PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Neurosci. Author manuscript; available in PMC 2013 September 27.
Published in final edited form as:
PMCID: PMC3640307
NIHMSID: NIHMS460266

microRNA-276a Functions in Ellipsoid Body and Mushroom Body Neurons for Naïve and Conditioned Olfactory Avoidance in Drosophila

Abstract

microRNA-mediated gene regulation plays a key role in brain development and function. But there are few cases in which the roles of individual miRNAs have been elucidated in behaving animals. We report a miR-276a::DopR regulatory module in Drosophila that functions in distinct circuits for naïve odor responses and conditioned odor memory. Drosophila olfactory aversive memory involves convergence of the odors (conditioned stimulus, CS) and the electric shock (unconditioned stimulus, US) in mushroom body (MB) neurons. Dopamine receptor, DopR, mediates the US inputs onto MB. Distinct dopaminergic neurons also innervate ellipsoid body (EB), where DopR function modulates arousal to external stimuli. We demonstrate that miR-276a is required in MB neurons for memory formation and in EB for naïve responses to odors. Both roles of miR-276a are mediated by tuning DopR expression. The dual role of this miR-276a::DopR genetic module in these two neural circuits highlights the importance of miRNA-mediated gene regulation within distinct circuits underlying both naïve behavioral responses and memory.

Introduction

microRNAs (miRNAs) are small RNAs (~21–23 nucleotides long) that are thought to regulate as many as 50% of genes at the post-transcriptional level by binding to complementary sequences in target mRNAs (Bartel, 2009). miRNA-mediated regulation has emerged as a key mechanism governing synaptic plasticity (Schratt et al., 2007). We demonstrate a role for miR-276a in Drosophila for both naïve responses to odors and for olfactory memories. We focused on this particular miRNA gene because it maps nearby to one of the mutations identified from a forward mutagenesis screen for memory defects (Dubnau et al., 2003). By manipulating spatial and temporal function of this miRNA, we uncovered a complex role in both naïve and conditioned odor responses. We also demonstrate that DopR, a type one dopamine receptor, is a functional downstream effector of miR-276a.

Pavlovian olfactory conditioning in Drosophila has provided a powerful system to investigate genetic and circuit mechanisms of memory (Busto et al., 2010; Keene and Waddell, 2007; Margulies et al., 2005). A model has emerged in which mushroom body (MB) neurons integrate odor CS (conditioned stimulus) inputs with neuromodulatory US inputs. For aversive learning, the US information is mediated by several characterized dopaminergic neurons (Aso et al., 2010; Claridge-Chang et al., 2009; Krashes et al., 2009; Schwaerzel et al., 2003) projecting onto MB neurons. Formation of all stages of aversive olfactory memory (short-term, middle-term and long-term) requires DopR expression in MB(Kim et al., 2007b; Qin et al., 2012). However, long-term memory (LTM) involves a broader neural circuit because CREB-mediated gene expression is required outside MB, in DAL neurons that send inputs to MB (Chen et al., 2012), and NMDA-receptor function is required for LTM in R4 subtypes of EB neurons (Wu et al., 2007).

Outside MB, DopR function also is required in modulating various forms of arousal to external stimuli, including ethanol, cocaine and caffeine (Andretic et al., 2008; Kong et al., 2010; Van Swinderen and Andretic, 2011), as well as startle-induced arousal caused by repetitive air puffs (Lebestky et al., 2009). For certain forms of arousal, DopR expression is required within R2/R4m subsets of EB neurons (Kong et al., 2010; Lebestky et al., 2009), which include the cell type(s) where NMDA-receptor function is needed for olfactory LTM (Wu et al., 2007). Thus naïve responses to external stimuli and long-lived conditioned responses to odors share a role for EB neurons and also share a role for dopamine signaling onto DopR.

In this study we show that miR-276a is required within MB for conditioned olfactory LTM and in R2/R4m-subtypes of EB neurons for naïve olfactory avoidance. Furthermore, we are able to fully suppress both the LTM and naïve olfactory response defects of miR-276a disruptions simply by reducing the DopR copy number. Over-expression of DopR within MB also is sufficient to phenocopy LTM defects of the miR-276a mutants. We propose a model in which miR-276a fine-tunes the levels of DopR within MB for conditioned olfactory long-term memory and within EB for naïve odor responses.

Materials and Methods

Fly stocks

Fly stocks were cultured in standard fly food and room temperature (22.5 °C). The wild type flies utilized in this study were w1118 (iso1CJ). All other mutant strains and transgenic strains were backcrossed to this wild type strain for at least five generations. The miR-276Rosa mutant was originally generated in the Tully laboratory from a forward mutagenesis screen by inserting a P-element p{lacW} (Dubnau et al., 2003). The null allele miR-276aD8 was generated by providing transposes Delta 2–3 in trans and mobilizing the P-element imprecisely. To detect the molecular lesion in miR-276aD8, genomic DNA from the miR-276aD8/Rosa animals was purified and PCR-amplified by primers priming flanking regions (forward primer: 5’-AATAGAGTTGACAAAGCGTTCGGCGCCCACG-3’ and reverse primer: 5’-GCGGAGGAAGGGAATCTGGCACTCGAATCG-3’) with the Roche Expand Long Range dNTP pack (Roche, Cat. No. 04829034001). The PCR product was sequenced and it was determined that in the miR-276aD8 allele, a ~3.6Kb genomic region to the right of the P-element insertion site was deleted and a ~2.8Kb residual sequence of the P-element was left in the genome. Animals homozygous for miR-276aD8 are semi-lethal and few animals survive during late pupal stage. Similarly, the precise excision alleles miR-276aA6 and miR-276aD2.2 were also generated by providing transposase Delta 2–3 in trans and mobilizing the P-element precisely. PCR reactions (forward primer: 5’-AATAGAGTTGACAAAGCGTTCGGCGCCCACG-3’ and reverse primer: 5’-TGAACGTAGGAACTCTATACCTCGCTGATGG-3’) were used to verify that the P-elements were removed and genomic structures were restored in theses alleles.

The BAC rescue genomic constructs were obtained from BACPAC resources. These BAC clones flank the miR-276a precursor regions, but were selected carefully to avoid any sequence flanking upstream or downstream genes. The names and approximate sizes of the constructs are: CH322-133G18 (~20Kb), CH322-151H13 (~19Kb) and CH321-46B15 (~75Kb). These BAC clones were engineered into the attB-P[acman]-CmR-BW vector (Venken et al., 2009) and these transgene constructs were directly injected and permanently integrated at specific docking sites (engineered genomic loci containing attP sequence) in the genome using ΦC31 transposase (Venken et al., 2009; Venken et al., 2006). We selected the 9736 (53B2) docking site (P[acman] Resources, www.pacmanfly.org). This docking site is relatively further away from annotated genes and presumably will not affect animal behavior. The transgenic fly injection services were provided by BestGene Inc. (Chino Hills, CA). Since the docking site stock itself contains a yellow1 mutant allele on the X chromosomes and this mutation could potentially impair animal behavior, we crossed male transformants with wild type flies and select male progenies before starting subsequent backcrossing in order to remove yellow1.

The UAS::miR-276a-4.7Kb rescue construct was made by cloning a ~4.7Kb genomic region from wild type flies into the pUAST vector. Forward primer 5’-GTTTGTGCCTCAAGTGGCAGTCATAAATTTGAG-3’ and reverse primer 5’-AACCGCACCTCAATCGCCCTTTACTTGG-3’ were used to PCR-amplify a ~4.7Kb genomic region containing the miR-276a precursor and largely upstream regions. The PCR product was cloned with a Zero Blunt™ TOPO™ PCR Cloning Kit (Invitrogen) and then sub-cloned into the pUAST vector. The resulting pUAST-miR-276a-4.7Kb constructs were injected at BestGene Inc. (Chino Hills, CA) by standard P-tranposase mediated integration.

The UAS::EGFP::miR-276aSPONGE and UAS::EGFP::SCRAMBLED transgenic flies were generated as previously described (Loya et al., 2009). The “sponge” sequence used for UAS::EGFP::miR-276aSPONGEis: 5’-TCTAGAAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACCGTAGAGCACGGTACTAGTTCCTACTCGAG-3’.And the “sponge” sequence used for UAS::EGFP::SCRAMBLED is: 5’-CTCGAGTTAGAATTTAAACCTCACCATGATGCATTAGAATTTAAACCTCACCATGAGCGGTTAGAATTTAAACCTCACCATGAAGGCTTAGAATTTAAACCTCACCATGAGTCCTTAGAATTTAAACCTCACCATGATGGCTTAGAATTTAAACCTCACCATGAACTTTTAGAATTTAAACCTCACCATGAGGCATTAGAATTTAAACCTCACCATGATAGATTAGAATTTAAACCTCACCATGAGCCTTTAGAATTTAAACCTCACCATGATCTAGA-3’. Two transformant lines (presumably different insertion sites) of each transgene were randomly selected for the behavior study. For clarity, these transformant lines were named as: UAS::EGFP::SPONGE#1, UAS::EGFP::SPONGE#2, UAS::EGFP::SCRAMBLED#1 and UAS::EGFP::SCRAMBLED#4.

The GAL4 stocks used in this study include: pan neuronal driver elav, olfactory sensory neuron driver Or83b, antenna lobe projection neuron driver GH146, antenna lobe local neuron driver GH298, mushroom bodies driver OK107 and c747, ellipsoid body driver c232 and c547 and heat-shock GAL4 (hs-GAL4). Two GAL4 stocks combined with tublin promoter driven temperature sensitive GAL80 transgene, elav; GAL80ts and GAL80ts; OK107 were also used. UAS::mCD8::GFP (Bloomington Stock Center) was also used to virtualize GAL4 expression patterns.

Two strong alleles of DopR gene, dumb1 and dumb2 (Kim et al., 2007b) were used in this study.

Quantitative Real-Time PCR (QPCR)

TaqMan® MicroRNA Assays (Applied Biosystems) were used to quantitate the expression level of miR-276a in wild type, mutant and rescue animals. TaqMan® MicroRNA Assays for miR-276a (assay ID 000297) and the endogenous control 2s rRNA (assay ID 001766), MultiScribe™ reverse transcription kit (4366596), TaqMan® Universal PCR Master Mix, No AmpErase® UNG (4324018) were purchased from Applied Biosystems. The QPCR was performed according to the assay manual. In brief, massive numbers of fly heads were collected for each genotype and total RNA was purified with Trizol (Invitrogen) and treated by DNaseI (Promega). Following reverse transcription (RT) reaction with microRNA specific stem-loop RT primers, quantitative Real-Time PCR (QPCR) reactions were carried out with TaqMan® MicroRNA probes in an Applied Biosystems 7900HT Fast Real-Time PCR System. Ct values obtained from the QPCR reactions were further converted to relative fold changes with a delta-delta-Ct method (Schmittgen, 2001).

TaqMan® Gene Expression Assays (Applied Biosystems) were used to quantitate the expression levels of Zfh2, DopR, Pino, Nf1 and dpr genes for validating potential miR-276a targets. TaqMan® Gene Expression Assays for Zfh2 (assay ID Dm01825551_m1), DopR (assay ID Dm02134813_m1), Pino (assay Dm01845906_m1), Nf1 (assay ID Dm02151064_g1) dpr (assay ID Dm01836227_m1) and the endogenous control RpII140 (assay ID Dm02134593_g1), High Capacity RNA-to-cDNA kit (4387406), TaqMan® Gene Expression Master Mix (4369016) were purchased from Applied Biosystems. The QPCR was performed according to the assay manual. In brief, massive numbers of fly heads were collected for each genotype and total RNA was purified with Trizol (Invitrogen) and treated by DNaseI (Promega). Following reverse transcription (RT) reaction, quantitative Real-Time PCR (QPCR) reactions were carried out with TaqMan® Gene Expression Assay probes in an Applied Biosystems 7900HT Fast Real-Time PCR System. Ct values obtained from the QPCR reactions were further converted to relative fold changes with a delta-delta-Ct method (Schmittgen, 2001).

Behavior assays

Olfactory associative memory was tested by training 2–3 day old flies in a T-maze apparatus using a Pavlovian conditioning paradigm (Tully et al., 1994; Tully and Quinn, 1985). Approximately 100 flies were loaded into an electrifiable training grid. For a single training session, flies were exposed sequentially to one odor (the conditioned stimulus, CS+), which was paired with a 60-volt electric shock and then a second odor (the unconditioned stimulus, CS−) without shock. 3 minutes after this training session, the flies were tested and allowed to choose between the two odors. A half performance index was calculated by dividing the number of flies that chose correctly, minus the flies that chose incorrectly by the total number of flies in the experiment. The same protocol was then performed with another group of 100 flies and reciprocal odor presentation. The final PI was calculated by averaging both reciprocal half PIs. The long-term-memory (LTM) experiment was an adaptation of this training protocol. Flies were subjected to ten such training sessions in robotic trainers spaced out with a 15-minute rest interval between each. Flies then were transferred into food vials and incubated at 18 °C until being tested 24 hours after the training. A massed training protocol was also performed (ten consecutive single training sessions in robotic trainers without rest intervals). All genotypes were trained and tested in parallel, and rotated between all the robotic trainers to ensure a balanced experiment. Odor pairs and concentrations used for these behavior paradigms are: 3-Octanol (1.5×10−3 v/v) and 4-Methylcyclohexanol (1×10−3 v/v), or 3-Octanol (1.5×10−3 v/v) and Benzaldehyde (0.5×10−3 v/v). Pure odors were purchased from Sigma and delivered as the stated concentrations with air flow at 750ml/min.

Olfactory avoidance was quantified by exposing naïve flies to each odor versus air in the T-maze (i.e. odor from the left and air from the right). After 2 minutes, the number of flies in each arm of the T-maze was counted. Subsequently the directions of odor and air were alternated (i.e. odor from the right and air from the left) and another group of naïve flies were tested. A half PI was calculated by dividing the number of flies that chose air, minus the flies that chose the odor by the total number of flies in the experiment. The final PI was calculated by averaging both reciprocal half PIs. Odor concentrations test for olfactory acuity were indicated in each figure. Pure odors were purchased from Sigma and delivered as the stated concentrations with air flow at 750ml/min.

Shock reactivity was quantified by exposing naïve flies to two electrifiable grids in the T-maze, while delivering a 60-volts electric shock to one of the grids. Flies were also allowed for choosing for 2 minutes. A PI was calculated by dividing the number of flies that chose to avoid the shock, minus the flies that chose the shock by the total number of flies in the experiment.

In all cases, behavior experiments within a figure were performed in parallel.

Quantification of 24hr embryo hatching rate

Crosses with corresponding genotypes were made and maintained in cages on agar plates containing fruit juice for a few days (3–5days). Early in the morning, the agar plates were replaced with fresh new ones and yeast paste to make sure female flies start to lay fertilized eggs in large quantity and then a 4hr egg collection was performed. 24hr after the end of egg collection, numbers of hatched embryos from each cross were counted and hatching rates were calculated by dividing the number of hatched embryos with the total number of embryos.

GAL80ts temperature shift experiment

The female virgin flies with genotypes of elav;GAL80ts or GAL80ts;;OK107 were collected and crossed to WT, UAS::EGFP::miR-276aSPONGE and UAS::EGFP::SCRAMBLED transgenic flies. All the crosses were raised at the permissive temperature (29°C). Upon eclosion, we separated the progenies of each cross to two groups: one was continuously incubated at the permissive temperature (29°C) and the other one was incubated at the restrictive temperature (18°C). Both groups were incubated for an additional 72hr before testing for the avoidance behavior and olfactory memory. The avoidance behavior test was described as above except for that a three times more concentrated 4-Methylcyclohexanol (3×10−3 v/v) was used. Permissive temperature incubation during the entire process of development affected the animal behavior. We raised the testing odor concentration to ensure that a similar level of avoidance index in WT flies with animals raised at 22.5°C can be obtained with animals raised at 29°C. Following temperature shift treatment, olfactory avoidance tests were conducted at 25°C in an environment-controlled room with 70% humidity. LTM experiments were conducted by perform 10X spaced training sessions at 25°C in an environment-controlled room with 70% humidity. The trained flies were kept at 18°C before testing for LTM at 25°C 24hrs later.

Imaging

Expression levels of GAL4 lines were virtualized by UAS::mCD8::GFP with confocal microscopy as described previously (Blum et al., 2009). DopR antibody staining was performed with a method and an anti-DopR antibody described previously (Lebestky et al., 2009).

Statistics

Statistical analyses were performed using JMP software. Student t-test (two tailed) was used for comparisons between two groups. One-way ANOVA followed by post hoc analysis was used for comparisons of multiple groups. Behavioral data from the Pavlovian memory task are normally distributed and are shown in all figures as means ± SEM (Tully et al., 1994). QPCR data are presented as means ±SEM of fold changes.

Results

Genetic reagents to manipulate the miR-276a gene locus

The miR-276aRosa mutant isolated from a forward mutagenesis screen (Dubnau 2003) has a p{lacW} element inserted 1.2Kb upstream of the gene region coding for the predicted dme-mir-276a precursor. dme-mir-276a and the p{lacW} element insertion site fall within a large intergenetic region of about 100Kb, where there are no known or predicted protein coding genes within ~50Kb either upstream or downstream of the miRNA sequence (Fig1. A). dme-mir-276b, which also belongs to the dme-mir-276 gene family, sits ~45Kb upstream. Both of these miRNA loci produce RNA precursors that can contribute to the expression of a miRNA passenger sequence, miR-276* with identical sequence from the two loci (Fig1. B, C). The mature miRNAs, miR-276a and miR-276b, differ from each other by only one nucleotide. Expression profiling of miRNAs from cultured Drosophila S2 cells or various tissues indicate that the abundance of miR-276a is ten fold higher than miR-276b and most miR-276* arises from the dme-mir-276a precursor locus (Czech et al., 2008).

Figure 1
Genetic and behavioral characterization of miR-276a gene locus

To investigate the function of miR-276a locus in behavior, we first generated a suite of reagents to manipulate miR-276a expression with both temporal and cell type specificity. We generated both precise and imprecise excisions of the p{lacW} element insertion (Fig1. A and Methods). In the miR-276aD8 allele, a ~3.6Kb genomic region to the right of the p{lacW} element insertion site was deleted and a ~2.8Kb residual sequence of the P-element was left in the genome. miR-276aD8 therefore removes the entire mir-276a precursor and can be considered a null allele. In the miR-276aA6 and the miR-276aD2.2 alleles, the P-element is almost completely removed with ~10bp residual P-element sequence remaining in the genome. No flanking deletions were detected. These excision alleles therefore are predicted to restore the normal function of this locus (Fig1. A). In addition to these mutant alleles, we generated transgenic rescue animals containing genomic BAC clones, CH322-133G18 (~20Kb), CH322-151H13 (~19Kb) and CH321-46B15 (~75Kb), which were carried in p[acman] vectors (Venken et al., 2009; Venken et al., 2006). These BAC clones cover the mir-276a precursor region and do not include any nearby protein coding genes or the mir-276b precursor region (Fig1. A).

To characterize the expression of miR-276a in the above mutants and BAC rescue transgenes, we used Quantitative Real-Time PCR (QPCR) to detect miR-276a levels in fly heads (Fig1. D and Fig2. C). In the miR-276aRosa homozygous mutant animal heads, miR-276a expression level was reduced by about 40% compared to wild type animals. In the miR-276aD8 homozygous mutant animal heads, miR-276a expression (Fig1. D, F(3,18)=25.09, p<0.05) was nearly eliminated (the low residual expression presumably derives from miR-276b locus, which differs from miR-276a by only one nucleotide). This is consistent with the conclusion that miR-276aD8 is a null allele of miR-276a, while miR-276aRosa, is a hypomorphic allele. Animals trans-heterozygous for the two mutant alleles, miR-276aD8/Rosa yield defective miR-276a expression that is intermediate between that of miR-276aRosa and miR-276aD8 homozygous animals (Fig1. D, F(3,18)=25.09, p<0.05). Because the homozygous miR-276aD8 mutant is semi-lethal (few survive to adulthood), we used miR-276aD8/Rosa as a viable but strong allele combination for behavioral experiments. For the BAC rescue transgenes, only CH321-46B15, the largest of the three constructs (~75Kb genomic fragment) restored miR-276a expression (Fig2. C, F(3,19)=16.06, p<0.05).

Figure 2
Transgene rescue of miR-276a mutants

miR-276aD8/Rosa mutant animals exhibit defective long-term olfactory memory and naïve olfactory avoidance

An LTM defect originally was reported for the miR-276aRosa hypomorphic allele (Dubnau et al., 2003). We tested short-term and long-term olfactory memory as well as task-relevant sensorimotor responses to the odors and electric shock using the strong miR-276aD8/Rosa allele combination. We found that the miR-276aD8/Rosa animals exhibited significantly defective performance for long-term memory (LTM) measured 24hr after 10 spaced training sessions, while animals heterozygous for miR-276aD8 or miR-276aRosa allele performed normally compared to WT (Fig1. E, F(3,60)=11.77, p<0.05). However, the miR-276aD8/Rosa animals also exhibited significantly defective naïve avoidance responses (Fig1. F and I) to 4-Methylcyclohexanol (MCH) (Fig1. F and I, F(3,18)=5.88, p<0.05) and 3-Octanol (OCT) (Fig1. I, F(3,34)=9.51, p<0.05), but not Benzaldehyde (BA) (Fig1, I, F(3,20)=1.88, n.s.) at the concentrations used for our standard memory assay (1×10−3 v/v, 1.5×10−3 v/v, and 0.5×10−3 v/v respectively for MCH, OCT and BA), compared to WT or heterozygous mutant controls. At 10 fold higher concentrations, responses were appeared normal for OCT (Fig1. I, F(3,20)=4.06, n.s.), but not for MCH (Fig1. I, F(3,20)=19.74, p<0.05). These observations raised the possibility that the reduced naïve odor response of strong allele combinations of miR-276a contributes to the olfactory memory defect (but see below). Avoidance of electric shock (60 volts) appeared normal in all genotypes (Fig1. G, F(3,11)=0.20, n.s.).

miR-276a function underlies naïve olfactory avoidance defects

In addition to the complementation tests shown in Fig1. E and I, we also tested whether the naïve odor avoidance defect was reverted with the precise excision alleles in which the P-element was removed (confirmed by PCR) and the genomic structure was restored. Indeed, animals that were trans-heterozygous for miR-276a mutant alleles (hypomorphic allele miR-276aRosa or null allele miR-276aD8) and either of the two precise excision alleles (miR-276aA6 or miR-276aD2.2) exhibit normal naïve olfactory avoidance responses to MCH (Fig1. H, F(5,30)=16.96, p<0.05). We next tested whether transgenes containing genomic BAC clones are sufficient to rescue the naïve olfactory response defects (Fig2). All three BAC clones tested include the predicted miR-276a precursor region but exclude any other protein coding genes or miR-276b coding region (Fig1. A). We found that the expression levels and behavioral defect of miR-276aD8/Rosa can be fully rescued by providing a transgenic copy of a ~75Kb BAC clone CH321-46B15 (Fig2. A,F(2,35)=5.49, p<0.05). Smaller BAC clones (~20Kb CH322-133G18 and ~19Kb CH322-151H13) (Fig1. A), in contrast, failed to rescue miR-276aD8/Rosa expression or olfactory behavior (Fig2. B, F(3,12)=13.42, p<0.05). Taken together, the above findings provide convergent evidence that miR-276a is responsible for the defect in naïve odor responses.

Dominant negative microRNA “sponge” phenocopies naïve olfactory response defect of miR-276a mutants

As a complementary and independent approach, we made use of the “microRNA sponge” system (Ebert et al., 2007), which was recently adapted to the Drosophila model (Loya et al., 2009). The “sponge” transgenes include 10 repetitive sequences complementary to miR-276a with mismatches at positions 9–12 for enhanced stability. When UAS::EGFP::miR-276aSPONGE expression is induced by GAL4, endogenous miR-276a should be “soaked up” and its normal function should be interfered with (Fig3. A). As controls, we used UAS::EGFP::SCRAMBLED flies in which 10 repetitive complementary sequences are replaced by a scrambled sequence that is not recognized by any microRNA in Drosophila. We demonstrated the efficiency and specificity of this approach with an in vivo assay in which expression of UAS::EGFP::miR-276aSPONGEcan suppress the developmental lethality from pan-neuronal over-expression of miR-276a (Fig3. B). We next tested naïve olfactory avoidance behavior in animals expressing UAS::EGFP::miR-276aSPONGE or UAS::EGFP::SCRAMBLED under the pan-neuronal elav-GAL4 driver (Fig3. E). We used two independent transgenic lines each for UAS::EGFP::miR-276aSPONGE and UAS:: EGFP::miR-SCRAMBLED. We found that expression of the UAS::EGFP::miR-276aSPONGE in neurons impaired the animals’ performance in the naïve olfactory avoidance assay, while animals that express the UAS::EGFP::SCRAMBLED transgenes performed normally (Fig3. E, F(5,42)=24.48, p<0.05). The control animals that contained the UAS-transgenes but not the Gal4 driver performed normally as well (Fig3. F, F(4,25)=0.75, n.s.).

Figure 3
Post development miR-276a function in EB neurons for naïve olfactory responses

In addition to recapitulating the mutant phenotype, the “sponge” system also provided an indirect observation of miR-276a expression pattern. Because endogenous miR-276a can bind to the 3’UTR of the UAS::EGFP::miR-276aSPONGE transgene, expression of EGFP driven from the pan-neuronal elav-GAL4 was dramatically reduced when compared with that of UAS::EGFP::SCRAMBLED. This is consistent with the idea that miR-276a is broadly expressed in adult fly heads (Fig3. C and D).

Post-development function of miR-276a is sufficient for naïve olfactory responses

In order to define the temporal requirements for miR-276a function, we combined a tubulin promoter driven GAL80 temperature sensitive (GAL80ts) transgene (McGuire et al., 2004) with elav-GAL4. GAL80ts is a suppressor of GAL4, and at the permissive temperature (18°C), GAL80ts is active and suppresses GAL4-controlled UAS::EGFP::miR-276aSPONGE transgene expression. At the restrictive temperature (29°C), GAL80ts is inactivated, and the SPONGE or SCRAMBLED transgenes are expressed. We crossed either UAS::EGFP::miR-276aSPONGE or UAS::EGFP::SCRAMBLED transgenic flies to elav;GAL80ts animals. Progeny from these crosses were kept at the restrictive temperature (29°C). Hence transgene expression was kept on, and miR-276a function was blocked during development. After eclosion, we separated the progeny of each cross into two groups: one was continuously incubated at the restrictive temperature (29°C) where miR-276a function is disrupted, and the other one was shifted to the permissive temperature (18°C) allowing miR-276a function to be turned back on. Both groups were incubated for an additional 72hr before being tested for avoidance behavior (Fig3. G). We found that when miR-276a function was kept off after eclosion (no shift to permissive temperature), the flies that contained UAS::EGFP::miR-276aSPONGE transgenes exhibited reduced naïve odor avoidance compared with UAS::EGFP::SCRAMBLED and elav/+; GAL80ts/+ control animals. This was true for each of the two independent “sponges” versus “scrambled” transgenes. In contrast, when the UAS::EGFP::miR-276aSPONGE transgene was turned off after development (permitting a recovery of miR-276a function), we observed a significant restoration of naïve olfactory avoidance in the temperature shifted group (Fig3. G, SPONGE#1 ,t(22)=4.65, p<0.05; SPONGE#2, t(22)=2.71, p<0.05). In control crosses with the UAS::EGFP::SCRAMBLED transgenes, there was no significant difference between temperature shifted and un-shifted groups (Fig3. G, SCRAMBLED#1, t(6)=0.73, n.s.; SCRAMBLED#4, t(6)=0.68, n.s.). These findings demonstrate that acute (post-developmental) function of miR-276a is sufficient for normal naïve odor avoidance. Thus this behavioral effect is unlikely to derive from defects in neural development.

miR-276a is required in ellipsoid body (EB) neurons for normal naïve olfactory responses to MCH

To map the neural cell types in which miR-276a function is required, we conducted a small scale screen in which the UAS::EGFP::miR-276aSPONGE was tested in combination with a set of GAL4 lines that each interrogate distinct subsets of the known circuits that underlie either olfaction or olfactory memory. Because some of these GAL4 lines may drive modest levels of expression, we combined the two UAS::EGFP::miR-276aSPONGE transformant lines in order to increase the levels of transgene expression (Loya et al., 2009). We selected GAL4 lines that express in olfactory sensory neurons (Or83b), antenna lobe projection neurons (GH146), antenna lobe local interneurons (GH298), mushroom bodies (MB; OK107 and c747) and two different sets of ellipsoid body (EB) neurons (c232 and c547) (Fig3. H and I). In each case, we tested naïve olfactory responses to MCH in animals that contained both the GAL4 driver and two UAS::EGFP::miR-276aSPONGE transgenes in comparison with controls that were heterozygous for the GAL4 drivers. Surprisingly, the collection of GAL4 lines (Or83b, GH146, GH298, OK107 and c747) that query the main olfactory system from receptor to mushroom bodies yielded normal naïve olfactory avoidance behavior (Fig3. I, Or83b, t(6)=0.39, n.s.; GH146, t(6)=0.93, n.s.; GH298, t(6)=0.84, n.s.; OK107, t(6)=1.81, n.s.; c747, t(6)=0.06, n.s ). In contrast, only c547, which labels the R2/R4m subset of neurons in the EB (Fig3. J), showed significantly reduced naïve olfactory avoidance of MCH (Fig3. I, t(14)=3.37, p<0.05). c232, which labels R3/R4d EB neurons did not impact olfactory avoidance (Fig3. I, c232, t(6)=0.92, n.s.). The finding with c547 labeled R2/R4m neurons was unexpected because EB neurons are several synapses downstream of the primary circuits that are thought to code for olfactory stimuli (Chiang et al., 2011) (FlyCircuit Database: http://www.flycircuit.tw). Several studies, however, have linked EB neurons to long-term olfactory memory (Wu et al., 2007), and arousal to external stimuli (Kong et al., 2010; Lebestky et al., 2009). The arousal phenotypes of mutations in a Dopamine receptor (DopR) gene are of particular relevance because they can be fully rescued by DopR expression using the c547 GAL4 but not c232 GAL4 (Kong et al., 2010; Lebestky et al., 2009). The requirement for miR-276a function in R2/R4m EB neurons thus guided our search for functional targets of miR-276a.

miR-276a impact on naïve avoidance of MCH is mediated by DopR

We used four published methods (Pictar: http://pictar.mdc-berlin.de/; TargetScanFly6.0: http://www.targetscan.org/fly/; ElMMo: http://www.mirz.unibas.ch/ElMMo2/; and miRanda: http://www.microrna.org/microrna/home.do) (Grun et al., 2005) (Ruby et al., 2007) (Enright et al., 2003) (Betel et al., 2010) (Gaidatzis et al., 2007) to predict mRNA targets of miR-276a and obtained a list of predicted target genes that we prioritized based on prediction scores from each method, known nervous system expression patterns and neuronal or behavioral functions (Fig4. A). We focused on the following genes: Zn finger homeodomain 2 (zfh2), defective proboscis extension response (dpr), Dopamine receptor (DopR), Pinocchio (Pino, also known as smi21F, smell impaired 21F) and Neurofibromin 1 (Nf1). These predicted target genes rank with high scores with all prediction methods and have established functions related to nervous system development (Lundell and Hirsh, 1992), regulating arousal (Andretic et al., 2008; Kong et al., 2010; Lebestky et al., 2009), mediating olfactory responses (Nakamura et al., 2002; Rollmann et al., 2005) and olfactory learning and memory(Kim et al., 2007b; Qin et al., 2012). We tested whether reducing miR-276a expression can acutely alter predicted target gene expression. We crossed a heatshock GAL4 (hs-GAL4) driver to a UAS::miR- 276a-4.7Kb transgene to over-express miR-276a through development at 29°C, at which temperature hs-GAL4 has leaky expression (Xia et al., 2005). After eclosion, we separated the progeny into two groups: one was continuously incubated at 29°C, and the other was incubated at 18°C to reduce heatshock-driven expression (Fig4. B). hs-GAL4/+ heterozygous animals were used as a control. We used QPCR to compare the expression levels of each candidate target gene in heads from animals that had been kept at 29°C with those that had been shifted to 18°C to reduce the transgenic expression of miR-276a. In the case of Zfh2 and DopR, we observe a significant increase in expression levels when the miR-276a transgene is silenced (Fig4. C, t(4)=4.32, p<0.05 and D, t(4)=2.27, p<0.05). With Pino and Nf1, no change in expression was detected (Fig4. F and G, n.s.). With dpr, we see a trend of increased expression in both the hs-GAL4/UAS::miR-276a-and hs-GAL4/+ control genotypes, indicating that temperature shift on its own can affect dpr expression levels (Fig4E, t(3)=5.03, p=0.02 and t(4)=1.85, p=0.06). Thus two out of 5 tested candidates showed miR-276a-dependent changes in transcript levels (and see below for protein level). The increased expression of Zfh2 and DopR when the miR-276a transgene is turned off supports the idea that the micro-RNA normally represses these two genes. As a second test of this regulatory relationship, we used an acute induction protocol in which the heatshock-driven miR-276a transgene was kept off (18°C) during development and then acutely induced with a 40min heat shift (37°C) followed by 4 hours recovery. With this acute induction protocol (Fig4. H), both Zfh2 and DopR levels are decreased (Fig4. I, t(4)=4.07, p<0.05 and J, t(4)=4.46, p=0.05).

Figure 4
miR-276a regulates DopR expression level

The DopR 3’UTR contains at least one putative miR-276a binding site, which is highly conserved across Drosophila species (Fig5. A). While we cannot be certain whether the effects on DopR are direct and mediated by the putative target motif, we do observe a negative regulatory effect of miR-276a on DopR expression as predicted for a direct target. In either case, the negative sign of interaction predicts that mutation of miR-276a would cause increased DopR expression. This idea was of particular interest because of our finding that miR-276a functions within R2/R4m EB neurons that are labeled by c547. DopR function within these neurons has an established role in two different forms of arousal (Kong et al., 2010; Lebestky et al., 2009) and the DopR mutations exhibit a dominant increase in arousal, suggesting dosage sensitivity (Lebestky et al., 2009). In our case, mutations of miR-276a would lead to increased DopR expression, which should cause decreased arousal. We therefore tested whether reducing the copy number of DopR can suppress miR-276a mutations. We introduced a copy of the DopRdumb2 allele into the miR-276aD8/Rosa mutant and tested naïve olfactory avoidance. Remarkably, the DopRdumb2/+; miR-276aD8/Rosa animals exhibit normal avoidance (Fig5. B, F(2,29)=23.55, p<0.05). Taken together with the expression studies described above, this experiment provides strong evidence that DopR is a functional downstream effector of miR-276a within R2/R4m EB neurons and that this regulatory relationship impacts naïve responses to this olfactory stimulus.

Figure 5
DopR is a downstream target of miR-276a for naïve olfactory responses

miR-276a impacts olfactory LTM via effects on DopR expression in mushroom bodies (MB)

In addition to EB, DopR also is expressed in MB (Kim et al., 2007b; Lebestky et al., 2009; Fig6. A and B), the main anatomical structure underlying olfactory memory and learning in Drosophila. Mutations in the DopR gene can completely abolish STM and LTM and restoring DopR expression in the γ-neuron subset of MB is sufficient to rescue both STM and LTM (Kim et al., 2007b; Lebestky et al., 2009; Qin et al., 2012). We therefore wondered whether the same miR-276a::DopR regulatory relationship in EB also occurs in MB to modulate DopR expression levels. We examined DopR expression levels by immunohistochemistry in brains where UAS::EGFP::miR-276aSPONGE is expressed in OK107-labeled MB neurons. We found that there is indeed a substantial elevation of DopR expression in MB when we drive the “sponge” transgene in MB compared to control animals (UAS::EGFP::miR-276aSPONGE/+ heterozygous animals) (Fig6. C and D). These results are consistent with the effects on DopR expression observed with QPCR (Fig4).

Figure 6
miR-276a regulates DopR in MB for LTM

The finding that miR-276a regulates DopR in MB suggested a role in olfactory memory. In the case of the miR-276aD8/Rosa mutant animals, the defect in naïve odor responses precluded conclusions regarding effects on memory per se because responding to the odors and shock stimuli used in the conditioning procedure are pre-requisites for performance. But the differing effects on naïve odor avoidance of cell type specific “sponge” expression in EB versus MB suggested that we might be able to separate effects on memory from those on naïve odor responses. Expression of the UAS::EGFP::miR-276aSPONGE in MB using either GAL4 driver lines OK107 or c747 in fact did not cause defects in naive olfactory avoidance to any of the three odors tested or to shock avoidance (Fig3. I and Fig6. I, for BA, F(2,9)=2.13, n.s.; for OCT, F(2,9)=0.47, n.s.; for shock, , F(2,19)=0.39, n.s.). Because odor avoidance and shock reactivity were normal with miR276a “sponge” expression in MB, it provided a means to test the role in memory in a meaningful way without the caveats that come along with defects in task relevant sensorimotor responses. We therefore tested the effects on memory and learning of expressing the sponge in MB with each of these two GAL4 lines (Fig6. E-H, J and K). Although responses to all three odors tested appear normal with MB-driven “sponge” expression, we selected OCT and BA for these discriminative olfactory conditioning experiments because the naïve response defects to these odors are mild compared with MCH even for the case where miR-276a function is compromised in the whole animal (Fig1. I). With the OK107 GAL4 line, we observed a significantly reduced memory performance measured 24 hours after spaced repetitive training (LTM) (Fig6. E, F(3,28)=11.49, p<0.05) but not after repetitive massed training or immediately after one training session (Fig6. F, t(12)=0.08, n.s. and G, t(16)=2.67, n.s.). Thus the defect appears specific to LTM, which requires new protein synthesis (Tully et al., 1994). LTM is similarly reduced with GAL4 line c747, which also labels MB neurons (Fig6. H, F(2,39)=6.60, p<0.05).

We wondered whether miR-276a function in MB for LTM is mediated by regulation of DopR expression as was the case in EB for naïve olfactory responses to MCH. We introduced a copy of a strong DopR allele, into animals that also express UAS::EGFP::miR-276aSPONGE in MB. Because this experiment made use of GAL4 to drive the sponge transgene, we used the DopRdumb1 allele rather than DopRdumb2 because the latter allele contains a GAL4 responsive UAS element upstream of the DopR coding region (see below). We found that removing one copy of the DopR gene was sufficient to fully suppress the effects on olfactory memory caused by expressing the dominant negative miR-276a “sponge”. The defective LTM observed in UAS::EGFP::SPONGE#1/c747; UAS::EGFP::SPONGE#2 animals is fully reversed in UAS::EGFP::SPONGE#1/c747; UAS::EGFP::SPONGE#2, DopRdumb1/+ animals (Fig6. H). This experiment is consistent with the idea that miR276a normally holds DopR levels in check within MB. When the micro-RNA function is reduced, DopR levels increase (Fig4., Fig5. and Fig6. C and D), and removing one copy of the DopR gene suppresses the effect. A prediction of this dosage sensitivity hypothesis is that over-expression of DopR in MB above and beyond the levels normally seen also should compromise LTM. To test this idea, we compared the effects on LTM of expressing three different levels of DopR in MB. First, the DopRdumb2 homozygous mutation has very little expression of DopR and results in profoundly deficient LTM performance (Qin et al., 2012). The DopRdumb2 allele is caused by insertion of a P-element in the upstream region (Kim et al., 2007a). Because this P-element contains a Gal4 responsive UAS enhancer, the memory defects can be rescued when combined with a strong MB-Gal4 line such as OK107, which drives expression of the flanking DopR gene on each of the two DopRdumb2 alleles in the homozygous mutant (Kim et al., 2007a; Qin et al., 2012). In order to drive even higher levels of DopR within MB neurons, we tested the effects of adding a third UAS-responsive transgene (UAS::DopR). This results in an LTM defect that is as severe as that seen with the strong loss of function homozygous mutant (Fig6. L, F(3,28)=19.66, p<0.05).

Acute function of miR-276a is sufficient for normal olfactory memory

Post-development function of miR-276a is sufficient to restore the naïve olfactory response defect of miR-276a mutant animals (Fig3. G). To test whether acute expression of miR-276a also is sufficient to restore normal LTM, we again introduced a copy of temperature sensitive GAL80ts. Animals that contained the SPONGE transgenes, the OK107 GAL4 line and the GAL80ts (UAS::EGFP::SPONGE#1/GAL80ts; UAS::EGFP::SPONGE#2/+; OK107/+) and control groups that contained the GAL80ts and the OK107 GAL4 line (GAL80ts/+; OK107/+) were each raised at the restrictive temperature (29°C) to keep the “sponge” transgene induced and miR-276a function blocked in OK107-labelled MB neurons during development. After eclosion, we separated the progeny from each cross into two groups: one was continuously incubated at the restrictive temperature (29°C) where miR-276a function remained off in MB, and the other one was incubated at the permissive temperature (18°C) allowing miR-276a function to be turned back on in MB. Both groups were incubated for an additional 72hr before being tested for LTM. We found that activation of miR-276a function in MB after development was sufficient to support fully normal LTM performance (Fig6. M, F(3,28)=4.35, p<0.05). In control groups there were no significant differences between temperature shifted and un-shifted groups. Thus as with naïve olfactory avoidance responses, post-developmental function of miR-276a also is sufficient to support LTM.

Taken together, our findings support the conclusion that naïve and conditioned odor responses each require miR-276a function, but in distinct neural circuits. Moreover, in each case DopR is a functional downstream regulatory target. Our data support a model (Fig7) in which the levels of DopR are tuned by miR-276a within each of these two neural circuits.

Figure 7
A model in which miR-276a tunes DopR levels in EB and MB for naïve olfactory arousal response and long-term memory

Discussion

miRNAs have been proposed to provide robustness to gene regulatory networks (Herranz and Cohen, 2010) (Pelaez and Carthew, 2012), but they can also act as cell fate or developmental switches (Flynt and Lai, 2008). In the brain, perturbations of miRNA biogenesis have major impacts on development, neurodegeneration (Berdnik et al., 2008; Cuellar et al., 2008; Davis et al., 2008; Giraldez et al., 2005; Kim et al., 2007b; Schaefer et al., 2007) and behavior such as circadian rhythms and memory. For example, disruption in mice of the miRNA-processing enzyme, Dicer, enhances synaptic plasticity and fear memory (Konopka et al., 2010). Cell type specific disruption of dicer-1 in Drosophila also impairs circadian behavior (Kadener et al., 2009). Because such disruptions of the miRNA biogenesis and effector machinery impact production or function of all or most miRNAs, it is not unexpected that phenotypic effects are pervasive and pleiotropic.

miRNA profiling studies in brain in fact demonstrate that different neuronal cell types express distinct populations of miRNAs and some of the neuronal miRNAs distribute to different subcellular localizations (Edbauer et al., 2010; He et al., 2012; Kaern et al., 2005; Kim et al., 2004; Kim et al., 2007b; Krichevsky et al., 2003; Kye et al., 2007; Lagos-Quintana et al., 2002; Landgraf et al., 2007; Minones-Moyano et al., 2011; Miska et al., 2004; Natera-Naranjo et al., 2010; Sempere et al., 2004). Moreover, each miRNA gene in principle can regulate many different targets across multiple cell types, and each mRNA can in principle be targeted by multiple miRNAs. Thus cell-type specific manipulations of individual miRNAs within an in vivo context are needed to decipher underlying mechanisms and functionally relevant targets. A series of recent studies have implicated individual miRNA genes in brain development, neurodegeneration, plasticity and behavior (Cayirlioglu et al., 2008; Chandrasekar and Dreyer, 2009; Cheng et al., 2007; Gao et al., 2010; Hansen et al., 2010; Kadener et al., 2009; Karres et al., 2007; Kye et al., 2011; Lin et al., 2011; Liu et al., 2012; Luo and Sehgal, 2012; Magill et al., 2010; Mellios et al., 2011; Nudelman et al., 2010; Rajasethupathy et al., 2009). Several of these studies hint at the idea that for a given phenotype, several miRNAs can converge on a common target, and there are a few cases where phenotypic effects may be mediated largely via one common target. (Yoon et al., 2011) (Luo and Sehgal, 2012) (Cayirlioglu et al., 2008). In the case of memory and synaptic plasticity, there is some evidence for convergence of miRNAs (and piRNAs) onto CREB as a target (Gao et al., 2010; Rajasethupathy et al., 2012; Rajasethupathy et al., 2009) (Yang et al., 2012). But there still are relatively few cases where miRNA gene function has been established within neural circuits for specific behaviors. And the architecture of downstream regulatory effects of miRNAs on brain function in general and on memory in particular are poorly understood.

We took advantage of both classic and modern Drosophila genetic approaches to manipulate miR-276a function in defined neural circuits with temporal specificity. Starting with a hypomorphic allele that was identified in a forward mutagenesis screen (Dubnau et al., 2003), we engineered a null mutation, precise excisions, BAC rescue transgenes, GAL4-responsive transgenes, and a GAL4-responsive dominant-negative “sponge” transgene. The “sponge” method (Ebert and Sharp, 2010; Loya et al., 2009) in particular provided a means to manipulate miR-276a function in vivo with cell type and temporal specificity of the GAL4 transactivator system. Proof of principle experiments with “sponges” for miR-7, miR-8 and miR-9a in appropriate tissues produce comparable developmental phenotypes as classic loss-of-function mutant alleles (Loya et al., 2009).

Similarly, the miR-276a “sponge” used in this study was able to phenocopy the effects observed in miR-276a mutant animals. Combining this dominant negative “sponge” with GAL4/GAL80ts reagents provided the means to dissect miR-276a post-development function underlying two different behavioral phenotypes into distinct neural circuits. This provides the first example in which a miRNA gene’s function is demonstrated in behaving animals with both cell-type and temporal specificity. By separately testing effects of miR-276a manipulation within two different neural cell types, we uncovered distinct effects on two related olfactory behaviors. When the sponge was used to interfere with miR-276a function within all neurons, we observed defective responses to odors with naïve animals. This precluded a meaningful test of performance in the olfactory memory task. Surprisingly, sponge expression within each of the major cell types of the main olfactory system had no impact on olfactory responses, but when we used the sponge to block miR-276a function in EB neurons, we reproduced the defect in naïve responses to MCH. In contrast, sponge expression in MB neurons did not impact naïve responses, which provided an opportunity to test olfactory memory without the confound that come from odor response defects. The cell-type specificity of miR-276a function in c547 expressing R2/R4m EB neurons for naive responses to MCH and in MB intrinsic neurons for LTM also pointed to a functionally relevant downstream target from among those that were suggested by bioinformatics predictions and QPCR validations.

We focused on DopR both because it contains a conserved miR-276a binding site and because like miR-276a, DopR function has been mapped to MB for memory and to EB for naïve responses (odors for miR-276a, ethanol and startle response for DopR). We were able to verify that DopR expression is regulated by miR-276a both at the transcript levels in response to transgenic miR-276a induction and at the protein level within MB in response to “sponge” expression. Although we cannot be certain that the regulation of DopR is direct, the sign of the effect is as predicted for a direct target. More importantly, the regulatory relationship is biologically relevant. Both behaviors are fully suppressed when one copy of DopR gene is removed. This supports the conclusion that over-expression of DopR contributes to both behavioral defects observed in miR-276a mutants. And transgenic DopR over-expression in MB in fact was sufficient to produce an LTM defect.

Together with evidence from the literature, these findings suggest a model in which DopR expression levels are dosage sensitive both for LTM and for naïve behavioral responses. We propose that under physiological conditions, a miRNA::DopR regulatory module tunes the levels of DopR in neural circuits underlying naïve olfactory responses and olfactory LTM (Fig5). In the case of LTM, loss of function mutations (Qin et al., 2012) or MB-driven over-expression of DopR (Fig4. E) each yield decreased memory performance similar to that observed with MB expression of the miR-276a “sponge”. Similarly the effects of EB-driven miR-276a “sponge” are rescued by reducing the copy number of DopR. This dosage sensitivity is consistent with the fact that loss of even one copy of DopR in a miR-276a+/+ animal causes elevated startle- mediated arousal (Lebestky et al., 2009).

Dopaminergic signaling also has been demonstrated to set thresholds for multiple types of arousal (Van Swinderen and Andretic, 2011). While the role of DopR in these various forms of arousal is complex, effects on ethanol induced and repetitive startle- induced arousal also have been mapped to c547-labelled R2/R4m EB neurons. We thus interpret the reduced naïve odor responses with c547-driven miR-276a “sponge” to be a result of reduced olfactory arousal, although this remains to be tested. And it should be noted that we have tested the effects of c547-EB-driven sponge on naïve responses to just one odor, MCH.

The potential connection between EB-mediated arousal and MB-mediated olfactory memory is an intriguing one. NMDA receptor function is in fact required in these same EB neurons for normal LTM formation (Wu et al., 2007). So the EB cell types in which miR276a functions for naïve avoidance to MCH also are a part of the circuit for LTM. One attractive possibility is that behavioral experience modulates functional levels of DopR within MB and EB. In this case the observed role of EB on olfactory LTM could derive from long-lasting changes in CS+ arousal mediated by a miR-276a::DopR regulatory mechanism.

Acknowledgments

We thank Kyung-An Han, Tim Lebestky, Glenn Turner, Koen Venken, Leslie Vosshall, Yi Zhong, BACPAC Resources, BestGene Inc., for protocols, strains and reagents. We are also grateful to Allison Blum, Stephane Castel, Christine Cho, Jonathan Coravo, Julius Brennecke, Benjamin Czech, Nabanita Chatterjee, Gregory Hannon, Huaien Wang, Josh Huang, Sitharthan Kamalakaran, Maurice Kernan, Lisa Krug, Fei Li, Lisa Prazak, Yichun Shuai, Tim Tully, Glenn Turner, Shouzhen Xia, Lei Wang, Chaolin Zhang and Yi Zhong for critical discussions, technical support and comments on the manuscript. This work was supported by NIH grant TR01(5R01NS067690-03), NIH grant (5R01MH06944), DART neuroscience LLC and the Beckman Foundation.

Footnotes

The authors declare no competing financial interests.

Commercial interest:

This work was funded in part by DART LLC in the form of a research grant to the Dubnau lab. No personal compensation was involved. And no author has a stake in DART LLC.

References

  • Andretic R, Kim YC, Jones FS, Han KA, Greenspan RJ. Drosophila D1 dopamine receptor mediates caffeine-induced arousal. Proc Natl Acad Sci U S A. 2008;105:20392–20397. [PubMed]
  • Aso Y, Siwanowicz I, Bracker L, Ito K, Kitamoto T, Tanimoto H. Specific dopaminergic neurons for the formation of labile aversive memory. Curr Biol. 2010;20:1445–1451. [PMC free article] [PubMed]
  • Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–233. [PubMed]
  • Berdnik D, Fan AP, Potter CJ, Luo L. MicroRNA processing pathway regulates olfactory neuron morphogenesis. Curr Biol. 2008;18:1754–1759. [PMC free article] [PubMed]
  • Betel D, Koppal A, Agius P, Sander C, Leslie C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 2010;11:R90. [PMC free article] [PubMed]
  • Blum AL, Li W, Cressy M, Dubnau J. Short- and long-term memory in Drosophila require cAMP signaling in distinct neuron types. Curr Biol. 2009;19:1341–1350. [PMC free article] [PubMed]
  • Busto GU, Cervantes-Sandoval I, Davis RL. Olfactory learning in Drosophila. Physiology (Bethesda) 2010;25:338–346. [PMC free article] [PubMed]
  • Cayirlioglu P, Kadow IG, Zhan X, Okamura K, Suh GS, Gunning D, Lai EC, Zipursky SL. Hybrid neurons in a microRNA mutant are putative evolutionary intermediates in insect CO2 sensory systems. Science. 2008;319:1256–1260. [PMC free article] [PubMed]
  • Chandrasekar V, Dreyer JL. microRNAs miR-124, let-7d and miR-181a regulate cocaine-induced plasticity. Mol Cell Neurosci. 2009;42:350–362. [PubMed]
  • Chen CC, Wu JK, Lin HW, Pai TP, Fu TF, Wu CL, Tully T, Chiang AS. Visualizing long-term memory formation in two neurons of the Drosophila brain. Science. 2012;335:678–685. [PubMed]
  • Cheng HY, Papp JW, Varlamova O, Dziema H, Russell B, Curfman JP, Nakazawa T, Shimizu K, Okamura H, Impey S, et al. microRNA modulation of circadian-clock period and entrainment. Neuron. 2007;54:813–829. [PMC free article] [PubMed]
  • Chiang AS, Lin CY, Chuang CC, Chang HM, Hsieh CH, Yeh CW, Shih CT, Wu JJ, Wang GT, Chen YC, et al. Three-dimensional reconstruction of brain-wide wiring networks in Drosophila at single-cell resolution. Curr Biol. 2011;21:1–11. [PubMed]
  • Claridge-Chang A, Roorda RD, Vrontou E, Sjulson L, Li H, Hirsh J, Miesenbock G. Writing memories with light-addressable reinforcement circuitry. Cell. 2009;139:405–415. [PubMed]
  • Cuellar TL, Davis TH, Nelson PT, Loeb GB, Harfe BD, Ullian E, McManus MT. Dicer loss in striatal neurons produces behavioral and neuroanatomical phenotypes in the absence of neurodegeneration. Proc Natl Acad Sci U S A. 2008;105:5614–5619. [PubMed]
  • Czech B, Malone CD, Zhou R, Stark A, Schlingeheyde C, Dus M, Perrimon N, Kellis M, Wohlschlegel JA, Sachidanandam R, et al. An endogenous small interfering RNA pathway in Drosophila. Nature. 2008;453:798–802. [PMC free article] [PubMed]
  • Davis TH, Cuellar TL, Koch SM, Barker AJ, Harfe BD, McManus MT, Ullian EM. Conditional loss of Dicer disrupts cellular and tissue morphogenesis in the cortex and hippocampus. J Neurosci. 2008;28:4322–4330. [PubMed]
  • Dubnau J, Chiang AS, Grady L, Barditch J, Gossweiler S, McNeil J, Smith P, Buldoc F, Scott R, Certa U, et al. The staufen/pumilio pathway is involved in Drosophila long-term memory. Curr Biol. 2003;13:286–296. [PubMed]
  • Ebert MS, Neilson JR, Sharp PA. MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods. 2007;4:721–726. [PubMed]
  • Ebert MS, Sharp PA. MicroRNA sponges: progress and possibilities. Rna. 2010;16:2043–2050. [PubMed]
  • Edbauer D, Neilson JR, Foster KA, Wang CF, Seeburg DP, Batterton MN, Tada T, Dolan BM, Sharp PA, Sheng M. Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132. Neuron. 2010;65:373–384. [PubMed]
  • Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. MicroRNA targets in Drosophila. Genome Biol. 2003;5:R1. [PMC free article] [PubMed]
  • Flynt AS, Lai EC. Biological principles of microRNA-mediated regulation: shared themes amid diversity. Nat Rev Genet. 2008;9:831–842. [PMC free article] [PubMed]
  • Gaidatzis D, van Nimwegen E, Hausser J, Zavolan M. Inference of miRNA targets using evolutionary conservation and pathway analysis. BMC Bioinformatics. 2007;8:69. [PMC free article] [PubMed]
  • Gao J, Wang WY, Mao YW, Graff J, Guan JS, Pan L, Mak G, Kim D, Su SC, Tsai LH. A novel pathway regulates memory and plasticity via SIRT1 and miR-134. Nature. 2010;466:1105–1109. [PMC free article] [PubMed]
  • Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF. MicroRNAs regulate brain morphogenesis in zebrafish. Science. 2005;308:833–838. [PubMed]
  • Grun D, Wang YL, Langenberger D, Gunsalus KC, Rajewsky N. microRNA target predictions across seven Drosophila species and comparison to mammalian targets. PLoS Comput Biol. 2005;1:e13. [PMC free article] [PubMed]
  • Hansen KF, Sakamoto K, Wayman GA, Impey S, Obrietan K. Transgenic miR132 alters neuronal spine density and impairs novel object recognition memory. PLoS One. 2010;5:e15497. [PMC free article] [PubMed]
  • He M, Liu Y, Wang X, Zhang MQ, Hannon GJ, Huang ZJ. Cell-type-based analysis of microRNA profiles in the mouse brain. Neuron. 2012;73:35–48. [PMC free article] [PubMed]
  • Herranz H, Cohen SM. MicroRNAs and gene regulatory networks: managing the impact of noise in biological systems. Genes Dev. 2010;24:1339–1344. [PubMed]
  • Kadener S, Menet JS, Sugino K, Horwich MD, Weissbein U, Nawathean P, Vagin VV, Zamore PD, Nelson SB, Rosbash M. A role for microRNAs in the Drosophila circadian clock. Genes Dev. 2009;23:2179–2191. [PubMed]
  • Kaern M, Elston TC, Blake WJ, Collins JJ. Stochasticity in gene expression: from theories to phenotypes. Nat Rev Genet. 2005;6:451–464. [PubMed]
  • Karres JS, Hilgers V, Carrera I, Treisman J, Cohen SM. The conserved microRNA miR-8 tunes atrophin levels to prevent neurodegeneration in Drosophila. Cell. 2007;131:136–145. [PubMed]
  • Keene AC, Waddell S. Drosophila olfactory memory: single genes to complex neural circuits. Nat Rev Neurosci. 2007;8:341–354. [PubMed]
  • Kim J, Inoue K, Ishii J, Vanti WB, Voronov SV, Murchison E, Hannon G, Abeliovich A. A MicroRNA feedback circuit in midbrain dopamine neurons. Science. 2007a;317:1220–1224. [PMC free article] [PubMed]
  • Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G. Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc Natl Acad Sci U S A. 2004;101:360–365. [PubMed]
  • Kim YC, Lee HG, Han KA. D1 dopamine receptor dDA1 is required in the mushroom body neurons for aversive and appetitive learning in Drosophila. J Neurosci. 2007b;27:7640–7647. [PubMed]
  • Kong EC, Woo K, Li H, Lebestky T, Mayer N, Sniffen MR, Heberlein U, Bainton RJ, Hirsh J, Wolf FW. A pair of dopamine neurons target the D1-like dopamine receptor DopR in the central complex to promote ethanol-stimulated locomotion in Drosophila. PLoS One. 2010;5:e9954. [PMC free article] [PubMed]
  • Konopka W, Kiryk A, Novak M, Herwerth M, Parkitna JR, Wawrzyniak M, Kowarsch A, Michaluk P, Dzwonek J, Arnsperger T, et al. MicroRNA loss enhances learning and memory in mice. J Neurosci. 2010;30:14835–14842. [PubMed]
  • Krashes MJ, DasGupta S, Vreede A, White B, Armstrong JD, Waddell S. A neural circuit mechanism integrating motivational state with memory expression in Drosophila. Cell. 2009;139:416–427. [PMC free article] [PubMed]
  • Krichevsky AM, King KS, Donahue CP, Khrapko K, Kosik KS. A microRNA array reveals extensive regulation of microRNAs during brain development. Rna. 2003;9:1274–1281. [PubMed]
  • Kye MJ, Liu T, Levy SF, Xu NL, Groves BB, Bonneau R, Lao K, Kosik KS. Somatodendritic microRNAs identified by laser capture and multiplex RT-PCR. Rna. 2007;13:1224–1234. [PubMed]
  • Kye MJ, Neveu P, Lee YS, Zhou M, Steen JA, Sahin M, Kosik KS, Silva AJ. NMDA mediated contextual conditioning changes miRNA expression. PLoS One. 2011;6:e24682. [PMC free article] [PubMed]
  • Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr Biol. 2002;12:735–739. [PubMed]
  • Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, et al. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell. 2007;129:1401–1414. [PMC free article] [PubMed]
  • Lebestky T, Chang JS, Dankert H, Zelnik L, Kim YC, Han KA, Wolf FW, Perona P, Anderson DJ. Two different forms of arousal in Drosophila are oppositely regulated by the dopamine D1 receptor ortholog DopR via distinct neural circuits. Neuron. 2009;64:522–536. [PMC free article] [PubMed]
  • Lin Q, Wei W, Coelho CM, Li X, Baker-Andresen D, Dudley K, Ratnu VS, Boskovic Z, Kobor MS, Sun YE, et al. The brain-specific microRNA miR-128b regulates the formation of fear-extinction memory. Nat Neurosci. 2011;14:1115–1117. [PubMed]
  • Liu N, Landreh M, Cao K, Abe M, Hendriks GJ, Kennerdell JR, Zhu Y, Wang LS, Bonini NM. The microRNA miR-34 modulates ageing and neurodegeneration in Drosophila. Nature. 2012;482:519–523. [PMC free article] [PubMed]
  • Loya CM, Lu CS, Van Vactor D, Fulga TA. Transgenic microRNA inhibition with spatiotemporal specificity in intact organisms. Nat Methods. 2009;6:897–903. [PMC free article] [PubMed]
  • Lundell MJ, Hirsh J. The zfh-2 gene product is a potential regulator of neuron-specific dopa decarboxylase gene expression in Drosophila. Dev Biol. 1992;154:84–94. [PubMed]
  • Luo W, Sehgal A. Regulation of circadian behavioral output via a MicroRNA-JAK/STAT circuit. Cell. 2012;148:765–779. [PMC free article] [PubMed]
  • Magill ST, Cambronne XA, Luikart BW, Lioy DT, Leighton BH, Westbrook GL, Mandel G, Goodman RH. microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. Proc Natl Acad Sci U S A. 2010;107:20382–20387. [PubMed]
  • Margulies C, Tully T, Dubnau J. Deconstructing memory in Drosophila. Curr Biol. 2005;15:R700–713. [PMC free article] [PubMed]
  • McGuire SE, Mao Z, Davis RL. Spatiotemporal gene expression targeting with the TARGET and gene-switch systems in Drosophila. Sci STKE. 2004;2004:pl6. [PubMed]
  • Mellios N, Sugihara H, Castro J, Banerjee A, Le C, Kumar A, Crawford B, Strathmann J, Tropea D, Levine SS, et al. miR-132, an experience-dependent microRNA, is essential for visual cortex plasticity. Nat Neurosci. 2011;14:1240–1242. [PMC free article] [PubMed]
  • Minones-Moyano E, Porta S, Escaramis G, Rabionet R, Iraola S, Kagerbauer B, Espinosa-Parrilla Y, Ferrer I, Estivill X, Marti E. MicroRNA profiling of Parkinson's disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial function. Hum Mol Genet 2011 [PubMed]
  • Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR. Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 2004;5:R68. [PMC free article] [PubMed]
  • Nakamura M, Baldwin D, Hannaford S, Palka J, Montell C. Defective proboscis extension response (DPR), a member of the Ig superfamily required for the gustatory response to salt. J Neurosci. 2002;22:3463–3472. [PubMed]
  • Natera-Naranjo O, Aschrafi A, Gioio AE, Kaplan BB. Identification and quantitative analyses of microRNAs located in the distal axons of sympathetic neurons. Rna. 2010;16:1516–1529. [PubMed]
  • Nudelman AS, DiRocco DP, Lambert TJ, Garelick MG, Le J, Nathanson NM, Storm DR. Neuronal activity rapidly induces transcription of the CREB-regulated microRNA-132, in vivo. Hippocampus. 2010;20:492–498. [PMC free article] [PubMed]
  • Pelaez N, Carthew RW. Biological robustness and the role of microRNAs: a network perspective. Curr Top Dev Biol. 2012;99:237–255. [PMC free article] [PubMed]
  • Qin H, Cressy M, Li W, Coravos JS, Izzi SA, Dubnau J. Gamma Neurons Mediate Dopaminergic Input during Aversive Olfactory Memory Formation in Drosophila. Curr Biol. 2012;22:608–614. [PMC free article] [PubMed]
  • Rajasethupathy P, Antonov I, Sheridan R, Frey S, Sander C, Tuschl T, Kandel ER. A Role for Neuronal piRNAs in the Epigenetic Control of Memory-Related Synaptic Plasticity. Cell. 2012;149:693–707. [PMC free article] [PubMed]
  • Rajasethupathy P, Fiumara F, Sheridan R, Betel D, Puthanveettil SV, Russo JJ, Sander C, Tuschl T, Kandel E. Characterization of small RNAs in Aplysia reveals a role for miR-124 in constraining synaptic plasticity through CREB. Neuron. 2009;63:803–817. [PMC free article] [PubMed]
  • Rollmann SM, Mackay TF, Anholt RR. Pinocchio, a novel protein expressed in the antenna, contributes to olfactory behavior in Drosophila melanogaster. J Neurobiol. 2005;63:146–158. [PubMed]
  • Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC. Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs. Genome Res. 2007;17:1850–1864. [PubMed]
  • Schaefer A, O'Carroll D, Tan CL, Hillman D, Sugimori M, Llinas R, Greengard P. Cerebellar neurodegeneration in the absence of microRNAs. J Exp Med. 2007;204:1553–1558. [PMC free article] [PubMed]
  • Schmittgen TD. Real-time quantitative PCR. Methods. 2001;25:383–385. [PubMed]
  • Schratt G, Greenberg M, Krishnarao Appasani SA, Ambros VR. MicroRNA function in the nervous system MicroRNAs. Cambridge University Press; 2007.
  • Schwaerzel M, Monastirioti M, Scholz H, Friggi-Grelin F, Birman S, Heisenberg M. Dopamine and octopamine differentiate between aversive and appetitive olfactory memories in Drosophila. J Neurosci. 2003;23:10495–10502. [PubMed]
  • Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004;5:R13. [PMC free article] [PubMed]
  • Tully T, Preat T, Boynton SC, Del Vecchio M. Genetic dissection of consolidated memory in Drosophila. Cell. 1994;79:35–47. [PubMed]
  • Tully T, Quinn WG. Classical conditioning and retention in normal and mutant Drosophila melanogaster. J Comp Physiol A. 1985;157:263–277. [PubMed]
  • Van Swinderen B, Andretic R. Dopamine in Drosophila: setting arousal thresholds in a miniature brain. Proc Biol Sci. 2011;278:906–913. [PMC free article] [PubMed]
  • Venken KJ, Carlson JW, Schulze KL, Pan H, He Y, Spokony R, Wan KH, Koriabine M, de Jong PJ, White KP, et al. Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nat Methods. 2009;6:431–434. [PMC free article] [PubMed]
  • Venken KJ, He Y, Hoskins RA, Bellen HJ. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science. 2006;314:1747–1751. [PubMed]
  • Wu CL, Xia S, Fu TF, Wang H, Chen YH, Leong D, Chiang AS, Tully T. Specific requirement of NMDA receptors for long-term memory consolidation in Drosophila ellipsoid body. Nat Neurosci. 2007;10:1578–1586. [PMC free article] [PubMed]
  • Xia S, Miyashita T, Fu TF, Lin WY, Wu CL, Pyzocha L, Lin IR, Saitoe M, Tully T, Chiang AS. NMDA receptors mediate olfactory learning and memory in Drosophila. Curr Biol. 2005;15:603–615. [PMC free article] [PubMed]
  • Yang Y, Shu X, Liu D, Shang Y, Wu Y, Pei L, Xu X, Tian Q, Zhang J, Qian K, et al. EPAC null mutation impairs learning and social interactions via aberrant regulation of miR-124 and Zif268 translation. Neuron. 2012;73:774–788. [PMC free article] [PubMed]
  • Yoon WH, Meinhardt H, Montell DJ. miRNA-mediated feedback inhibition of JAK/STAT morphogen signalling establishes a cell fate threshold. Nat Cell Biol. 2011;13:1062–1069. [PMC free article] [PubMed]