PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptHHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
 
J Immunol. Author manuscript; available in PMC 2014 January 1.
Published in final edited form as:
PMCID: PMC3529770
NIHMSID: NIHMS419484

CD11b/CD18 (Mac-1) Is a Novel Surface Receptor for Extracellular Double-stranded RNA to Mediate Cellular Inflammatory Responses

Abstract

During viral infection, extracellular dsRNA is a potent signaling molecule that activates many innate immune cells including macrophages. TLR3 is a well-known receptor for extracellular dsRNA, and internalization of extracellular dsRNA is required for endosomal TLR3 activation. Preserved inflammatory responses of TLR3-deficient macrophages to extracellular dsRNA strongly support a TLR3-independent mechanism in dsRNA-mediated immune responses. The present study demonstrated that CD11b/CD18 (Mac-1), a surface integrin receptor, recognized extracellular dsRNA and induced macrophage immune responses. CD11b deficiency reduced inflammatory cytokine induction elicited by polyinosinic:polycytidylic acid (poly I:C, a synthetic dsRNA) in mouse sera and livers and in cultured peritoneal macrophages. DsRNA-binding assay and confocal immunofluorescence showed that Mac-1, especially the CD11b subunit, interacted and colocalized with poly I:C on the surface of macrophages. Further mechanistic studies revealed two distinct signaling events following dsRNA recognition by Mac-1. Firstly, Mac-1 facilitated poly I:C internalization through the activation of PI3K signaling and enhanced TLR3-dependent activation of interferon regulatory factor 3 (IRF3) in macrophages. Secondly, poly I:C induced activation of phagocyte NADPH oxidase (NOX2) in a TLR3-independent, but Mac-1 dependent manner. Subsequently, NOX2-derived intracellular reactive oxygen species activated MAPK and NFκB pathways. Our results indicate that extracellular dsRNA activates Mac-1 to enhance TLR3-dependent signaling and to trigger TLR3-independent, but Mac-1-dependent inflammatory oxidative signaling, identifying a novel mechanistic basis for macrophages to recognize extracellular dsRNA to regulate innate immune responses. This study identifies Mac-1 as a novel surface receptor for extracellular dsRNA and implicates Mac-1 as a potential therapeutic target for virus-related inflammatory diseases.

Keywords: Extracellular dsRNA, Innate immunity, Pathogen recognition receptor (PRR), Integrin, Mac-1(CD11b/CD18), Macrophage, Internalization, NADPH oxidase, Polyinosinic:polycytidylic acid (poly I:C), Reactive oxygen species (ROS), TLR3

Introduction

As the first line of host defense, the innate immune system combats numerous pathogens through a diverse set of pattern recognition receptors (PRRs). These PRRs are capable of identifying pathogen-associated molecular patterns (PAMPs) and initiating the innate immune response. During viral infections, various virus-associated PAMPs are recognized by and bind to their respective PRRs, which induces robust host antiviral and immune responses. It is well known that viral-produced dsRNA is a critical viral PAMP, which functions as a powerful stimulus of both innate and adaptive antiviral immune responses (1). Viral dsRNA is primarily generated during viral replication in virally infected cells (2). Once the infected cells die by lysis, the viral dsRNA is released into the extracellular space and becomes a stable molecule; extracellular dsRNA is implicated in both local and systemic reactions associated with viral infections and modulates both innate and adaptive immune responses (35). Experimentally, synthetic dsRNA like polyinosinic:polycytidylic acid (poly I:C) has been commonly used to induce antiviral responses in vivo or in vitro (6).

The TLR3, RIG-I-like receptors (RLRs) RIG-I/MDA-5/LGP2, and NOD-like receptor Nalp3 (NLRs) have been identified as PRRs for dsRNA (1). Based on cellular location, the membrane receptor TLR3 can recognize internalized extracellular dsRNA, while both RLRs and NLRs are the cytoplasmic sensors that are likely to identify intracellular dsRNA generated during the intracellular viral life cycle (710). Interestingly, TLR3 is only able to recognize and to bind dsRNA in acidified endosomes (11), which suggests that extracellular dsRNA must first be internalized before it activates TLR3. Considering the evidence that extracellular dsRNA is still able to induce a significant number of proinflammatory cytokines in TLR3-knockout macrophages or microglia (7, 11, 12), we hypothesize that other PRRs on the cell surface can serve as the first line receptors to sense extracellular dsRNA and to mediate cellular responses.

Previous studies have indicated that the surface receptor integrin CD11b/CD18, also known as macrophage-1 antigen (Mac-1), complement receptor 3 (CR3) or αMβ2, serves as a PRR to recognize PAMPs and DAMPs (damage-associated molecular patterns), such as gram-negative bacteria-derived LPS (13), aggregated beta-amyloid (14), and damage-associated alarmin HMGB1 (high mobility group box 1) (15). Mac-1, expressed on many innate immune cells, such as monocytes, granulocytes, macrophages, and natural killer cells (16), has been implicated in various immune cell responses including adhesion, migration, phagocytosis, chemotaxis, cellular activation, and cytotoxicity (17, 18). Furthermore, Mac-1 has been reported to participate in inflammatory diseases associated with Ross River virus infection (19) and to bind some nucleotides like oligodeoxynucleotide (20). These characteristics of Mac-1 prompted us to investigate the possibility that Mac-1 serves as a PRR for extracellular dsRNA to regulate the innate immune response.

In this study, we identified Mac-1 as a novel surface receptor mediating extracellular dsRNA-elicited cellular immune responses. Our results demonstrate that Mac-1 can recognize extracellular dsRNA on the cell surface and then mediates outside-in signaling, regulating dsRNA internalization and mediating activation of phagocyte NADPH oxidase (NOX2), to induce cellular immune responses in macrophages. Our results provide new insight into how the macrophage recognizes extracellular signals associated with lytic virus infections and mediates the innate immune response.

Materials and Methods

Animal study

CD11b−/− mice (Mac1-deficient), gp91−/− mice (NADPH oxidase-deficient), and their age-matched wild-type control (C57BL/6J) were obtained from the Jackson Laboratory (Bar Harbor, ME). TLR3−/− mice and their age-matched wild-type control (TLR+/+, C57BL/6NJ) were also obtained from the Jackson Laboratory. Housing and breeding of the animals were performed humanely and with regard for alleviation of suffering following the National Institutes of Health Guide for Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources 1996). Six to eight week-old male mice of different strains were used in whole experiments. All procedures were approved by the NIEHS Animal Care and Use Committee.

An in vivo animal model involved immune activation by poly I:C (Sigma-Aldrich; an average size of 300bp to 750bp). Wild-type mice and CD11b−/− (CD11b-KO) mice were intraperitoneally injected with poly I:C (5 mg/kg). Serum was collected two hours later for cytokine measurement using commercially available ELISA kits (R&D Systems, MN), and liver tissues were harvested for mRNA isolation and cytokine assay by quantitative real time-PCR.

Preparation of peritoneal macrophages and culture of macrophage cell line

Peritoneal macrophages from different strains were induced and harvested as previously described (21). Briefly, wild-type mice, CD11b-KO mice, and gp91−/− (gp91-KO) mice were intraperitoneally injected with 2 ml/mouse of 3% sterile thioglycollate. After 4 days, peritoneal exudate macrophages were collected by lavage in 5 ml of ice-cold RPMI medium 1640 (Invitrogen, CA), washed twice in RPMI, and pre-incubated in serum-free medium for 1 h. The cells were then washed twice to remove non-adherent cells. Adherent macrophages were cultured in RPMI medium containing 10% FBS (Invitrogen), 50 U/ml penicillin, and 50 μg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO2.

The murine macrophage cell line RAW 264.7 (ATCC® TIB-71) was suspension cultured in DMEM containing 10% FBS, 2 mM L-glutamine, 50 U/ml penicillin, and 50 μg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO2.

Double-strand RNA binding assay

The dsRNA-binding assay was performed as described previously (22, 23). Briefly, Poly I:C-conjugated agarose beads were prepared by incubating poly C agarose beads (Sigma-Aldrich, MO) with poly I (polyinosinic acid) (Sigma-Aldrich) at 4°C overnight. Cyanogen bromide-activated agarose beads (Sigma-Aldrich) were used as controls. Cell lysates were prepared in NP-40 lysis buffer (10 mM Tris-HCl at pH 7.5, 1% Nonidet P-40, 0.15 M NaCl, 1 mM EDTA, and protease inhibitor cocktail) and centrifuged at 16,000 g for 15 min at 4°C. For pull-down assays, poly C-, poly I:C-conjugated beads, or non-coated empty beads were equilibrated in lysis buffer containing RNase inhibitor (Invitrogen) and incubated overnight with whole-cell lysates at 4°C on a rotating shaker. After centrifugation, beads were washed extensively and then resuspended in sample buffer (Invitrogen). Samples were boiled for 10 min, centrifuged at 13,000 g for 1 min to discard insoluble pellets. Samples were then loaded onto SDS-PAGE, electroblotted onto PVDF membranes and probed by immunoblot analysis against CD11b (Abcam, MA).

Flow cytometric analysis

Poly I:C was labeled with FITC using Mirus RNA labeling kit (24). Labeled RNA was then purified with RNAeasy mini kit (Qiagen, CA). Peritoneal macrophages or RAW 264.7 cells were washed twice and suspended in HBSS (Invitrogen). The cells (1 × 106 cells/ml) were kept on ice for determination of surface binding of poly I:C by incubating with 10 μg/ml FITC-labeled poly I:C for 20 min (20). After washing 3 times with cold HBSS, poly I:C-bound macrophages were detected by BD LSR II Flow Cytometer. A live cell gate was made using forward (FSC) versus side (SSC) scatter plot. The surface binding was expressed as the mean fluorescence intensities of total calculated population. Internalization analysis of FITC-labeled poly I:C was performed as same as the surface binding process described above, but cells were incubated at 37°C instead of on ice (20), and trypan blue (1 mg/ml) was used to quench extracellular surface-bound fluorescence as previously described (25). The internalization of poly I:C was expressed as the mean fluorescence intensities of total calculated population.

Confocal microscopy

Poly I:C and poly C were labeled with Cy3 for confocal observation (24). Peritoneal macrophages were seeded and grown in glass-bottom microwell dishes (MatTek Corp, MA). Cells were then treated with 10 μg/ml of Cy3-labeled poly I:C or poly C, either on ice for 20 min to observe the surface binding or at 37°C for 15 or 30 min to determine the internalization. Stained macrophages were washed 3 times with ice-cold PBS and fixed with 4% paraformaldehyde for further observation on Zeiss LSM510 Laser Scanning Confocal Microscope (Carl Zeiss Microimaging Inc., German).

Quantitative real time-PCR

Total RNA of cells or tissues was isolated using the TRIzol reagent, then first-strand cDNA was synthesized using superscript reverse transcriptase (Invitrogen) according to the manufacturer’s protocols. After 0.5 μg of total RNA was subjected to a reverse transcription reaction, two microliters of cDNA was amplified by quantitative real-time PCR analysis for the induction of inflammatory cytokines using SYBR-Green Master mix (BioRad, CA) in a final volume of 25 μl. The sequences of the primers were the following: mouse TNF-α, CATCTTCTCAAAATTCGAGTGGACAA (forward), TGGGAGTAGACAAGGTACAACCC (reverse); mouse IL-12p40: GGAAGCACGGCAGCAGAATA (forward), AACTTGAGGGAGAAGTAGGAATGG (reverse); mouse IFN-β: ATGAGTGGTGGTTGCAGGC (forward), TGACCTTTCAAATGCAGTAGATTCA (reverse); mouse IL-6: TTGCCTTCTTGGGACTGATGCT (forward), GTATCTCTCTGAAGGACTCTGG (reverse); mouse GAPDH: TTCACCACCATGGAGAAGGC (forward), GGCATGGACTGTGGTCATGA (reverse). Data were normalized to GAPDH expression.

Measurement of extracellular superoxide and intracellular reactive oxygen species (iROS)

The release of superoxide was determined by measuring the superoxide dismutase (SOD)-inhibitable reduction of tetrazolium salt (WST-1, 2-[4-Iodophenyl]-3-[4-nitrophenyl]-5-[2,4-disulfophenyl]-2H-tetrazolium) as described (26). Briefly, peritoneal macrophages (1 × 105/well) were grown overnight in 96-well plates in DMEM medium containing 10% FBS and switched to phenol red-free HBSS (100 μl/well). Fifty microliters of HBSS containing vehicle, poly I:C, or PMA were then added to each well, followed by the addition of 50 μl of WST-1 (1 mM) in HBSS, with and without 600 U/ml SOD. The cells were incubated for 30 min at 37°C, and the absorbance at 450 nm was read with a SpectraMax Plus microplate spectrophotometer (Molecular Devices, CA). The production of iROS was measured by the fluorescence probe DCFH-DA as described (26). Briefly, macrophages cultured overnight in 96-well plates were incubated with 10 μM DCFH-DA (Invitrogen) for 30 min at 37°C. After 2 washes with HBSS buffer, cells were switched to HBSS containing 1% FBS. After the cells were incubated with vehicle or poly I:C (50 μg/ml) at 37°C for 30 min, the fluorescence density was read at 488 nm for excitation and 525 nm for emission using a SpectraMax Gemini XS fluorescence microplate reader (Molecular Devices).

Nuclear extraction, gel electrophoresis and western blotting analysis

Peritoneal macrophages from wild-type and CD11b−/− mice were incubated with poly I:C (50 μg/ml) or vehicle at 37°C for 60 or 120 min and washed twice with cold PBS. Nuclear extraction was performed at 4°C with a nuclear extraction kit from Affymetrix following manufacturer’s instructions. Protein concentrations were determined using the DC protein assay (BIO-RAD). The whole-cell lysates from cultured cells were homogenized in radioimmunoprecipitation assay buffer (RIPA) (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 1:100 protease inhibitor cocktail) with phosphatase inhibitors (10mM NaF, 1mM Na4P3O7, and 1mM sodium orthovanadate), sonicated and boiled for 10 min. Protein concentrations were determined using the biocinchoninic acid (BCA) assay (Pierce). Protein samples were resolved on 4–12% SDS-PAGE, and immunoblot analysis was performed using antibodies against indicated signaling molecules (Cell Signaling Technology). An antibody against GAPDH (Sigma-Aldrich) or HDAC2 (Santa Cruz Biotech) was included as an internal standard to monitor loading errors.

Immunofluorescence staining

Macrophages were grown and treated on glass coverslips, fixed in 4% paraformaldehyde, permeabilized with 0.4% Triton-X100, and blocked with 5% goat serum. Samples were sequentially incubated with primary antibodies and corresponding fluorescence probe-conjugated secondary antibodies (Invitrogen), and then analyzed using a Zeiss LSM510 Confocal Microscope. To study distribution and colocalization of desired proteins, we analyzed images from at least 10 random fields from 3 independent experiments.

Statistical analysis

Data were expressed as mean ± S.E.M. Statistical significance was assessed by ANOVA followed by Bonferroni’s t test using GraphPad Prism software (GraphPad Software Inc., CA). A value of p < 0.05 was considered statistically significant.

Results

Mac-1-deficient mice revealed impaired immune response to poly I:C

To determine whether Mac-1 is a potential candidate in sensing extracellular dsRNA and regulating immune response, mice deficient in the CD11b subunit of Mac-1 and age-matched wild-type mice were intraperitoneally injected with synthetic dsRNA poly I:C (5mg/kg). Measurement of serum inflammatory factors 2h after poly I:C injection revealed decreased circulating TNF-α, IFN-β, and IL-12p40 in CD11b−/− mice compared to wild-type controls (Figure 1A). Similarly, the mRNA level of TNF-α, IL-12p40, IFN-β, and IL-6 in the liver of CD11b−/− mice was reduced (Figure 1B). Collectively, Mac-1-deficient (CD11b−/−) mice displayed an impaired immune response to poly I:C.

Figure 1
Mac-1-deficient mice revealed impaired immune response after poly I:C-injection

Mac-1 deficiency impaired immune responses to poly I:C in macrophages

Since Mac-1 is dominantly expressed on macrophages that have a central role in the innate immune response, we next compared inflammatory cytokine induction and investigated inflammatory signaling cascades after poly I:C stimulation in CD11b−/− and wild-type peritoneal macrophages. Consistent with our in vivo results, the mRNA level of TNF-α, IL-12p40, IFN-β, and IL-6 was significantly lower in CD11b−/− macrophages than in wild-type controls (Figure 2A). Secreted TNF-α and IL-12p40 in the supernatant showed a significant reduction in CD11b−/− macrophages (Figure 2B). IL-12p70 was detected after macrophages were challenged with 50 μg/ml poly I:C for 24h, reaching 2.8 ± 0.3 pg/ml in wild-type macrophages and 0.8 ± 0.6 pg/ml in CD11b−/− macrophages. A similar pattern was observed in poly I:C-elicited release of nitric oxide (NO), an inflammatory molecule (Figure 2C). By contrast, stimulation of cultured peritoneal macrophages with TNF-α (50 ng/ml) or PMA (100 nM) induced indistinguishable immune responses in CD11b−/− macrophages and wild-type macrophages (Figure S1). In addition, TLR3 expression in CD11b−/− and wild-type macrophages was not different (Figure S2). These data together suggest that the observed impairment in the immune response of CD11b−/− macrophages to poly I:C is due to the functional deficiency of Mac-1 receptor to poly I:C stimulation, but not due to a general immune deficit in these cells.

Figure 2
Mac-1 deficiency impaired immune responses to poly I:C in macrophages

Poly I:C bound to Mac-1 receptor on the cell surface of macrophages

A double-stranded RNA binding assay using cell extracts from peritoneal macrophages or RAW 264.7 cells (a mouse macrophage-like cell line) was used to test the possibility that poly I:C binds to Mac-1. Poly I:C-conjugated agarose beads pulled down the CD11b subunit of Mac-1, whereas unconjugated beads or beads conjugated with single-stranded poly C failed to do so (Figure 3A). These results indicate that Mac-1 can specifically recognize double-stranded poly I:C. To further confirm the interaction between poly I:C and Mac-1, a surface binding assay was performed using flow cytometry and confocal imaging. FITC-labeled poly I:C bound to the surface of wild-type macrophages, whereas such surface binding was dramatically decreased in CD11b−/− macrophages (Figure 3B, C). Furthermore, the surface binding was also significantly reduced in wild-type macrophages or RAW 264.7 cells pretreated with fibrinogen, an endogenous ligand of Mac-1, whereas such an inhibitory effect of fibrinogen was not observed in CD11b−/−macrophages (Figure 3B, C). Consistent with this result, confocal imaging (Figure 3D) showed that CD11b deletion or fibrinogen pretreatment reduced the surface binding of poly I:C in macrophages. In addition, immunofluorescence staining of CD11b also revealed colocalization of CD11b with surface-bound Cy3-poly I:C in wild-type macrophages (Figure 3E). Further overlapping analysis showed more than 75% overlap of Mac-1 with Cy3-poly I:C on the cell surface (Figure 3E). Overall, these data provide strong evidence that Mac-1 can recognize and bind double-stranded poly I:C on the surface of the macrophage, indicating that Mac-1 may mediate immune responses to poly I:C through outside-in signaling.

Figure 3
Poly I:C bound to Mac-1 receptor on the cell surface

Mac-1 facilitated the internalization of poly I:C

It is well known that internalization of extracellular dsRNA is a crucial step to subsequent antiviral responses induced by endosomal TLR3 activation (6, 11, 24). Our confocal imaging analysis detected intracellular poly I:C within 15 min after Cy3-labeled poly I:C was added to macrophages, and further accumulation of intracellular poly I:C was observed with extended time (30 min). However, the uptake of poly I:C was significantly attenuated in CD11b−/− macrophages compared with wild-type macrophages (Figure 4A). In contrast to the differential internalization of poly I:C, the uptake of Cy3-labeled poly C (ssRNA) was indistinguishable in wild-type and CD11b−/− peritoneal macrophages, indicating the specificity of CD11b on dsRNA poly I:C (Figure 4A). The flow cytometric analysis revealed about 40% reduction in the uptake of FITC-labeled poly I:C into CD11b−/− macrophages compared with wild-type macrophages (Figure 4B). These results implicate a critical role of Mac-1 in the internalization of poly I:C into macrophages. Such a conclusion was further confirmed by the finding that Mac-1 blocking antibody significantly attenuated the uptake of poly I:C into wild-type macrophages but not CD11b−/− macrophages (Figure 4C).

Figure 4
Mac-1 facilitates the internalization of poly I:C

As a common cellular signaling pathway of integrins (27, 28), the activation of PI3K (phosphoinositide 3-kinase) was specifically described in previous studies on Mac-1 signaling transduction (29, 30). PI3K has also been implicated in the regulation of endocytosis and intracellular membrane trafficking in macrophages (31, 32). Here, we found that wortmannin, a PI3K inhibitor, blocked the uptake of poly I:C into the macrophage (Figure 4D). Importantly, when challenged with poly I:C, the phosphorylation of AKT, a key kinase downstream of PI3K, was significantly impaired in CD11b−/− macrophages (Figure 4E). Taken together, the reduced uptake of poly I:C in the setting of PI3K inhibition in wild-type macrophages and the diminished PI3K activation in CD11b−/− macrophages suggest that Mac-1 promotes the internalization of poly I:C through activating the PI3K pathway. Thus, Mac-1 may facilitate immune responses in macrophages through enhancing the uptake of extracellular poly I:C into the endosome, where TLR3 resides.

Mac-1 altered poly I:C-induced downstream signaling

It is well known that poly I:C activates interferon regulatory factor 3 (IRF3) signaling via TLR3, leading to the induction of IFN and IFN-inducible genes. The attenuation of poly I:C-elicited IFN-β induction in CD11b−/− macrophages and mice (Figure 1) suggests that Mac-1 might participate in TLR3-dependent IRF3 activation. IRF3 is present in an inactive form in the cytoplasm in unstimulated innate immune cells; upon the phosphorylation of its serine, the active IRF3 translocates to the nucleus leading to the transcription of IFN and IFN-inducible genes. We next examined the phosphorylation and the nuclear translocation of IRF3 protein by using nuclear fraction of wild-type and CD11b−/− macrophages. Here, to rule out possible interference from any contaminated cytoplasmic IRF3 in the nuclear fraction, we used phospho-IRF-3 (Ser396) antibody to determine IRF3 activation. As expected, we observed decreases in poly I:C-induced phosphorylation and nuclear translocation of IRF3 in CD11b−/− macrophages compared with wild-type macrophages (Figure 5A), indicating Mac-1 enhanced TLR3-dependent IRF3 activation.

Figure 5
Mac-1 altered poly I:C-induced downstream signaling pathway

To further determine the downstream signaling cascades of poly I:C-elicited Mac-1 activation, MAPK and NFκB pathways, two major signaling pathways responsible for proinflammatory cytokine induction, were assayed in wild-type and CD11b−/− macrophages. Wild-type macrophages revealed time-dependent phosphorylation in MAPK and NFκB pathways (Figure 5B, 5C) after poly I:C (50 μg/ml) stimulation. CD11b−/− macrophages displayed significant reduction in the phosphorylation of JNK1/2, the p65 subunit of NFκB, and IκB as well as the degradation of IκB-α (Figure 5B, 5C). The phosphorylation of p38 was also impaired in CD11b−/− macrophages, although its reduction was less prominent than the reduction in JNK phosphorylation (Figure 5B). These results indicate an important role for Mac-1 in the activation of JNK and NFαB by poly I:C. We next treated wild-type macrophages with either a JNK inhibitor (SP600125, 5 μM) or a NFαB inhibitor (Compound A, 1 μM) (33) for 30 min and then challenged the cells with poly I:C. Both inhibitors significantly suppressed the release of TNF-α and IL-12p40, which further demonstrated the importance of the activation of JNK and NFκB in poly I:C-induced immune response (Figure 5D). Together, these results suggest that Mac-1 contributes to the poly I:C-induced immune response in macrophages through promoting the activation of MAPK and NFκB pathways.

In response to extracellular dsRNA, NFκB activation is thought to be involved in the downstream signaling of TLR3 activation (7), but the engagement of the TLR3 seems to be not required for the activation of MAPK signaling in macrophages (34). Thus, our findings described above (Figure 5) suggest that in addition to the contribution to TLR3-NFκB pathway by facilitating dsRNA internalization, Mac-1 may also induce TLR3-independent signaling pathways, such as MAPK pathway. Bafilomycin A (BFA), an inhibitor of vacuolar-type H+-ATPase, blocks the acidification of the endosome and therefore inhibits TLR3 activation (35). In the presence of BFA, considerable induction of proinflammatory cytokines TNF-α and IL-6 persisted after poly I:C treatment, whereas the induction of IFN-β was abolished (Figure S3). These data support the premise that type I interferon induction by extracellular poly I:C is TLR3-dependent (36, 37), but also suggest that other proinflammatory cytokines can be induced by extracellular poly I:C in a TLR3-independent manner. Interestingly, the persisting levels of TNF-α and IL-6 in the setting of BFA were significantly lower in CD11b−/− macrophages than wild-type controls, further supporting the involvement of Mac-1 in a TLR3-independent response to extracellular poly I:C.

Mac-1-dependent, TLR3-independent, activation of phagocyte NADPH oxidase (NOX2) enhanced immune responses to poly I:C

Previous studies showed that Mac-1 ligands can induce production of superoxide free radical in macrophages and neutrophils where NOX2 acts as a major source of superoxide during inflammation (20, 30). Therefore, we examined the effect of the interaction of poly I:C and Mac-1 on NOX2 activation in macrophages. As shown in Figure 6A, poly I:C (50 μg/ml) induced significant production of extracellular superoxide in wild-type macrophages. On the contrary, poly I:C failed to do so in macrophages deficient in CD11b or gp91 (the catalytic subunit of NOX2). However, PMA (a commonly used NOX2 stimulator) triggered robust superoxide production in both wild-type and CD11b−/− macrophages; as expected, PMA was inactive in gp91−/− macrophages. Although superoxide radical is membrane-impermeable, its downstream products, hydrogen peroxide and peroxynitrite (the reaction product of superoxide and NO), are membrane permeable. Consistent with extracellular superoxide production, intracellular reactive oxygen species (iROS) were also elevated after poly I:C treatment in wild-type macrophages, whereas deficiency in either Mac-1 or NOX2 abolished such iROS production (Figure 6B). These results indicate that poly I:C activates NOX2 to secrete superoxide anion in a Mac-1-dependent manner.

Figure 6
Mac-1-dependent activation of phagocyte NADPH oxidase (NOX2) enhanced poly I:C-elicited immune response

Next, we demonstrated the contribution of NOX2 activation to poly I:C-elicited induction of proinflammatory cytokines. The production of TNF-α and IL-12p40 in poly I:C-treated macrophages was significantly attenuated by the genetic deletion of gp91 (Figure 6C) or by the pharmacological inhibition of NOX2 activity by apocynin, a widely used NOX2 inhibitor (Figure 6D). The downstream signaling of NOX2 activation was determined in wild-type and gp91−/− macrophages. The phosphorylation of p38, JNK, and p65 was attenuated in gp91−/− macrophages compared to wild-type macrophages (Figure 6E). Such reduced phosphorylation of p38, JNK, and p65 in gp91−/− macrophages was also observed in Mac-1-deficient macrophages (Figure 5B–C). These results, combined with the finding that Mac-1 is required for poly I:C-induced NOX2 activation (Figure 6A, B), indicated that poly I:C-elicited activation of Mac-1 activated NOX2 and thereby stimulated MAPK and NFκB pathways to promote proinflammatory cytokine production.

Interestingly, poly I:C-induced superoxide production was not altered in TLR3−/− macrophages compared with wild-type cells (Figure 6F). In addition, the inhibition of NOX2 activity by apocynin led to similar reduction in the induction of TNF-α and IL-12p40 in TLR3−/− and wild-type peritoneal macrophages (Figure 6G). These results indicate that TLR3 was not involved in the activation of NOX2. Altogether, our findings demonstrated that poly I:C activates NOX2 to release superoxide anion and to participate in the induction of proinflammatory cytokines in a TLR3-independent, but Mac-1-dependent manner. In addition, through facilitating the internalization of poly I:C, Mac-1 activation may also amplify TLR3-dependent proinflammatory responses to dsRNA.

Discussion

Extracellular dsRNA, as a potent stimulator of the innate immune response, induces inflammatory cytokines and chemokines in many different cell types. However, the precise mechanism underlying its extracellular recognition and intracellular signaling remains largely unknown. In this study, we demonstrate that Mac-1 functions as a novel surface receptor for dsRNA in macrophages, as summarized in Figure 7. Specifically, Mac-1 binds extracellular dsRNA on the surface of macrophages to mediate cellular immune responses. Further mechanistic studies indicate that Mac-1 activation facilitates the internalization of dsRNA and also activates NOX2, which then not only enhances TLR3-dependent proinflammatory responses but also triggers TLR3-independent oxidative immune responses. Thus, Mac-1 plays a distinct role in dsRNA-induced immune responses. Our findings suggest that Mac-1 acts as a bona fide PRR for extracellular dsRNA to signal downstream inflammatory responses.

Figure 7
Model illustration of the role of Mac-1 in dsRNA-mediated signaling in the macrophage

As a member of β2 integrins, Mac-1 has long been recognized to participate in immune responses to infection and has been suggested to be a therapeutic target (18, 38). For instance, Mac-1 (also named as CR3) can bind complement components (such as iC3b) induced by invading pathogens to activate innate and adaptive immune response (39, 40). CD11b-deficient mice has been used to uncover the specific contribution of Mac-1 to many immune responses, such as Fc-receptor-triggered inflammation (41), phagocytosis of complement-opsonized particles (42), and immune reactions to bacteria or LPS (13, 21). Recent studies of the Ross River virus (RRV)-associated arthritis/myositis indicated a role of Mac-1 in virus-induced inflammation (19). RRV causes severe leukocyte-mediated inflammatory responses in joint and skeletal muscle tissues, leading to chronic inflammatory manifestation similar to arthritis/myositis. CD11b−/− mice exhibit decreased proinflammatory and cytotoxic effectors (e.g. S100A9/S100A8 and IL-6) and less severe tissue damages compared to wild-type mice, indicating contribution of Mac-1 to RRV-induced chronic inflammation. Although the authors of this article considered the activated complement components as the stimulus for Mac-1, a direct link between complement and Mac-1 was not demonstrated (19). Viral-produced dsRNA is a powerful viral PAMP and stimulates both innate and adaptive antiviral immune responses (1). Previous studies have shown that Mac-1 acts as a membrane-bound PRR and binds a number of different PAMPs and DAMPs (22, 42, 43). Further studies to define the role of viral dsRNA and Mac-1 activation in virus infection and host antiviral inflammatory response will identify novel disease mechanisms related to virus pathogens.

CD11b−/− mice displayed impaired immune responses to poly I:C, suggesting that Mac-1 may contribute to viral dsRNA-induced inflammation (Figure 1). A dsRNA-binding assay and a cell surface binding assay reveal that Mac-1 can recognize poly I:C on the surface of macrophages, indicating Mac-1 is a novel surface PRR for dsRNA (Figure 3). The ligand-binding ability of Mac-1 may due to intrinsic properties of the I-domain (the major binding site for Mac-1 ligands) in the CD11b subunit (44). The I-domain is known to interact with a large array of ligands. However, the binding profile of the I-domain is still unclear. The blockage of poly I:C binding by the I-domain-binding ligand fibrinogen (Figure 3B–D) and the attenuation in poly I:C internalization by the anti-CD11b antibody specific for residues 250–350 within the I-domain (Figure 4C) suggest that poly I:C may bind to the I-domain of CD11b. Structural analysis of the I-domain reveals a metal ion-dependent adhesion site (MIDAS) (44); this site is thought to prefer negative-charged groups such as aspartate or glutamate residues of ligands (e.g. ICAM-1) (18). Such coordination may also be important for the binding of the negative-charged phosphate-group of poly I:C to this domain. However, our dsRNA-binding assay indicated that the recognition was specific for dsRNA (poly I:C), not for single-stranded RNA (poly C), which indicate that the negative-charged group is not a determining factor for the binding of poly I:C to Mac-1.

We next demonstrated that Mac-1 promotes endocytosis of extracellular poly I:C. In fact, several reports have revealed the involvement of Mac-1 in the phagocytosis of its ligands (20, 42), but little is known about the underlying mechanism. For dsRNA entry, type A scavenger receptors (SR-As) can mediate its internalization in fibroblasts (6) or epithelial cells (24). Consistent with these findings, inhibitors of SR-As (fucoidan or dextran sulfate) blocked the uptake of poly I:C into macrophages (Figure S4). The reduction in poly I:C internalization in macrophages deficient in CD11b or pretreated with an anti-CD11b antibody (Figure 4A–C) indicates the participation of Mac-1 in the endocytosis of poly I:C. Thus, Mac-1 may assist or regulate the function of SR-As in the uptake of dsRNA. A recent study reported that Mac-1 and SR-As mediated phagocytosis of degenerated myelin by macrophages through a PI3K-dependent pathway (45). Blockage of poly I:C entry into macrophages by a PI3K inhibitor (Figure 4D) and attenuation of PI3K activation in CD11b−/− macrophages (Figure 4E) imply that Mac-1 facilitates the endocytosis of poly I:C through activating the PI3K pathway. The endocytosis of extracellular dsRNA is proven to be a critical step for antiviral TLR3 activation to induce type I interferon production via interferon regulatory factor 3 (IRF3) (36, 37, 46). Although TLR3 partially locates to the surface in some cell types (4749), TLR3 only binds dsRNA in the low-pH endosome (11). The reduction in poly I:C internalization (Figure 4A, B), IRF3 activation (Figure 5A) and production of type I interferon (IFN-β) in CD11b−/− macrophages (Figure 2A) indicates that Mac-1-mediated endocytosis of poly I:C participates in TLR3-dependent antiviral response.

TLR3 is a well-established receptor for extracellular dsRNA. However, extracellular dsRNA is still able to induce significant amount of multiple proinflammatory cytokines in TLR3−/− macrophages or microglia (7, 12). The TLR3-independent inflammatory responses triggered by dsRNA were confirmed by our similar findings (Figure 6G). Most importantly, the present study delineated a TLR-3 independent, but Mac-1 dependent mechanism that underlines NOX2-associated oxidative immune responses to extracellular dsRNA. Firstly, poly I:C stimulated wild-type macrophages but not macrophages deficient in Mac-1 or gp91 (the catalytic subunit of NOX2) to generate extracellular superoxide and intracellular ROS (Figure 6A, B). Secondly, TLR3−/− and wild-type macrophages released the same amount of extracellular superoxide upon poly I:C challenge (Figure 6F). Thirdly, the genetic deletion or the pharmacological inhibition of NOX2 reduced poly I:C-elicited proinflammatory cytokine production (Figure 6C, D). Fourthly, poly I:C-mediated production of proinflammatory cytokines in TLR3−/− macrophages was decreased by NOX2 inhibition of (Figure 6G). Lastly, the impaired activation of MAPKs and NFκB in macrophages deficient in Mac-1 (Figure 5B, C) or gp91 (Figure 6E) further implies that Mac-1 can induce inflammatory signaling through NOX2-induced intracellular ROS. Indeed, growing evidence has implicated an important role of intracellular ROS in inducing cellular immune responses to viral infection (5052). Two independent groups have recently shown that in airway epithelial cells treated with either poly I:C or RSV (respiratory syncytial virus) NADPH oxidase is the major source of intracellular ROS and plays a crucial role in mediating downstream cellular immune responses (53, 54). Here, we reported an important role of NOX2-associated ROS in dsRNA-mediated innate immune responses in macrophages.

In summary, the present study has demonstrated that Mac-1 acts as a novel ‘signaling PRR’ on the cell surface, sensing extracellular dsRNA. We further elucidate that poly I:C activates inflammatory oxidative enzyme NOX2 to produce ROS and to participate in the induction of proinflammatory cytokines in a TLR3-independent, but Mac-1-dependent manner. Through facilitating the internalization of poly I:C, Mac-1 activation also amplifies TLR3-dependent proinflammatory responses to dsRNA. Our results provide new insight into how macrophages recognize extracellular signals associated with lytic virus infections and identify a potential therapeutic target for virus-related inflammatory diseases.

Supplementary Material

Acknowledgments

This work was supported by the Intramural Research Program of the National Institutes of Health, the National Institute of Environmental Health Sciences.

We thank Anthony Lockhart for the assistance with animal colony management and maintenance. We also thank Dr. Monte S. Willis (University of North Carolina, Chapel Hill) for reviewing this manuscript.

Abbreviations

Mac-1
macrophage-1 antigen
poly I:C
polyinosinic:polycytidylic acid
CR3
complement receptor 3
IRF3
interferon regulatory factor 3
NOX2
phagocyte NADPH oxidase
PRRs
pattern recognition receptors
PAMPs
pathogen-associated molecular patterns
iROS
intracellular reactive oxygen species
SOD
superoxide dismutase
WST-1
2-[4-Iodophenyl]-3-[4-nitrophenyl]-5-[2,4-disulfophenyl]-2H-tetrazolium

Footnotes

Competing Interests:

The authors have declared that no competing interests exist.

References

1. Creagh EM, O’Neill LA. TLRs, NLRs and RLRs: a trinity of pathogen sensors that co-operate in innate immunity. Trends Immunol. 2006;27:352–357. [PubMed]
2. Jacobs BL, Langland JO. When two strands are better than one: the mediators and modulators of the cellular responses to double-stranded RNA. Virology. 1996;219:339–349. [PubMed]
3. Majde JA, Guha-Thakurta N, Chen Z, Bredow S, Krueger JM. Spontaneous release of stable viral double-stranded RNA into the extracellular medium by influenza virus-infected MDCK epithelial cells: implications for the viral acute phase response. Arch Virol. 1998;143:2371–2380. [PubMed]
4. Carter WA, De Clercq E. Viral infection and host defense. Science. 1974;186:1172–1178. [PubMed]
5. Majde JA. Viral double-stranded RNA, cytokines, and the flu. J Interferon Cytokine Res. 2000;20:259–272. [PubMed]
6. DeWitte-Orr SJ, Collins SE, Bauer CM, Bowdish DM, Mossman KL. An accessory to the ‘Trinity’: SR-As are essential pathogen sensors of extracellular dsRNA, mediating entry and leading to subsequent type I IFN responses. PLoS Pathog. 2010;6:e1000829. [PMC free article] [PubMed]
7. Alexopoulou L, Holt AC, Medzhitov R, Flavell RA. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature. 2001;413:732–738. [PubMed]
8. Kanneganti TD, Body-Malapel M, Amer A, Park JH, Whitfield J, Franchi L, Taraporewala ZF, Miller D, Patton JT, Inohara N, Nunez G. Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to viral infection and double-stranded RNA. J Biol Chem. 2006;281:36560–36568. [PubMed]
9. Kato H, Takeuchi O, Mikamo-Satoh E, Hirai R, Kawai T, Matsushita K, Hiiragi A, Dermody TS, Fujita T, Akira S. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med. 2008;205:1601–1610. [PMC free article] [PubMed]
10. Liao JY, Thakur SA, Zalinger ZB, Gerrish KE, Imani F. Inosine-containing RNA is a novel innate immune recognition element and reduces RSV infection. PLoS One. 2011;6:e26463. [PMC free article] [PubMed]
11. Liu L, Botos I, Wang Y, Leonard JN, Shiloach J, Segal DM, Davies DR. Structural basis of toll-like receptor 3 signaling with double-stranded RNA. Science. 2008;320:379–381. [PMC free article] [PubMed]
12. Town T, Jeng D, Alexopoulou L, Tan J, Flavell RA. Microglia recognize double-stranded RNA via TLR3. J Immunol. 2006;176:3804–3812. [PubMed]
13. Wright SD, Jong MT. Adhesion-promoting receptors on human macrophages recognize Escherichia coli by binding to lipopolysaccharide. J Exp Med. 1986;164:1876–1888. [PMC free article] [PubMed]
14. Zhang D, Hu X, Qian L, Chen SH, Zhou H, Wilson B, Miller DS, Hong JS. Microglial MAC1 receptor and PI3K are essential in mediating beta-amyloid peptide-induced microglial activation and subsequent neurotoxicity. J Neuroinflammation. 2011;8:3. [PMC free article] [PubMed]
15. Gao HM, Zhou H, Zhang F, Wilson BC, Kam W, Hong JS. HMGB1 acts on microglia Mac1 to mediate chronic neuroinflammation that drives progressive neurodegeneration. J Neurosci. 2011;31:1081–1092. [PMC free article] [PubMed]
16. Ho MK, Springer TA. Mac-1 antigen: quantitative expression in macrophage populations and tissues, and immunofluorescent localization in spleen. J Immunol. 1982;128:2281–2286. [PubMed]
17. Solovjov DA, Pluskota E, Plow EF. Distinct roles for the alpha and beta subunits in the functions of integrin alphaMbeta2. J Biol Chem. 2005;280:1336–1345. [PubMed]
18. Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002;110:673–687. [PubMed]
19. Morrison TE, Simmons JD, Heise MT. Complement receptor 3 promotes severe ross river virus-induced disease. J Virol. 2008;82:11263–11272. [PMC free article] [PubMed]
20. Benimetskaya L, Loike JD, Khaled Z, Loike G, Silverstein SC, Cao L, el Khoury J, Cai TQ, Stein CA. Mac-1 (CD11b/CD18) is an oligodeoxynucleotide-binding protein. Nat Med. 1997;3:414–420. [PubMed]
21. Perera PY, Mayadas TN, Takeuchi O, Akira S, Zaks-Zilberman M, Goyert SM, Vogel SN. CD11b/CD18 acts in concert with CD14 and Toll-like receptor (TLR) 4 to elicit full lipopolysaccharide and taxol-inducible gene expression. J Immunol. 2001;166:574–581. [PubMed]
22. Sumpter R, Jr, Loo YM, Foy E, Li K, Yoneyama M, Fujita T, Lemon SM, Gale M., Jr Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J Virol. 2005;79:2689–2699. [PMC free article] [PubMed]
23. Feng Z, Cerveny M, Yan Z, He B. The VP35 protein of Ebola virus inhibits the antiviral effect mediated by double-stranded RNA-dependent protein kinase PKR. J Virol. 2007;81:182–192. [PMC free article] [PubMed]
24. Limmon GV, Arredouani M, McCann KL, Corn Minor RA, Kobzik L, Imani F. Scavenger receptor class-A is a novel cell surface receptor for double-stranded RNA. Faseb J. 2008;22:159–167. [PubMed]
25. Loike JD, Silverstein SC. A fluorescence quenching technique using trypan blue to differentiate between attached and ingested glutaraldehyde-fixed red blood cells in phagocytosing murine macrophages. J Immunol Methods. 1983;57:373–379. [PubMed]
26. Zhou H, Zhang F, Chen SH, Zhang D, Wilson B, Hong JS, Gao HM. Rotenone activates phagocyte NADPH oxidase by binding to its membrane subunit gp91phox. Free Radic Biol Med. 2012;52:303–313. [PMC free article] [PubMed]
27. Cary LA, Guan JL. Focal adhesion kinase in integrin-mediated signaling. Front Biosci. 1999;4:D102–113. [PubMed]
28. Moissoglu K, Schwartz MA. Integrin signalling in directed cell migration. Biol Cell. 2006;98:547–555. [PubMed]
29. Schymeinsky J, Mocsai A, Walzog B. Neutrophil activation via beta2 integrins (CD11/CD18): molecular mechanisms and clinical implications. Thromb Haemost. 2007;98:262–273. [PubMed]
30. Anderson KE, Boyle KB, Davidson K, Chessa TA, Kulkarni S, Jarvis GE, Sindrilaru A, Scharffetter-Kochanek K, Rausch O, Stephens LR, Hawkins PT. CD18-dependent activation of the neutrophil NADPH oxidase during phagocytosis of Escherichia coli or Staphylococcus aureus is regulated by class III but not class I or II PI3Ks. Blood. 2008;112:5202–5211. [PubMed]
31. Araki N, Johnson MT, Swanson JA. A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages. J Cell Biol. 1996;135:1249–1260. [PMC free article] [PubMed]
32. Fujioka Y, Tsuda M, Hattori T, Sasaki J, Sasaki T, Miyazaki T, Ohba Y. The Ras-PI3K signaling pathway is involved in clathrin-independent endocytosis and the internalization of influenza viruses. PLoS One. 2011;6:e16324. [PMC free article] [PubMed]
33. Zhang F, Qian L, Flood PM, Shi JS, Hong JS, Gao HM. Inhibition of IkappaB kinase-beta protects dopamine neurons against lipopolysaccharide-induced neurotoxicity. J Pharmacol Exp Ther. 2010;333:822–833. [PubMed]
34. Steer SA, Moran JM, Christmann BS, Maggi LB, Jr, Corbett JA. Role of MAPK in the regulation of double-stranded RNA- and encephalomyocarditis virus-induced cyclooxygenase-2 expression by macrophages. J Immunol. 2006;177:3413–3420. [PubMed]
35. Saleh MC, van Rij RP, Hekele A, Gillis A, Foley E, O’Farrell PH, Andino R. The endocytic pathway mediates cell entry of dsRNA to induce RNAi silencing. Nat Cell Biol. 2006;8:793–802. [PMC free article] [PubMed]
36. Matsumoto M, Seya T. TLR3: interferon induction by double-stranded RNA including poly(I:C) Adv Drug Deliv Rev. 2008;60:805–812. [PubMed]
37. Prantner D, Darville T, Nagarajan UM. Stimulator of IFN gene is critical for induction of IFN-beta during Chlamydia muridarum infection. J Immunol. 2010;184:2551–2560. [PMC free article] [PubMed]
38. Cox D, Brennan M, Moran N. Integrins as therapeutic targets: lessons and opportunities. Nat Rev Drug Discov. 2010;9:804–820. [PubMed]
39. Beller DI, Springer TA, Schreiber RD. Anti-Mac-1 selectively inhibits the mouse and human type three complement receptor. J Exp Med. 1982;156:1000–1009. [PMC free article] [PubMed]
40. Wright SD, Rao PE, Van Voorhis WC, Craigmyle LS, Iida K, Talle MA, Westberg EF, Goldstein G, Silverstein SC. Identification of the C3bi receptor of human monocytes and macrophages by using monoclonal antibodies. Proc Natl Acad Sci U S A. 1983;80:5699–5703. [PubMed]
41. van Spriel AB, van Ojik HH, Bakker A, Jansen MJ, van de Winkel JG. Mac-1 (CD11b/CD18) is crucial for effective Fc receptor-mediated immunity to melanoma. Blood. 2003;101:253–258. [PubMed]
42. Fallman M, Andersson R, Andersson T. Signaling properties of CR3 (CD11b/CD18) and CR1 (CD35) in relation to phagocytosis of complement-opsonized particles. J Immunol. 1993;151:330–338. [PubMed]
43. Anderson DC, Springer TA. Leukocyte adhesion deficiency: an inherited defect in the Mac-1, LFA-1, and p150,95 glycoproteins. Annu Rev Med. 1987;38:175–194. [PubMed]
44. Lee JO, Rieu P, Arnaout MA, Liddington R. Crystal structure of the A domain from the alpha subunit of integrin CR3 (CD11b/CD18) Cell. 1995;80:631–638. [PubMed]
45. Makranz C, Cohen G, Baron A, Levidor L, Kodama T, Reichert F, Rotshenker S. Phosphatidylinositol 3-kinase, phosphoinositide-specific phospholipase-Cgamma and protein kinase-C signal myelin phagocytosis mediated by complement receptor-3 alone and combined with scavenger receptor-AI/II in macrophages. Neurobiol Dis. 2004;15:279–286. [PubMed]
46. Colonna M. TLR pathways and IFN-regulatory factors: to each its own. Eur J Immunol. 2007;37:306–309. [PubMed]
47. Bsibsi M, Bajramovic JJ, Vogt MH, van Duijvenvoorden E, Baghat A, Persoon-Deen C, Tielen F, Verbeek R, Huitinga I, Ryffel B, Kros A, Gerritsen WH, Amor S, van Noort JM. The microtubule regulator stathmin is an endogenous protein agonist for TLR3. J Immunol. 2010;184:6929–6937. [PubMed]
48. Matsumoto M, Kikkawa S, Kohase M, Miyake K, Seya T. Establishment of a monoclonal antibody against human Toll-like receptor 3 that blocks double-stranded RNA-mediated signaling. Biochem Biophys Res Commun. 2002;293:1364–1369. [PubMed]
49. Matsumoto M, Oshiumi H, Seya T. Antiviral responses induced by the TLR3 pathway. Rev Med Virol 2011 [PubMed]
50. Gonzalez-Dosal R, Horan KA, Rahbek SH, Ichijo H, Chen ZJ, Mieyal JJ, Hartmann R, Paludan SR. HSV infection induces production of ROS, which potentiate signaling from pattern recognition receptors: role for S-glutathionylation of TRAF3 and 6. PLoS Pathog. 2011;7:e1002250. [PMC free article] [PubMed]
51. Hu S, Sheng WS, Schachtele SJ, Lokensgard JR. Reactive oxygen species drive herpes simplex virus (HSV)-1-induced proinflammatory cytokine production by murine microglia. J Neuroinflammation. 2011;8:123. [PMC free article] [PubMed]
52. Liu T, Castro S, Brasier AR, Jamaluddin M, Garofalo RP, Casola A. Reactive oxygen species mediate virus-induced STAT activation: role of tyrosine phosphatases. J Biol Chem. 2004;279:2461–2469. [PubMed]
53. Yu M, Lam J, Rada B, Leto TL, Levine SJ. Double-stranded RNA induces shedding of the 34-kDa soluble TNFR1 from human airway epithelial cells via TLR3-TRIF-RIP1-dependent signaling: roles for dual oxidase 2- and caspase-dependent pathways. J Immunol. 2011;186:1180–1188. [PMC free article] [PubMed]
54. Jamaluddin M, Tian B, Boldogh I, Garofalo RP, Brasier AR. Respiratory syncytial virus infection induces a reactive oxygen species-MSK1-phospho-Ser-276 RelA pathway required for cytokine expression. J Virol. 2009;83:10605–10615. [PMC free article] [PubMed]