Cappellen D, El Marjou A, Gil-Diez-de-Medina S, Girault JM, Yoshida T, et al. Tumour suppressive properties of fibroblast growth factor receptor 2-IIIb in human bladder cancer. Oncogene. 1999;18:7234–43. [PubMed]
36. Carstens RP, Eaton JV, Krigman HR, Walther PJ, Garcia-Blanco MA. Alternative splicing of fibroblast growth factor receptor 2 (FGF-R2) in human prostate cancer. Oncogene. 1997;15:3059–65. [PubMed]
37. Yan G, Fukabori Y, McBride G, Nikolaropolous S, McKeehan WL. Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy. Mol Cell Biol. 1993;13:4513–22. [PMC free article] [PubMed]
38. Kwabi-Addo B, Ropiquet F, Giri D, Ittmann M. Alternative splicing of fibroblast growth factor receptors in human prostate cancer. Prostate. 2001;46:163–72. [PubMed]
39. Du P, Zhang X, Huang CC, Jafari N, Kibbe WA, Hou L, et al. Comparison of Beta-value and M-value methods for quantifying methylation levels by microarray analysis. BMC Bioinformatics. 2010;11:587. [PMC free article] [PubMed]
40. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–50. [PubMed]
41. Bussolati B, Brossa A, Camussi G. Resident stem cells and renal carcinoma. Int J Nephrol. 2011:286985. [PMC free article] [PubMed]
42. Schmidt-Ott KM, Yang J, Chen X, Wang H, Paragas N, Mori K, et al. Novel regulators of kidney development from the tips of the ureteric bud. J Am Soc Nephrol. 2005;16:1993–2002. [PubMed]
43. Buffa FM, Harris AL, West CM, Miller CJ. Large meta-analysis of multiple cancers reveals a common, compact and highly prognostic hypoxia metagene. Br J Cancer. 2010;102:428–35. [PMC free article] [PubMed]
44. Jones J, Otu H, Spentzos D, Kolia S, Inan M, Beecken WD, et al. Gene signatures of progression and metastasis in renal cell cancer. Clin Cancer Res. 2005;11:5730–9. [PubMed]
45. Speicher MR, Schoell B, du Manoir S, Schrock E, Ried T, Cremer T, et al. Specific loss of chromosomes 1, 2, 6, 10, 13, 17, and 21 in chromophobe renal cell carcinomas revealed by comparative genomic hybridization. Am J Pathol. 1994;145:356–64. [PubMed]
46. Gobbo S, Eble JN, Grignon DJ, Martignoni G, MacLennan GT, Shah RB, et al. Clear cell papillary renal cell carcinoma: a distinct histopathologic and molecular genetic entity. Am J Surg Pathol. 2008;32:1239–45. [PubMed]
47. Bluemlein K, Gruning NM, Feichtinger RG, Lehrach H, Kofler B, Ralser M. No evidence for a shift in pyruvate kinase PKM1 to PKM2 expression during tumorigenesis. Oncotarget. 2011;2:393–400. [PMC free article] [PubMed]
48. Senga K, Mostov KE, Mitaka T, Miyajima A, Tanimizu N. Grainyhead-like 2 regulates epithelial morphogenesis by establishing functional tight junctions through the organization of a molecular network among claudin3, claudin4, and Rab25. Mol Biol Cell. 2012;23:2845–55. [PMC free article] [PubMed]
49. Cieply B, Riley Pt, Pifer PM, Widmeyer J, Addison JB, Ivanov AV, et al. Suppression of the epithelial-mesenchymal transition by Grainyhead-like-2. Cancer Res. 2012;72:2440–53. [PMC free article] [PubMed]
50. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119:1420–8. [PMC free article] [PubMed]