PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
 
Antimicrob Agents Chemother. 2013 January; 57(1): 37–41.
PMCID: PMC3535906

KPC-4 Is Encoded within a Truncated Tn4401 in an IncL/M Plasmid, pNE1280, Isolated from Enterobacter cloacae and Serratia marcescens

Abstract

We describe the transfer of blaKPC-4 from Enterobacter cloacae to Serratia marcescens in a single patient. DNA sequencing revealed that KPC-4 was encoded on an IncL/M plasmid, pNE1280, closely related to pCTX-M360. Further analysis found that KPC-4 was encoded within a novel Tn4401 element (Tn4401f) containing a truncated tnpA and lacking tnpR, ISKpn7 left, and Tn4401 IRL-1, which are conserved in other Tn4401 transposons. This study highlights the continued evolution of Tn4401 transposons and movement to multiple plasmid backbones that results in acquisition by multiple species of Gram-negative bacilli.

INTRODUCTION

Klebsiella pneumoniae carbapenemase (encoded by blaKPC), a functional group 2f, molecular class A serine β-lactamase conferring resistance to all β-lactam antibiotics except cephamycins, is the most common carbapenemase isolated in the United States (1). There are at least 12 known blaKPC types published in the literature or deposited in GenBank; however, the biological significance of these types is unknown. Although blaKPC is commonly isolated from K. pneumoniae sequence type 258 (ST258) worldwide (2, 3), it is also found in other Gram-negative species, including Serratia marcescens and Enterobacter cloacae (46). In addition, KPC is encoded on a highly conserved transposon, Tn4401, found on several different transferable plasmid replicons in multiple species (4, 610). Tn4401 has at least 6 known isoforms (a through e, with two isoforms called Tn4401d) that are distinct due to deletions found just upstream of blaKPC (99-bp deletion [isoform a], no deletion [isoform b], 215-bp deletion [isoform c], 68-bp deletion [isoform d], and 255-bp deletion [isoform e]) (2, 3, 1114). A separate Tn4401d that contains a partial deletion in blaKPC has been reported (11). We report the isolation of blaKPC-4 from E. cloacae and its subsequent in vivo transfer to S. marcescens in a single patient at an academic medical center. blaKPC-4 was isolated within a unique Tn4401 isoform (Tn4401f) on an IncL/M plasmid, pNE1280, from both E. cloacae and S. marcescens. Bioinformatic analysis of pNE1280 demonstrated high nucleotide identity to the previously sequenced IncL/M plasmid pCTX-M360, carrying blaCTX-M (15).

MATERIALS AND METHODS

Susceptibility testing and molecular methods.

Antibiotic susceptibility testing of all isolates was performed using either Etest (bioMérieux, Marcy l'Etoile, France) or disk diffusion (16) and interpreted using standards from the Clinical and Laboratory Standards Institute (CLSI) (17). The modified Hodge test, used to phenotypically detect the presence of a carbapenemase, was performed according to the CLSI guidelines (17). K. pneumoniae BAA1705 and BAA1706 were used as positive and negative controls, respectively (17). Extended-spectrum β-lactamases (ESBLs) were phenotypically detected by testing the MICs of cefotaxime and ceftriaxone alone and in combination with clavulanate. A ≥3, twofold concentration decrease in an MIC for either ceftriaxone or cefotaxime tested in combination with clavulanate in comparison to the MIC when tested alone was considered positive for an ESBL (17). The primers used to detect the presence of blaKPC and IncL/M repA were as follows: KPC forward (ATGTCACTGTATCGCCGTCT) and KPC reverse (TTTTCAGAGCCTTACTGCCC), and IncL/M forward (GGATGAAAACTATCAGCATCTGAAG) and IncL/M reverse (CTGCAGGGGCGATTCTTTAGG) (1820). Isoelectric focusing, performed as described by Mathew et al. (21), was used to detect the presence and pIs of specific β-lactamases. Pulsed-field gel electrophoresis (PFGE) was performed according to the standard Pulsenet protocol for Escherichia coli, as described by Ribot et al. (22). Southern blot analysis (23) was performed using a blaKPC-4 DNA probe generated using KPC forward and reverse; DNA probes were subsequently labeled with digoxigenin-labeled dUTP (Roche). The subsequent hybridization and development of the Southern blots were performed as described in the manufacturer's DIG application manual (Roche). Plasmid was isolated from E. cloacae and E. coli using either the method of Kado and Liu (24) or the Qiagen (Valencia, CA) Large Construct Kit following the manufacturer's recommendations. Plasmid DNA was transformed into E. coli ElectroMAX Stbl4 or DH5α (Invitrogen, Carlsbad, CA) using heat shock and the manufacturer's recommendations. Conjugation experiments were performed by inoculating equal amounts (105 CFU) of the donor (either E. cloacae 1623 or S. marcescens 1638; both ampicillin resistant and sodium azide susceptible) and the recipient (E. coli J53; ampicillin susceptible and sodium azide resistant) (25, 26) onto a nitrocellulose filter (Millipore; 0.025-μm VSWP) placed on a brain heart infusion agar (Difco) plate. Following 18 h of incubation at 37°C, the filter was placed in 0.5 ml saline, vortexed, diluted, and plated on LB agar (Difco) containing 50 μg/ml ampicillin and 250 μg/ml sodium azide (Sigma) to detect transconjugants.

Plasmid sequencing and bioinformatic analyses.

pNE1280 was isolated from E. coli DH5α and sequenced on an Illumina GAIIx sequence analyzer (Illumina, San Diego, CA) using the University of Nebraska Medical Center (UNMC) Next Generation Sequencing Core Facility. Bioinformatic analyses included plasmid sequence annotation using the Maker Genome annotation pipeline (27), which requires protein sequences from closely related organisms. We obtained protein sequences from the plasmid sequences EU938349 and EU176011. The output of this pipeline was used to create a TBL file, which contains all sequence features in a tabular format. These data, together with published information, were converted with a TBL2ASN program (http://ncbi.nlm.nih.gov/genbank/tbl2asn2/) to generate an SQN file that could be submitted to GenBank.

RESULTS AND DISCUSSION

While performing a statewide public health surveillance study assessing the prevalence of expanded-spectrum cephalosporin and carbapenem resistance in the Enterobacteriaceae, we identified a 60-year-old female with a medical history of mitral and aortic valve stenosis, pulmonary hypertension, restrictive lung disease, and diabetes in January 2010. She was admitted for progressive dyspnea and renal failure and underwent aortic and mitral valve replacement 10 days later. Her postoperative course was complicated by renal failure requiring hemodialysis, pneumonia due to an extended-spectrum β-lactamase-producing K. pneumoniae strain, and a sternal wound infection due to S. marcescens isolate 1609, which was resistant to cefoxitin and ciprofloxacin and exhibited intermediate susceptibility to amoxicillin/clavulanate (Table 1). The patient underwent sternal debridement in March and received 2 weeks of meropenem, followed by 10 days of ciprofloxacin. Ischemic colitis necessitated right hemicolectomy during that time. At the end of April, a bronchoalveolar lavage specimen grew E. cloacae isolate 1623, which was resistant to multiple β-lactam antibiotics (Table 1), including meropenem, ertapenem, and imipenem, with MIC values of 4, 4, and 8 μg/ml, respectively. To phenotypically confirm the presence of a carbapenemase, a modified Hodge test was performed with E. cloacae 1623, and the results were positive. Using primers KPC forward and KPC reverse, specific for blaKPC (19, 20), an appropriate 893-bp product was amplified from E. cloacae 1623. Furthermore, isoelectric focusing detected a band reacting with nitrocephin of pI 7.6, consistent with a blaKPC β-lactamase (19). The patient was judged on clinical grounds to be colonized with E. cloacae 1623, and no further antimicrobial treatment was administered. In early May, acalculous cholecystitis was diagnosed and treated with percutaneous gall bladder drainage and 16 days of meropenem. The sternal wound did not heal well, and cultures from debridement specimens revealed Pseudomonas aeruginosa, which was treated with 2 weeks of cefepime followed by 4 weeks of ciprofloxacin, ending in mid-July. A blood culture from late July was positive for S. marcescens isolate 1637, which had an antibiotic susceptibility profile identical to that of S. marcescens 1609. However, a sputum culture from early August detected an S. marcescens isolate, 1638, susceptible only to amikacin, gentamicin, and tobramycin; resistant to multiple β-lactam antibiotics, including ertapenem and imipenem; and exhibiting intermediate susceptibility to meropenem (Table 1). Subsequent PCR experiments with S. marcescens 1638 using primers KPC forward and reverse demonstrated that it also encoded a KPC carbapenemase. Neither K. pneumoniae nor P. aeruginosa was positive for blaKPC by PCR. Due to a poor prognosis, the patient was placed on palliative care, and she died in August 2010.

Table 1
Antibiotic susceptibilities (MICs) of E. cloacae, S. marcescens, and E. coli DH5α 1623 and 1638

DNA sequencing of the blaKPC PCR products from both E. cloacae 1623 and S. marcescens 1638 confirmed that these isolates encoded a KPC-4 β-lactamase (19, 28). Furthermore, the PFGE patterns of S. marcescens 1609, 1637, and 1638 were indistinguishable (Fig. 1A), suggesting the possible transfer of a plasmid carrying blaKPC-4 from E. cloacae 1623 into a colonizing isolate of S. marcescens. To address this hypothesis, Southern blot analysis was performed on PFGE-separated DNA using a blaKPC-4 DNA probe. These analyses demonstrated that the blaKPC-4 DNA probe hybridized to a band of similar size in both E. cloacae 1623 and S. marcescens 1638, but not S. marcescens 1609 or 1637 (Fig. 1A and andBB).

Fig 1
PFGE and corresponding blaKPC Southern blot. (A) Lane 1, E. cloacae 1623; lane 2, S. marcescens 1609; lane 3, S. marcescens 1638; lane 4, S. marcescens 1637. (B) Southern blot of corresponding gel in panel A hybridized with a blaKPC DNA probe. Putative ...

To determine whether the blaKPC-4 gene was transferred between the two genera on a common plasmid, total plasmid DNA was extracted from E. cloacae 1623 and S. marcescens 1638 and used to transform E. coli ElectroMAX Stbl4. Potential E. coli Stbl4 strains harboring plasmids carrying blaKPC-4 from E. cloacae 1623 and S. marcescens 1638 were selected by plating on Luria-Bertani (LB) agar (Becton Dickinson, Sparks, MD) containing 1 μg/ml of imipenem (Sigma, St. Louis, MO), producing E. coli Stbl4 1623 and 1638, respectively. The transformation frequency of DNA isolated from both E. cloacae 1623 and S. marcescens 1638 that conferred reduced susceptibility to imipenem was measured at approximately 10−7 per μg plasmid DNA. To facilitate analysis, total plasmid DNA was isolated from imipenem-resistant E. coli Stbl4 1623 and 1638 and transformed into E. coli DH5α, creating E. coli DH5α 1623 and E. coli DH5α 1638. Following digestion with PstI, electrophoretic analysis of plasmids isolated from E. coli DH5α 1623 and E. coli DH5α 1638 showed indistinguishable restriction fragment length polymorphism (RFLP) patterns, suggesting that the same plasmid carrying blaKPC-4 was found in E. cloacae 1623 and S. marcescens 1638 (Fig. 2A). Although E. cloacae 1623 contained multiple plasmids, a PstI RFLP pattern identical to that of plasmid DNA from E. coli DH5α 1623 and DH5α 1638 was identified in total plasmid DNA (Fig. 2A). In addition, a common 7-kb band hybridized to a blaKPC-4 DNA probe in E. cloacae 1623, E. coli DH5α 1623, and E. coli DH5α 1638, further suggesting that carbapenem resistance emerged in S. marcescens 1638 through plasmid transfer via E. cloacae 1623 (or vice versa). This plasmid carrying blaKPC-4 that conferred carbapenem resistance was subsequently called pNE1280. For unclear reasons, possibly due to a highly active nuclease, we were unable to isolate high-quality plasmid DNA from S. marcescens 1638 for subsequent RFLP and Southern blot analysis.

Fig 2
Plasmid analysis and corresponding blaKPC Southern blot. (A) Lane 1 (from left), 1-kb DNA ladder (Life Technologies, Grand Island, NY); lane 2, E. cloacae plasmid DNA digested with PstI; lane 3, E. coli DH5α 1623 plasmid DNA digested with PstI; ...

Testing of antimicrobial susceptibility to ciprofloxacin, amikacin, gentamicin, tobramycin, trimethoprim-sulfamethoxazole, and tetracycline was performed with S. marcescens 1609, 1637, and 1638; E. cloacae 1623; and E. coli DH5α, DH5α 1623, and DH5α 1638. S. marcescens 1609, 1637, and 1638 were resistant to ciprofloxacin and tetracycline, whereas E. cloacae 1623 was intermediately susceptible to ciprofloxacin. However, E. coli DH5α 1623 and 1638 were not resistant to any of these antimicrobials, suggesting pNE1280 does not encode any additional resistance determinants. Furthermore, no difference in antibiotic susceptibility was detected between E. coli DH5α 1623 and E. coli DH5α 1638 (Table 1), further corroborating our molecular data and suggesting the two plasmids isolated from E. cloacae 1623 and S. marcescens 1638 were identical. In addition, E. coli DH5α 1623 exhibited lower MICs for all β-lactam antibiotics tested than E. cloacae 1623 and S. marcescens 1638 (Table 1). These findings are consistent with other studies demonstrating that the presence of KPC or other β-lactamases alone does not confer complete resistance to carbapenems in a naïve host (29, 30).

DNA sequencing revealed that pNE1280 was 66,532 bp (GenBank JQ837276). Open reading frame (ORF) analysis detected 72 ORFs within pNE1280, with 42 showing significant amino acid similarity to proteins with known functions. Sequence alignment comparisons against the GenBank database determined high nucleotide identity between the pNE1280 backbone and pCTX-M360 (NCBI reference sequence NC_011641.1), a previously described IncL/M plasmid carrying blaCTX-M isolated in China (15). Primers described by Carattoli et al., specific for IncL/M plasmids, confirmed that pNE1280 is an IncL/M plasmid backbone (18). pNE1280 contained one major insertion of approximately 13 kb containing the Tn3 family transposon Tn4401 harboring blaKPC-4, here called Tn4401f (31) (Fig. 3). The blaKPC-4 gene was flanked by ISKpn7 IR right and ISKpn6 IR left, similar to other previously described Tn4401-containing plasmids, and did not contain the 100-bp deletion found in pNYC and other Tn4401a transposons (Fig. 3) (31). However, pNE1280 contained a truncated tnpA gene and lacks both ISKpn7 IR left and the tnpR gene. In addition, Tn4401f does not contain the flanking upstream Tn4401 IR-L sequence in comparison to other known Tn4401 sequences (Fig. 3) (14). Therefore, these data suggest that Tn4401 and ISKpn7 are not functional within pNE1280, although a putative TN4401 IR-L was located just upstream of istB (Fig. 3).

Fig 3
Region from pNE1280 carrying blaKPC-4. The diagram depicts the region from pNE1280 carrying blaKPC-4 and a comparison between pNYC (Tn4401a) and pCOL (Tn4401b). Note that pNE1280 does not contain the 100-bp deletion found in Tn4401a regions, has a truncated ...

In conclusion, we found a high likelihood that blaKPC-4 was transferred from E. cloacae 1623 to S. marcescens 1638 within a single patient. This was the first case of blaKPC-mediated carbapenem resistance at our institution and, to our knowledge, in Nebraska. DNA sequencing revealed that KPC-4 was carried on an IncL/M plasmid, pNE1280; IncL/M plasmids have rarely been reported to carry blaKPC (2, 32). Although KPC-4 was encoded within the highly conserved Tn4401 element, several structural features were found, most notably the loss of tnpR and IRL-1, which suggests that the Tn4401f transposon described in this report is not functional. These observations further highlight the continued recombination and evolution of Tn4401 elements encoding KPC-4, and the biological relevance of these novel Tn4401 isoforms requires further study. In addition, bioinformatics analysis of pNE1280 demonstrated the presence of tra genes responsible for conjugation. Transconjugation experiments with both E. cloacae 1623 and S. marcescens 1638 revealed efficient transfer of pNE1280 and carbapenem resistance to E. coli J53, further documenting the ease with which pNE1280 and other IncL/M plasmids can be transferred throughout the Enterobacteriacae (data not shown). Lastly, these data highlight the importance of continued surveillance for the detection of emerging antibacterial resistance, especially in areas of presumed low prevalence.

ACKNOWLEDGMENTS

This project was supported by the Division of Laboratory Science and Standards, CDC, project CI 723775. The UNMC Next Generation Sequencing Core received support from National Center for Research Resources (NCRR) grants entitled UNMC SIG Supporting Next-Generation DNA Sequencing Technology 1S10RR027754-01, the Nebraska Research Network in Functional Genomics NE-INBRE P20 RR16469, the Molecular Biology of Neurosensory Systems CoBRE 2P20RR018788-06, and the Nebraska Research Initiative. We also acknowledge the software and hardware resources provided by the University of Nebraska at Omaha Bioinformatics Core Facility, which is supported by the Nebraska Research Network in Functional Genomics (NE-INBRE P20 RR16469).

The conclusions of this study are the sole responsibility of the authors and do not necessarily represent the official views of NCRR or NIH. Further, the findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Footnotes

Published ahead of print 15 October 2012

REFERENCES

1. Gupta N, Limbago BM, Patel JB, Kallen AJ. 2011. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clin. Infect. Dis. 53:60–67 [PubMed]
2. Cuzon G, Naas T, Truong H, Villegas MV, Wisell KT, Carmeli Y, Gales AC, Venezia SN, Quinn JP, Nordmann P. 2010. Worldwide diversity of Klebsiella pneumoniae that produce beta-lactamase blaKPC-2 gene. Emerg. Infect. Dis. 16:1349–1356 [PMC free article] [PubMed]
3. Kitchel B, Rasheed JK, Patel JB, Srinivasan A, Navon-Venezia S, Carmeli Y, Brolund A, Giske CG. 2009. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicrob. Agents Chemother. 53:3365–3370 [PMC free article] [PubMed]
4. Cai JC, Zhou HW, Zhang R, Chen GX. 2008. Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in intensive care units of a Chinese hospital. Antimicrob. Agents Chemother. 52:2014–2018 [PMC free article] [PubMed]
5. Marchaim D, Navon-Venezia S, Schwaber MJ, Carmeli Y. 2008. Isolation of imipenem-resistant Enterobacter species: emergence of KPC-2 carbapenemase, molecular characterization, epidemiology, and outcomes. Antimicrob. Agents Chemother. 52:1413–1418 [PMC free article] [PubMed]
6. Mathers AJ, Cox HL, Kitchel B, Bonatti H, Brassinga AK, Carroll J, Scheld WM, Hazen KC, Sifri CD. 2011. Molecular dissection of an outbreak of carbapenem-resistant Enterobacteriaceae reveals intergenus KPC carbapenemase transmission through a promiscuous plasmid. mBio 2:e00204–11 doi:10.1128/mBio.00204-11 [PMC free article] [PubMed]
7. Garcia-Fernandez A, Villa L, Carta C, Venditti C, Giordano A, Venditti M, Mancini C, Carattoli A. 2012. Klebsiella pneumoniae ST258 producing KPC-3 identified in Italy carries novel plasmids and OmpK36/OmpK35 porin variants. Antimicrob. Agents Chemother. 56:2143–2145 [PMC free article] [PubMed]
8. Goren MG, Carmeli Y, Schwaber MJ, Chmelnitsky I, Schechner V, Navon-Venezia S. 2010. Transfer of carbapenem-resistant plasmid from Klebsiella pneumoniae ST258 to Escherichia coli in patient. Emerg. Infect. Dis. 16:1014–1017 [PMC free article] [PubMed]
9. Mataseje LF, Boyd DA, Willey BM, Prayitno N, Kreiswirth N, Gelosia A, Poutanen SM, Low DE, Jenkins SG, Katz K, Mulvey MR. 2011. Plasmid comparison and molecular analysis of Klebsiella pneumoniae harbouring bla(KPC) from New York City and Toronto. J. Antimicrob. Chemother. 66:1273–1277 [PubMed]
10. Sidjabat HE, Silveira FP, Potoski BA, Abu-Elmagd KM, Adams-Haduch JM, Paterson DL, Doi Y. 2009. Interspecies spread of Klebsiella pneumoniae carbapenemase gene in a single patient. Clin. Infect. Dis. 49:1736–1738 [PubMed]
11. Chen L, Chavda KD, Mediavilla JR, Jacobs MR, Levi MH, Bonomo RA, Kreiswirth BN. 2012. Partial excision of blaKPC from Tn4401 in carbapenem-resistant Klebsiella pneumoniae. Antimicrob. Agents Chemother. 56:1635–1638 [PMC free article] [PubMed]
12. Kitchel B, Rasheed JK, Endimiani A, Hujer AM, Anderson KF, Bonomo RA, Patel JB. 2010. Genetic factors associated with elevated carbapenem resistance in KPC-producing Klebsiella pneumoniae. Antimicrob. Agents Chemother. 54:4201–4207 [PMC free article] [PubMed]
13. Naas T, Cuzon G, Truong HV, Nordmann P. 2012. Role of ISKpn7 and deletions in blaKPC gene expression. Antimicrob. Agents Chemother. 56:4753–4759 [PMC free article] [PubMed]
14. Naas T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP, Nordmann P. 2008. Genetic structures at the origin of acquisition of the beta-lactamase bla KPC gene. Antimicrob. Agents Chemother. 52:1257–1263 [PMC free article] [PubMed]
15. Zhu WH, Luo L, Wang JY, Zhuang XH, Zhong L, Liao K, Zeng Y, Lu YJ. 2009. Complete nucleotide sequence of pCTX-M360, an intermediate plasmid between pEL60 and pCTX-M3, from a multidrug-resistant Klebsiella pneumoniae strain isolated in China. Antimicrob. Agents Chemother. 53:5291–5293 [PMC free article] [PubMed]
16. Clinical Laboratory Standards Institute 2012. Performance standards for antimicrobial disk susceptibility tests; approved standard M02-A11, vol 32 Clinical and Laboratory Standards Institute, Wayne, PA
17. Clinical Laboratory Standards Institute 2012. Performance standards for antimicrobial susceptibility testing: twenty-second informational supplement M100-S22, vol 32 Clinical and Laboratory Standards Institute, Wayne, PA
18. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. 2005. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63:219–228 [PubMed]
19. Queenan AM, Bush K. 2007. Carbapenemases: the versatile beta-lactamases. Clin. Microbiol. Rev. 20:440–458 [PMC free article] [PubMed]
20. Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, Alberti S, Bush K, Tenover FC. 2001. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45:1151–1161 [PMC free article] [PubMed]
21. Mathew A, Harris AM, Marshall MJ, Ross GW. 1975. The use of analytical isoelectric focusing for detection and identification of beta-lactamases. J. Gen. Microbiol. 88:169–178 [PubMed]
22. Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, Barrett TJ. 2006. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Path. Dis. 3:59–67 [PubMed]
23. Sambrook JE, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
24. Kado CI, Liu ST. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365–1373 [PMC free article] [PubMed]
25. Jacoby GA, Han P. 1996. Detection of extended-spectrum beta-lactamases in clinical isolates of Klebsiella pneumoniae and Escherichia coli. J. Clin. Microbiol. 34:908–911 [PMC free article] [PubMed]
26. Yi H, Cho YJ, Yong D, Chun J. 2012. Genome sequence of Escherichia coli J53, a reference strain for genetic studies. J. Bacteriol. 194:3742–3743 [PMC free article] [PubMed]
27. Cantarel BL, Korf I, Robb SM, Parra G, Ross E, Moore B, Holt C, Sanchez Alvarado A, Yandell M. 2008. MAKER: an easy-to-use annotation pipeline designed for emerging model organism genomes. Genome Res. 18:188–196 [PubMed]
28. Wolter DJ, Kurpiel PM, Woodford N, Palepou MF, Goering RV, Hanson ND. 2009. Phenotypic and enzymatic comparative analysis of the novel KPC variant KPC-5 and its evolutionary variants, KPC-2 and KPC-4. Antimicrob. Agents Chemother. 53:557–562 [PMC free article] [PubMed]
29. Giles WP, Benson AK, Olson ME, Hutkins RW, Whichard JM, Winokur PL, Fey PD. 2004. DNA sequence analysis of regions surrounding blaCMY-2 from multiple Salmonella plasmid backbones. Antimicrob. Agents Chemother. 48:2845–2852 [PMC free article] [PubMed]
30. Woodford N, Tierno PM, Jr, Young K, Tysall L, Palepou MF, Ward E, Painter RE, Suber DF, Shungu D, Silver LL, Inglima K, Kornblum J, Livermore DM. 2004. Outbreak of Klebsiella pneumoniae producing a new carbapenem-hydrolyzing class A beta-lactamase, KPC-3, in a New York Medical Center. Antimicrob. Agents Chemother. 48:4793–4799 [PMC free article] [PubMed]
31. Cuzon G, Naas T, Nordmann P. 2011. Functional characterization of Tn4401, a Tn3-based transposon involved in blaKPC gene mobilization. Antimicrob. Agents Chemother. 55:5370–5373 [PMC free article] [PubMed]
32. Andrade LN, Curiao T, Ferreira JC, Longo JM, Climaco EC, Martinez R, Bellissimo-Rodrigues F, Basile-Filho A, Evaristo MA, Del Peloso PF, Ribeiro VB, Barth AL, Paula MC, Baquero F, Canton R, Darini AL, Coque TM. 2011. Dissemination of blaKPC-2 by the spread of Klebsiella pneumoniae clonal complex 258 clones (ST258, ST11, ST437) and plasmids (IncFII, IncN, IncL/M) among Enterobacteriaceae species in Brazil. Antimicrob. Agents Chemother. 55:3579–3583 [PMC free article] [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)