PMCCPMCCPMCC

Search tips
Search criteria 

Advanced

 
Logo of jidLink to Publisher's site
 
J Infect Dis. Nov 1, 2012; 206(9): 1372–1385.
Published online Aug 16, 2012. doi:  10.1093/infdis/jis510
PMCID: PMC3529603
Progressive Vaccinia: Case Description and Laboratory-Guided Therapy With Vaccinia Immune Globulin, ST-246, and CMX001
Edith R. Lederman,1,3a Whitni Davidson,1 Harold L. Groff,3 Scott K. Smith,1 Tyler Warkentien,2 Yu Li,1 Kimberly A. Wilkins,1 Kevin L. Karem,1 Rama S. Akondy,2 Rafi Ahmed,2 Michael Frace,1 Wun-Ju Shieh,1 Sherif Zaki,1 Dennis E. Hruby,4 Wendy P. Painter,5 Kimberly L. Bergman,6 Jeffrey I. Cohen,7 and Inger K. Damon1
1National Center for Zoonotic Vector Borne and Enteric Disease, Centers for Disease Control and Prevention
2Vaccine Center, Emory University School of Medicine, Atlanta , Georgia
3Division of Infectious Diseases, Naval Medical Center San Diego, California
4Siga Technologies, Corvallis, Oregon
5Chimerix, Durham, North Carolina
6Office of Clinical Pharmacology, Center for Drug Evaluation and Research, Food and Drug Administration, Silver Spring
7Medical Virology, National Institute of Allergy and Immunology, National Institutes of Health, Bethesda, Maryland
Published in part: Lederman E, Groff H, Warkentien T, et al. Progressive vaccinia in a military smallpox vaccinee—United States, 2009. Morb Mortal Wkly Rep 2009; 58:532–6.
aPresent affiliation: San Diego State University Graduate School of Public Health, CA.
Correspondence: Edith R. Lederman, MD, MPH, San Diego State University Graduate School of Public Health, Hardy Tower 119, 5500 Campanile Dr, San Diego, CA (erlederman/at/yahoo.com).
Received March 18, 2012; Accepted May 25, 2012.
Progressive vaccinia (PV) is a rare but potentially lethal complication that develops in smallpox vaccine recipients with severely impaired cellular immunity. We describe a patient with PV who required treatment with vaccinia immune globulin and who received 2 investigational agents, ST-246 and CMX001. We describe the various molecular, pharmacokinetic, and immunologic studies that provided guidance to escalate and then successfully discontinue therapy. Despite development of resistance to ST-246 during treatment, the patient had resolution of PV. This case demonstrates the need for continued development of novel anti-orthopoxvirus pharmaceuticals and the importance of both intensive and timely clinical and laboratory support in management of PV.
Variola virus, the causative agent of smallpox and a member of the Orthopoxvirus genus, was eradicated as a naturally occurring pathogen in 1977 [1]. The last clinical case of smallpox in the United States was in 1949. The United States eliminated its routine civilian vaccination program for smallpox in 1972 [2]; global vaccination efforts followed in 1980 after the World Health Assembly declaration of disease eradication. As a result, herd immunity against orthopoxviruses is waning globally [2]. Indeed, the accidental importation of Monkeypox virus, also an orthopoxvirus, into the Midwestern United States resulted in swift transmission and clinical illness among humans [3], even among those who had been vaccinated for smallpox prior to 1972 [4], thus confirming waning, disease-preventing [5] immunity decades after primary smallpox vaccination.
Vaccinia virus, also a member of the Orthopoxvirus genus, causes a localized infection in most healthy humans and is the active component of the smallpox vaccine. Although the smallpox vaccine is generally considered safe, patients with isolated skin conditions (eg, eczema) or systemic immune deficits (eg, human immunodeficiency virus infection, malignancy, or immunosuppression due to medications) should be exempt from current vaccination programs because of significant increased risks of adverse outcomes [6]. In addition, potential vaccinees with household contacts who have immunodeficiencies should refrain from vaccination, to avoid uncontrolled vaccinia infections in their close contacts [7]. Progressive vaccinia (PV), as described in the case below, is one such potentially life-threatening adverse event that might occur in immunocompromised individuals exposed to the smallpox vaccine. PV is, thankfully, a rare event, with 0.7–3.0 cases/million vaccinations [8].
To improve vaccine safety, studies are ongoing to discern whether administration of anti-orthopoxvirus agents at the time of vaccine administration may attenuate the infection but maintain an adequate immune response. These same agents may be of use in the treatment of rare but potentially fatal adverse outcomes in individuals who lack sufficient local and/or systemic cellular immunity [9].
Case Description
On 13 January 2009, an apparently healthy US Marine Corps member was vaccinated against smallpox with the ACAM2000 strain of vaccinia in preparation for deployment. On 25 January, he presented to a community hospital with fever and headache and was found to be neutropenic. Once stabilized, he was transferred to a regional military medical center, where he received a diagnosis of acute myelogenous leukemia (AML), subtype M0. On admission, he was noted to have a 1-cm, asymptomatic vesicle at his smallpox vaccination site, which was without surrounding erythema or regional lymphadenopathy (Figure 1A). Because of the aggressive nature of his hematologic malignancy, chemotherapy commenced immediately, and he received 2 courses of cytarabine and idarubicin. On 2 March, an infectious disease consultation was requested for persistence and enlargement of the smallpox vaccine lesion, which had expanded to 4 cm in diameter, with a central crust and thick annular bullous periphery (Figure 1B). Erythema, pain, and pruritus continued to be absent. Patient samples were submitted to the Centers for Disease Control and Prevention (CDC) for confirmatory orthopoxvirus testing.
Figure 1.
Figure 1.
Images of the smallpox vaccination site before, during, and after the patient recovered from progressive vaccinia. A, 28 January. B, 5 March. C, 27 March. D, 27 April. E, 18 June. F, 6 July. Images have been altered to remove features that might identify (more ...)
Evaluation of Samples for Vaccinia DNA or Virus and Antiviral Sensitivity
Lesion, oropharyngeal, and perirectal swab specimens, as well as blood and plasma specimens, were evaluated for the presence of orthopoxvirus DNA, using previously described real-time polymerase chain reaction (PCR) techniques [10]; lesion specimens positive for orthopoxvirus DNA by PCR were further evaluated for viable virus, using standard cell culture techniques with BSC-40 cells. Additionally, DNase I pretreatment of samples prior to evaluation by orthopoxvirus quantitative real-time PCR was done in some cases. The amount of DNA resistant to DNase was used to estimate intact viral particles. Between 30% and 40% of the orthopoxvirus DNA quantitated in a virus seed stock is DNase resistant (unpublished data). Vaccinia virus isolated from the vaccination site was investigated for antiviral resistance before and after antiviral therapies. Resistance was evaluated by generating a dose-response curve to various concentrations of antiviral drug in cells infected with twice-passaged viral isolates at a multiplicity of infection of 0.05. The effective concentrations of each drug to protect half the cells (EC50) from virus-induced destruction were calculated. Skin-punch biopsy specimens were evaluated for the presence of orthopoxvirus infection, using standard hematoxylin-eosin staining, electron microscopy preparation, and anti-orthopoxvirus immunohistochemical staining.
Evaluation of Samples for Anti-Vaccinia Immune Response
Serum specimens were evaluated for anti-orthopoxvirus immunoglobulin G (IgG) and immunoglobulin M (IgM), using an enzyme-linked immunosorbent assay previously reported [11]. T-cell number and phenotype were evaluated using flow cytometric analyses of whole blood shipped to the site in cytocheck tubes that preserve cellular phenotype. For absolute T-cell numbers, trucount tubes were used according to the manufacturer's instructions, and phenotyping was done as previously described [12, 13].
Pharmacokinetic Measurements
The patient signed informed consent documents to receive investigational agents that were provided under emergency investigational new drug (EIND) protocols approved by the Naval Medical Center San Diego Institutional Review Board and authorized by the Food and Drug Administration (FDA).
Plasma levels of ST-246 were determined using high-performance liquid chromatography (HPLC)–mass spectrometry, whereas CMX001 concentrations were analyzed using HPLC. Samples analyzed were taken 1 hour before and 4–6 hours after drug administration.
Ultradeep Sequencing
Ultradeep sequencing was performed to analyze sequence variability of a region of the F13L gene of vaccinia virus ACAM2000 (accession AY313847) after PCR amplification. A 166-base region (base pairs 778–944) was amplified using gene-specific forward (CTATTGGCCCGACATTTACAAC) and reverse (CATATTCGTCGACTATCAAC) primers that included additional 5′ extensions to allow for annealing of Roche GS-FLX Amplicon primers A and B and also contained multiplex bar code sequences. Bidirectional ultradeep sequencing was performed using a GS-FLX Sequencer (Roche 454 Life Sciences, Branford, CT) according to the manufacturer's instructions. Individual reads (range, 13 407–77 736 per sample) were analyzed by means of Roche GS Amplicon Variant Analyzer (AVA) software, using the ACAM2000 sequence as a reference.
Progressive vaccinia was confirmed [14] on 3 March, and a request for release of vaccinia immune globulin intravenous (human) (VIGIV) from the Department of Defense and the Strategic National Stockpile (SNS) at the CDC was submitted along with an EIND application for the use of oral and topical ST-246 [9]. Infusions of VIGIV from the SNS began on 4 March, while ST-246 oral and topical treatment began on 5 and 6 March, respectively. On 7 March, the patient became septic, required stress-dose corticosteroids, and was transferred to the intensive care unit. ST-246 was withheld for 24 hours; Pseudomonas aeruginosa bacteremia was identified as the cause of his deteriorating condition. Subsequent ST-246 doses were periodically increased following identification of subtarget plasma drug concentrations (target concentrations determined by efficacy studies in nonhuman primates), compared with those seen in healthy volunteers. Further VIGIV was administered at 6000 IU/kg.
Initially, the vaccination site began to respond to treatment, with drying, flattening, and cessation of enlargement, until 19 March, when satellite lesions were noted (Figure 1C). During this time, corticosteroid therapy was being slowly tapered (24 March was the final day), and periodic granulocyte colony-stimulating factor was administered. Additional VIGIV was administered to achieve a stable IgG level (Figure 2). The dosing of ST-246 was escalated to achieve target plasma concentrations, and an EIND was filed for an additional antiviral, CMX001, a prodrug of cidofovir. The patient received the first dose of CMX001 (200 mg) on 26 March. High-dose VIGIV (24 000 IU/kg) was administered in an attempt to increase the level of immunoglobulin at the site of vaccinia infection [9].
Figure 2.
Figure 2.
Anti-orthopoxvirus immunoglobulin G (IgG) and immunoglobulin M (IgM) levels. Arrows correspond to administration of vaccinia immune globulin (human) (VIGIV). VIGIV contains only gamma globulin (IgG) and therefore has no effect on increasing IgM levels. (more ...)
The patient was intermittently neutropenic until 21 April and received granulocyte colony-stimulating factor periodically to maintain an absolute neutrophil count of 1000 neutrophils/mm3. Additionally, he was noted to be lymphopenic, with absolute lymphocyte counts of <200 cells/m3 until 1 April, then stabilizing at >500 cells/mm3 by 21 April (Figure 3A–C). On 10 April, the vaccine site, which had been gradually improving, had a raised border once more; bacterial cultures revealed methicillin-resistant Staphylococcus aureus supporting superinfection of his vaccination site, rather than virologic progression. Treatment with intravenous vancomycin was initiated, and the vaccine site resumed healing. The eschars were manually debrided on 21 April with minimal bleeding, and healing continued steadily (Figure 1D). PCR failed to detect vaccinia virus DNA from swabs of the vaccine site collected on 27 April. A single-punch biopsy was performed to look for evidence of virus at the leading edge of the apparently regressing lesion. Immunohistochemical staining and PCR were both negative for orthopoxvirus. The treatment regimen was successfully de-escalated by discontinuing one agent at a time while observing the patient for any clinical indication of relapse. His entire treatment course consisted of 341 vials of VIGIV, 73 days of oral ST-246 (nearly 75 g), 68 days of topical ST-246, and 6 weekly doses of CMX001 (totaling 700 mg) (Figure 4).
Figure 3.
Figure 3.
White blood cell markers, viable virus and viral DNA load detected from the vaccine site, and viral DNA load in EDTA blood. A, White blood cell count. B, Absolute neutrophil count. C, Absolute lymphocyte count. D, Plaque-forming units per swab of the (more ...)
Figure 4.
Figure 4.
Time line of the patient's clinical course. Important landmarks in the progression of disease are found along the top portion of the time line. Medications used to treat progressive vaccinia and declining white blood cell counts can be found directly (more ...)
PCR evidence of virus levels above the limit of detection was documented in ethylenediaminetetraacetic acid–exposed blood samples from 4–8 and 22–26 March. The protocol of using DNase I pretreatment to measure the protected DNA (whole virus) versus unprotected DNA (extra-viral DNA) was used on blood samples. All samples treated with DNase prior to DNA extraction were negative by PCR (Figure 3F), with the exception of a 22 March sample (concomitant with the appearance of satellite lesions), consistent with free viral DNA (rather than encapsulated viral DNA) in the blood. In addition, oropharyngeal samples (from 5 March) and rectal swab samples (from 6 March) were negative for orthopoxvirus DNA. On 2 April, the lesion was free of viable virus.
No adverse events were clearly attributable to any investigational therapy. The patient experienced emesis and 1 bout of bloody diarrhea within hours after the first dose of CMX001, but he was thrombocytopenic at the time, and he did not experience any emesis or bleeding with subsequent doses.
Flow cytometry–based analysis was done on 2 April, 22 April, and 28 May to analyze circulating lymphocytes. Initial analysis on 2 April showed that overall the absolute numbers of CD4+ T cells, CD8+ T cells, and natural killer (NK) cells were well below the range present in healthy individuals, while CD19+ B cells were completely absent (Table 1). This likely reflected the effects of chemotherapy. Analysis also showed that despite lower absolute numbers, both CD4+ and CD8+ T cells were proliferating, as evidenced by expression of the cell cycle marker Ki-67, and expressed high levels of the activation markers HLA-DR and CD38. Together with the decreased expression of the anti-apoptotic protein Bcl-2, these characteristics are indicative of a potent, short-lived effector T-cell response (Table 1). Although the frequency of activated cells was comparable to that seen in an effector response in a healthy Dryvax recipient [12], who developed immunity and was of the same age group, sex, and race as the patient (Figure 5B.), we estimate that the absolute number of activated CD8+ T cells (approximately 32 cells/μL of blood) was 3–10-fold lower than that in the healthy Dryvax control. Analysis on 22 April and 28 May showed that absolute cell numbers of T, B, and NK cells had increased, although they were still below the range seen in healthy adults. T-cell proliferation and the activated T-cell phenotype were reduced by 22 April but still much higher than baseline levels seen in any healthy adult (<1% of CD4+ or CD8+ T cells).
Table 1.
Table 1.
Absolute Cell Counts in Whole-Blood Specimens From the Patient With Progressive Vaccinia and a Healthy Donor Control
Figure 5.
Figure 5.
A, T-cell response to vaccinia infection. Boxed numbers represent the percentage of cells specific to the vaccinia cytotoxic T-lymphocyte epitope. Effector response is measured approximately 2 weeks after vaccination. During this time, vaccinia virus–specific (more ...)
Because the patient was HLA-A2 positive, we were able to track the CD8 T cells recognizing a vaccinia virus cytotoxic T-lymphocyte epitope, using HLA-A2 restricted VVCLT tetramers [15]. Initial VVCLT tetramer frequencies were high (1% of total CD8+ T cells) and decreased (0.2% of total CD8+ T cells) by 28 May. The VVCLT tetramer–positive CD8+ T cells on 2 April were also highly activated (Ki-67+, BCl-2lo, HLA-DR+, CD38+, and Granzyme B+) and lost this phenotype by 28 May. This differentiation was similar to that of the VVCLT-specific effector and memory CD8+ T cells in the healthy Dryvax vaccinee. In summary, the initial activation was consistent with a vigorous virus-induced T-cell response that seemed to wane as the virus was controlled (Figure 5A.) [12, 16].
In addition to the hospital course as delineated above, the patient also developed gangrene as a consequence of pseudomonal sepsis and underwent below-the-knee amputations of both legs on 14 April. He was discharged in stable condition on 28 May. During follow-up, the former site of PV continued to remain quiescent and well healed (Figure 1E and 1F). On 24 July, he underwent allogeneic stem cell transplantation and to date remains free of vaccinia infection and of AML. His anti-orthopoxvirus IgM and IgG titers were negligible when evaluated 6 months following his allogeneic stem cell transplantation.
The apparent ST-246 EC50 of virus samplings from the vaccination site lesion from 23 March (EC50 = 0.95 µM) and March 31 (EC50 = 3.55 µM) were 13.5-fold and 50-fold, respectively, greater than that seen with the virus isolated prior to institution of ST-246 therapy on 2 March (EC50 = 0.07 µM). Minimal changes in apparent ST-246 EC50 were observed in evaluation of virus samplings from satellite lesions from 23 March (EC50 = 0.06 µM) or 31 March (EC50 = 0.14 µM). No resistance to CMX001 was observed in comparing virus samplings from 23 and 31 March (3 days prior to and 5 days after initiation of CMX001). Ultradeep sequencing at >20 000-fold coverage of a region of the F13 gene (nucleotides 778–944), the only known target of ST-246 (unpublished data, Siga Technologies), and analysis using the GS Amplicon Variant Analyzer were performed. An extremely low level of single-nucleotide polymorphism (SNP) variation, 0.28%–0.43% of the population amplified, was identified in numerous SNPs across that region sequenced. Random SNP variation was present in vaccination site and satellite lesion samples from 2, 29, and 31 March without significant change in frequency of appearance of any of these individual SNPs in these samples (Table 2). All changes were SNPs, and these low-frequency-level changes were all transitions. Although a G277C amino acid change resulting from a SNP at nucleotide 831 has been previously reported to be associated with resistance to ST-246 [17], analysis of the predicted protein sequence in these isolates did not reveal evidence of the G277C mutation. However, 2 specific predicted amino acid changes (from alanine to valine [amino acid 290] and from leucine to methionine [amino acid 315]) were observed in increasing frequency in the population between the material sequenced from the vaccination site on 23 March (3% and 7%, respectively) and 31 March (31% and 10%, respectively). These changes were not observed at levels above the limit of analysis (0.1% of the population) in the predicted protein sequences from the vaccination site samples sequenced from 2 March, nor from the satellite lesions sequenced from 23 or 31 March.
Table 2.
Table 2.
Percentage Nucleotide Variability and Change at a Partial Nucleotide Within the Vaccinia Virus F13L Gene
This case of successfully treated progressive vaccinia represents one of the most intensively studied orthopoxvirus infections in a single patient and is instructive from scientific and logistic perspectives. We used a laboratory-based approach to guide therapy, including when to intensify and when to stop treatment; in addition, we were able to analyze live virus before and after exposure to 2 investigational anti-orthopoxvirus agents and determine whether drug-resistant virus mutations had developed. Of concern, resistance to ST-246 was noted to develop late in disease, after protracted subtarget levels of systemic therapy and concomitant topical preparation. The aggregate level of resistance was less than that seen previously in a clonal, laboratory-derived resistant virus [17]. Studies are underway to understand whether the genetic variants observed to accumulate were responsible for the observed resistance. Interestingly, an increased EC50 was not observed in the satellite lesions. This might represent sampling error (only 4 lesions were swabbed) or might be related to selective pressure.
This case emphasizes the susceptibility of immunocompromised hosts to orthopoxvirus infections, even to the fully replicative viruses used in smallpox vaccines. Although we cannot delineate the contribution of any one agent to the patient's cure, we can with some certainty hypothesize that cure was dependent on recovery of immune system function. Immune reconstitution has been integral to ultimate recovery in previously described cases of progressive vaccinia [18].
The anti-orthopoxvirus agents the patient received apparently restricted viral progression enough to allow for recovery from pancytopenia, exogenous corticosteroid exposure, and malnutrition/deconditioning that had developed during his intense induction chemotherapy and pseudomonal sepsis. After appearance of satellite lesions (on 19 March), recovery of the absolute lymphocyte count (in contrast to absolute neutrophil or total white blood cell count) to levels of at least 100 cells/mm3 (on 25 March) and cessation of corticosteroids (on 24 March) appeared to correlate with initial vaccinia virus clearance. No infectious virus was detected (limit of detection, 80 or 160 plaque-forming units) after absolute lymphocyte counts of >200 cells/mm3 were achieved. T-cell studies revealed that although reduced numbers of T cells were present, a substantial fraction of those present were highly activated and targeted for vaccinia virus. The proportion of activated T cells waned with clinical recovery likely related to viral clearance. During this period, he was also receiving 3 anti-orthopoxvirus agents (ST2–46, CMX001, and VIGIV). Prior to recovery of his immune system, our patient required more VIGIV than that known to have been required by any patient to date, placing unanticipated demands on both military and federal stockpiles. This raises the question of potential demand for biologics like VIGIV in the event of an intentional orthopoxvirus release among the general population, in which multiple immunocompromised hosts may be simultaneously exposed, and the need for less reactogenic vaccines to prevent infection. We found that by measuring sequential anti-orthopoxvirus IgG and quantitative immunoglobulin levels as pharmacokinetic surrogates, we were able to prescribe VIGIV more judiciously; despite use of quantitative testing, the toll on the SNS from this single patient was noticeable. In addition, monoclonal antibodies may provide an alternative to VIGIV in the future [19]. However, no products are currently commercially available.
Although the patient was cured, the individual contribution of any single intervention we used is difficult to ascertain. Two anti-orthopoxvirus pharmaceuticals were used under EINDs, authorized by the FDA. The ST-246 oral formulation was used in 1 ill subject with eczema vaccinatum [9], and the dose and drug levels correlated well with the subject's weight; our subject required larger doses than anticipated for reasons that are not entirely clear but may be related to low bioavailability due to poor intestinal absorption (resulting from absence of food that enhances absorption and/or reduced splanchnic perfusion). Another patient who was receiving immunosuppressive medication and developed vaccinia virus infection of the hands also received ST-246, temporarily ceased use of immunosuppressive medications, and had a good clinical outcome [20].
We also applied a topical formulation of ST-246 to the vaccine site lesion; our patient is the first human to receive such a topical preparation. The use of such a preparation in an immunocompetent vaccinee could potentially reduce shedding and increase the time to healing without impairing the systemic response (ie, vaccine efficacy). CMX001, an orally bioavailable prodrug of cidofovir that has activity against DNA viruses, had never been given to an ill human subject with an orthopoxvirus infection before but was well tolerated in our patient; anticipated plasma levels were achieved, but this agent was given to the patient 2 weeks after his critical illness (pseudomonal sepsis) had resolved. Both agents are virustatic rather than virucidal but likely provided enough anti-orthopoxvirus activity to allow for stabilization of his vaccinia virus infection, followed by virologic cure with immune system reconstitution. In the future, in such severely ill patients, combination therapy may best be initiated at the outset, which might reduce the viral load and subsequent development of antiviral resistance mutations, and pharmacokinetics may need to be closely monitored to best manage therapy, especially in critically ill patients with unpredictable intestinal absorption. Combination therapy with these 2 drugs, which have different mechanisms of action, might be more effective, because ST-246 and CMX001 have been shown to be synergistic for treatment of orthopoxviruses in vitro and in mice [21, 22]. Vaccinia virus and vaccinia viral DNA measurements were used to monitor disease and guide therapy. Viral DNA in blood was, at one point, a harbinger of disease recrudescence after corticosteroid use. The ultimate length of treatment, however, may have been greater than what was actually needed. The treatment duration was extended in this case until clearance of viral DNA from the vaccination site and satellite lesions (Figure 3D and 3E), which was 2–3 weeks after clearance of infectious virus.
In summary, this case of progressive vaccinia provided us with a rare opportunity to use promising anti-orthopoxvirus agents in a critical care setting, as well as to evaluate the potential effects of drug exposure to resistance selection in the presence of actively replicating vaccinia virus. The development of additional anti-orthopoxvirus agents is necessary given that the currently available, although not licensed for orthopoxvirus use, options (ie, intravenous cidofovir) have significant toxicity. Because the current biologics are costly and in limited supply, the use of orthopoxvirus diagnostic tests may provide guidance as to when therapy is most needed and when it may be safely discontinued. Further studies on the significance of detecting viral DNA at various sites compared with infectious virus at these sites will also aid in decisions on how these laboratory tools can best be used in case management.
Notes
Acknowledgments. We thank the following experts who contributed to the clinical decision making during the care of this patient: Dr Michael Lane, Dr Vincent Fulginiti, Dr Debra Birnkrant, Dr Renata Engler, Dr Limone Collins, and Dr Robert Morrow.
Disclaimer. The views expressed in this manuscript are the authors and do not necessarily reflect the official policy or position of the US Department of the Navy, the US Department of Defence, or the US Government.
Financial support. This work was supported by the intramural research program of the National Institute of Allergy and Infectious Diseases (to J. I. C.).
Potential conflicts of interest. D. E. H. is the chief scientific officer of Siga Technologies. W. P. P. is the chief medical officer of Chimerix. All other authors report no potential conflicts.
All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of this manuscript have been disclosed.
1. World Health Organization. Declaration of global eradication of smallpox. Wkly Epidemiol Rec. 1980;55:145–52.
2. Henderson DA, Inglesby TV, Bartlett JG, et al. Smallpox as a biological weapon: medical and public health management. Working Group on Civilian Biodefense. JAMA. 1999;281:2127–37. [PubMed]
3. Reynolds MG, Yorita KL, Kuehnert MJ, et al. Clinical manifestations of human monkeypox influenced by route of infection. J Infect Dis. 2006;194:773–80. [PubMed]
4. Hammarlund E, Lewis MW, Hansen SG, et al. Duration of antiviral immunity after smallpox vaccination. Nat Med. 2003;9:1131–7. [PubMed]
5. Karem K, Reynolds M, Hughes C, et al. Monkeypox-induced immunity and failure of childhood smallpox vaccination to provide complete protection. Clin Vaccine Immunol. 2007;14:1318–27. [PMC free article] [PubMed]
6. Cono J, Casey C, Bell DM. Smallpox vaccination and adverse reactions. Morb Mortal Wkly Rep. 2003;52:1–28. [PubMed]
7. Centers for Disease Control and Prevention. Household transmission of vaccinia virus from contact with a military smallpox vaccine. Morb Mortal Wkly Rep. 2007;56:471–81. [PubMed]
8. Lane JM, Ruben FL, Neff JM, Millar JD. Complications of smallpox vaccination, 1968. N Engl J Med. 1969;281:1201–8. [PubMed]
9. Vora S, Damon I, Fulginiti V, et al. Severe eczema vaccinatum in a household contact of a smallpox vaccinee. Clin Infect Dis. 2008;46:1555–61. [PubMed]
10. Li Y, Olson VA, Laue T, Laker MT, Damon IK. Detection of monkeypox virus with real-time PCR assays. J Clin Virol. 2006;36:194–203. [PubMed]
11. Karem KL, Reynolds M, Braden Z, et al. Characterization of acute-phase humoral immunity to monkeypox: use of immunoglobulin M enzyme-linked immunosorbent assay for detection of monkeypox infection during the 2003 North American outbreak. Clin Diagn Lab Immunol. 2005;12:867–72. [PMC free article] [PubMed]
12. Miller JD, van der Most RG, Akondy RS, et al. Human effector and memory CD8+ T cell responses to smallpox and yellow fever vaccines. Immunity. 2008;28:710–22. [PubMed]
13. Guarner J, Johnson BJ, Paddock CD, et al. Monkeypox transmission and pathogenesis in prairie dogs. Emerg Infect Dis. 2004;10:426–31. [PMC free article] [PubMed]
14. Nell P, Kohl KS, Graham PL, et al. Progressive vaccinia as an adverse event following exposure to vaccinia virus: case definition and guidelines of data collection, analysis, and presentation of immunization safety data. Vaccine. 2007;25:5735–44. [PubMed]
15. Terajima M, Cruz J, Raines G, et al. Quantitation of CD8+ T cell responses to newly identified HLA-A*0201-restricted T cell epitopes conserved among vaccinia and variola (smallpox) viruses. J Exp Med. 2003;197:927–32. [PMC free article] [PubMed]
16. Chng WJ, Tan GB, Kuperan P. Establishment of adult peripheral blood lymphocyte subset reference range for an Asian population by single-platform flow cytometry: influence of age, sex, and race and comparison with other published studies. Clin Diagn Lab Immunol. 2004;11:168–73. [PMC free article] [PubMed]
17. Yang G, Pevear DC, Davies MH, et al. An orally bioavailable antipoxvirus compound (ST-246) inhibits extracellular virus formation and protects mice from lethal orthopoxvirus challenge. J Virol. 2005;79:13139–49. [PMC free article] [PubMed]
18. Bray M, Wright ME. Progressive vaccinia. Clin Infect Dis. 2003;36:766–74. [PubMed]
19. Lustig S, Fogg C, Whitbeck JC, Eisenberg RJ, Cohen GH, Moss B. Combinations of polyclonal or monoclonal antibodies to proteins of the outer membranes of the two infectious forms of vaccinia virus protect mice against a lethal respiratory challenge. J Virol. 2005;79:13454–62. [PMC free article] [PubMed]
20. Human vaccinia infection after contact with a raccoon rabies vaccine bait––Pennsylvania, 2009. MMWR Morb Mortal Wkly Rep. 2009;58:1204–7. [PubMed]
21. Quenelle DC, Prichard MN, Keith KA, et al. Synergistic efficacy of the combination of ST-246 with CMX001 against orthopoxviruses. Antimicrob Agents Chemother. 2007;51:4118–24. [PMC free article] [PubMed]
22. Chen N, Bellone CJ, Schriewer J, et al. Poxvirus interleukin-4 expression overcomes inherent resistance and vaccine-induced immunity: pathogenesis, prophylaxis, and antiviral therapy. Virology. 2011;409:328–37. [PMC free article] [PubMed]
Articles from The Journal of Infectious Diseases are provided here courtesy of
Oxford University Press